Dual real-time fluorescent PCR kit for identifying mycoplasma mycoides subsp. mycoides and mycoplasma bovis and its special oligonucleotide combination

Abstract

The application discloses a double real-time fluorescent PCR kit for identifying Mycoplasma mycoides subsp. mycoides and Mycoplasma bovis and a special oligonucleotide combination thereof, and belongs to the field of veterinary animal pathogen detection in biological detection technology. The special primers and probes in the kit are respectively designed according to specific and conservative sequences of the SC type of Mycoplasma mycoides subsp. mycoides and Mycoplasma bovis, and can not only double detect Mycoplasma mycoides subsp. mycoides and Mycoplasma bovis with high sensitivity, but also have strong specificity and good repeatability. Moreover, the amplification sequence fragments of the two can be used as positive quality control products for judging whether the sample to be detected is contaminated, so that the accuracy of the detection result is improved, and the kit can play a role in the fields of epidemic investigation, disease monitoring and purification.

Description

Technical Field

[0001] This invention belongs to the field of veterinary animal pathogen detection in the field of biological detection technology, specifically relating to a dual real-time fluorescent PCR kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis and its dedicated oligonucleotide combination (including primers, probes and optional positive control). Background Technology

[0002] Mycoplasma mycoides subsp. Mycoides SC, MmmSC and Mycoplasma bovis, M. bovis, both belong to the genus Mycoplasma in the family Mycoplasmataceae.

[0003] MmmSC causes a serious, contagious disease called bovine contagious pleuropneumonia (also known as "bovine pleuropneumonia"). This pathogen can infect cattle of all ages, sexes, and breeds. Infected cattle and carriers (in the chronic infection phase) are the main sources of MmmSC infection. Because cattle recovering from the acute and chronic phases often exhibit subclinical symptoms or become long-term carriers, the prevention and eradication of bovine contagious pleuropneumonia are extremely difficult.

[0004] M bovis can cause pneumonia, mastitis, arthritis, reproductive tract inflammation, keratoconjunctivitis, and even abortion and infertility in cattle. Currently, M bovis is a significant pathogen threatening the health of calves, with high infection and mortality rates. Even if infected cattle survive, they often experience stunted growth, severely impacting yield and quality. Furthermore, M bovis can cause secondary infections with other pathogens, resulting in substantial losses for my country's cattle industry.

[0005] Therefore, closely monitoring and effectively identifying the infection status of MmmSC and M bovis in cattle herds is particularly important for the development of my country's cattle industry.

[0006] Because both MmmSC and M. bovis are highly pathogenic to cattle and exhibit similar clinical symptoms and pathological changes, it is difficult to distinguish between the two infections. Therefore, it is necessary to rely on relevant detection methods or kits. For example, Liu Yang et al. (Liu Yang et al., Establishment of a Duplex PCR Detection Method for Bovine Mycoplasma, Chinese Journal of Preventive Veterinary Medicine, Vol. 32, No. 8, August 2010, hereinafter referred to as the literature) established a dual PCR detection method to distinguish between M. bovis and MmmSC. The sensitivity test results showed that the lowest concentration of M. bovis and MmmSC cultures detected by this method was 10. 6 cfu / mL and 10 5cfu / mL. Li Dawei et al. (Li Dawei et al., Establishment and Preliminary Application of Triple PCR Detection Method for Small Clones of Mycoplasma bovis, Mycoplasma agalactiae, and Mycoplasma filamentum subsp. filamentum, Journal of Animal Husbandry and Veterinary Medicine, 2011, 42(2): 306-310, hereinafter referred to as Reference 2) established a triple PCR diagnostic method that can distinguish between small clones of Mycoplasma bovis, Mycoplasma filamentum subsp. filamentum, and Mycoplasma agalactiae in a single step. The detection limits for Mycoplasma bovis and Mycoplasma filamentum subsp. filamentum were 0.8 ng / μL and 0.5 ng / μL, respectively. However, the methods in Reference 1 and Reference 2 are both multiplex conventional PCR methods, which have low detection sensitivity and low detection efficiency for Mycoplasma bovis and Mycoplasma filamentum subsp. filamentum. In addition, during the use of existing test kits, various factors often lead to the contamination of samples by positive control samples in the kits, which cannot be identified, often resulting in erroneous or unreliable test results and interfering with the timely implementation of effective prevention and control measures. Summary of the Invention

[0007] To address one or more problems existing in the prior art, one aspect of the present invention provides an oligonucleotide combination for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis, comprising dual real-time fluorescent PCR primers and a TaqMan probe for detecting Mycoplasma filamentosa subspecies and Mycoplasma bovis, wherein:

[0008] The PCR primers include: an upstream primer (MmmSC-F) and a downstream primer (MmmSC-R) for detecting Mycoplasma filamentosa subspecies, wherein the nucleotide sequence of the upstream primer (MmmSC-F) is shown in SED ID NO: 1, and the nucleotide sequence of the downstream primer (MmmSC-R) is shown in SED ID NO: 2; and an upstream primer (M.Bovis-F) and a downstream primer (M.Bovis-R) for detecting Mycoplasma bovis, wherein the nucleotide sequence of the upstream primer (M.Bovis-F) is shown in SED ID NO: 3, and the nucleotide sequence of the downstream primer (M.Bovis-R) is shown in SED ID NO: 4;

[0009] The TaqMan probes include: a TaqMan probe (MmmSC-P) for detecting Mycoplasma filamentosa, the nucleotide sequence of which is shown in SED ID NO: 5; and a TaqMan probe (M. Bovis-P) for detecting Mycoplasma bovis, the nucleotide sequence of which is shown in SED ID NO: 6.

[0010] In some embodiments, the TaqMan probe is fluorescently labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end. Optionally, the fluorescent reporter group can be selected from FAM, HEX, ROX, JOE, TET, Cy3, Cy5, and TAMRA, and the fluorescent quencher group can be selected from BHQ1, BHQ2, BHQ3, Dabcyl, and QYS7. However, the emission spectra of the fluorescent reporter groups labeled with TaqMan probe (MmmSC-P) and TaqMan probe (M.Bovis-P) should be far apart to avoid interference.

[0011] In some embodiments, the oligonucleotide combination also includes a positive control.

[0012] The positive control products include two types of positive control products, one for *Mycoplasma filamentosa* subsp. *filamentosa* and the other for *Mycoplasma bovis*. The positive control product for *Mycoplasma filamentosa* subsp. *filamentosa* contains the nucleotide sequence shown in SEQ ID NO: 9, and the positive control product for *Mycoplasma bovis* contains the nucleotide sequence shown in SEQ ID NO: 10; or

[0013] The positive control is a positive control that is effective against both Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, and contains the nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10.

[0014] Preferably, the nucleotide sequence of the positive control sample has the general formula: R1-R2-R3-R4-R5-R6-R7; wherein:

[0015] R1 is empty, or any segment of length 1-118 in the sequence shown in SEQ ID NO: 11;

[0016] R2 is the sequence shown in SEQ ID NO: 9;

[0017] R3 is empty, or any segment of length 1-58 in the sequence shown in SEQ ID NO: 12;

[0018] R4 is empty, or selected from restriction sites other than BglⅡ and EcoRI;

[0019] R5 is empty, or any segment of length 1-24 in the sequence shown in SEQ ID NO: 13;

[0020] R6 is the sequence shown in SEQ ID NO: 10;

[0021] R7 can be empty, or any segment of length 1-30 in the sequence shown in SEQ ID NO: 14.

[0022] Another aspect of the present invention provides a positive control for identifying Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis, comprising two positive control samples for Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis respectively, wherein the positive control sample for Mycoplasma filamentum subsp. filamentum contains the nucleotide sequence shown in SEQ ID NO: 9, and the positive control sample for Mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO: 10;

[0023] Optionally, the nucleotide sequence of the positive control for Mycoplasma filamentosa subspecies is: R1-R2-R3(I);

[0024] The general nucleotide sequence formula of the positive control for bovine mycoplasma is: R5-R6-R7(II);

[0025] or

[0026] The positive control is a positive control that is effective against both Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, and contains the nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10.

[0027] Optionally, the nucleotide sequence of the positive control is of the general formula: R1-R2-R3-R4-R5-R6-R7(III);

[0028] In general formula (I), general formula (III) and / or general formula (III),

[0029] R1 is empty, or any segment of length 1-118 in the sequence shown in SEQ ID NO: 11;

[0030] R2 is the sequence shown in SEQ ID NO: 9;

[0031] R3 is empty, or any segment of length 1-58 in the sequence shown in SEQ ID NO: 12 below;

[0032] R4 is empty, or selected from restriction sites other than BglⅡ and EcoRI;

[0033] R5 is empty, or any segment of length 1-24 in the sequence shown in SEQ ID NO: 13;

[0034] R6 is the sequence shown in SEQ ID NO: 10;

[0035] R7 can be empty, or any segment of length 1-30 in the sequence shown in SEQ ID NO: 14.

[0036] The application of the oligonucleotide combination or the positive control in the preparation of detection products for identifying Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis is also within the scope of this invention.

[0037] In another aspect, the present invention provides a dual real-time fluorescence PCR kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis, comprising the aforementioned oligonucleotide combination; preferably, the dual real-time fluorescence PCR kit further comprises the aforementioned positive control.

[0038] In another aspect, the present invention provides a method for identifying and detecting Mycoplasma filamentosa subsp. and Mycoplasma bovis for non-disease diagnostic purposes, comprising the following steps:

[0039] S1: Extract genomic DNA from the sample to be tested, and use the extracted genomic DNA as a template to perform dual real-time fluorescence PCR detection under the guidance of the oligonucleotide combination.

[0040] S2: The specific amplification curves and Ct values ​​were used to distinguish and detect Mycoplasma filamentosa subsp. and Mycoplasma bovis.

[0041] In some embodiments, the system for dual real-time fluorescence PCR detection in step S1 includes: 1-3 μL of DNA template, 8-12 μL of 2×Premix Ex Taq real-time fluorescence PCR reaction solution, 0.5-1.0 μL each of 10 μmol / L upstream primer (MmmSC-F) and downstream primer (MmmSC-R), 0.5-1.0 μL of 10 μmol / L TaqMan probe (MmmSC-P), 0.7-1.0 μL each of 10 μmol / L upstream primer (M.Bovis-F) and downstream primer (M.Bovis-R), 0.8-1.0 μL of 10 μmol / L TaqMan probe (M.Bovis-P), and 2-4 μL of ddH2O; and / or

[0042] The PCR reaction conditions for dual real-time fluorescence PCR detection in step S1 are: 95℃ for 30s; 95℃ for 10s, 56℃ for 30s, for a total of 40 cycles. Fluorescence signal detection is performed at the end of the annealing process in each cycle; and / or

[0043] The principle for identification detection in step S2 is as follows:

[0044] If the sample to be tested shows a typical amplification curve only in the signal channel labeled by the TaqMan probe (MmmSC-P) and the Ct value is <40.0, the result is determined to be positive for Mycoplasma filamentosa subsp. nucleic acid.

[0045] If the sample to be tested shows a typical amplification curve only in the signal channel labeled by the TaqMan probe (M. Bovis-P) and the Ct value is <40.0, the result is determined to be positive for bovine mycoplasma nucleic acid;

[0046] If the sample to be tested shows typical amplification curves in both the signal channels labeled by TaqMan probe (MmmSC-P) and TaqMan probe (M.Bovis-P), and the Ct value is <40.0, then the result is determined to be positive for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid.

[0047] If the sample to be tested has no Ct value, or a Ct value ≥ 40, or no typical amplification curve, the result is determined to be negative for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid.

[0048] In some implementations, the method further includes the following steps:

[0049] S3: qPCR products with positive nucleic acid results were recovered by gel extraction and subjected to enzyme digestion for identification. The enzyme digestion reaction system for positive qPCR gel products from *Mycoplasma filamentosa* subsp. *filamentosa* was as follows: 1-2 μg of qPCR gel product, 0.2-1 μL of 10 U / μL BglⅡ, 2 μL of 10×H Buffer, and ddH2O to a final volume of 20 μL. The enzyme digestion reaction system for positive qPCR gel products from *Mycoplasma bovis* was as follows: 1-2 μg of qPCR gel product, 0.2-1 μL of 15 U / μL EcoRI, 2 μL of 10×H Buffer, and ddH2O to a final volume of 20 μL.

[0050] S4: Determine whether the sample to be tested is contaminated by positive quality control products based on the enzyme digestion identification results.

[0051] In some embodiments, the reaction conditions for enzyme digestion identification in step S3 are as follows: for the enzyme digestion reaction of positive qPCR gel recovery products of Mycoplasma filamentosa subsp. filamentosa, the enzyme digestion reaction conditions are 30±1℃ for 1-2h; for the enzyme digestion reaction of positive qPCR gel recovery products of Mycoplasma bovis, the enzyme digestion reaction conditions are 37±1℃ for 1-2h.

[0052] In some embodiments, the determination principle in step S4 is as follows: if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma filamentosa subsp. filamentosa show both 35bp and 64bp bands on the agarose gel, the sample to be tested is determined to be contaminated by the positive quality control; if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma bovis show both 63bp and 84bp bands on the agarose gel, the sample to be tested is determined to be contaminated by the positive quality control.

[0053] The dual real-time fluorescent PCR primers and probes provided by the above technical solutions for identifying Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis are optimized for the SC sequence of Mycoplasma filamentum subsp. filamentum and the uvrC sequence of Mycoplasma bovis, respectively. This allows for highly sensitive dual detection of both Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis, with high specificity and good reproducibility. Furthermore, the amplification products, with minor modifications, can be used as positive control samples to determine whether the test sample is contaminated, thus achieving more accurate qualitative and quantitative detection. Therefore, the kit provided by this invention, including the above primers and probes, and optional positive control samples, can provide strong evidence for the investigation of the main prevalence of clinical pathogens and for disease monitoring and eradication.

[0054] The present invention has the following advantages:

[0055] (1) High sensitivity: The method and kit of this invention have a detection limit of 11.495 copies / μL for MmmSC and M. Bovis nucleic acids, which is 1000 times more sensitive than ordinary PCR methods; Good specificity: The method specifically targets the MmmSC and M. Bovis genomes and generates corresponding fluorescent amplification signals. Verification showed no cross-reactivity with Mycoplasma capurians subsp., Mycoplasma ovis pneumoniae, Brucella bovis strain A19, Clostridium perfringens, Streptococcus suis type 2, Bovine infectious rhinotracheitis virus, Bovine viral diarrhea virus, Bovine enterovirus, Junin virus, and Bovine Hungarian virus-related disease viruses.

[0056] (2) Rapid and high-throughput: The detection speed is fast, and the entire amplification and detection process can be completed within 1.5 hours after adding the DNA nucleic acid of the sample to be tested. Depending on the number of detection wells of the real-time PCR instrument, up to 384 samples can be detected simultaneously at one time.

[0057] (3) Simple operation: Two types of mycoplasma can be detected and identified simultaneously in one reaction. The entire amplification and result determination can be completed by placing the prepared TaqMan dual fluorescence PCR reaction system into a real-time PCR instrument. At the same time, artificially designed and synthesized nucleic acid fragments are used as positive control materials, which are easy to obtain, conducive to biosafety, and can reduce the pollution of the experimental environment.

[0058] (4) Elimination of contamination by positive control samples: The sequences of Mycoplasma filamentosa subsp. and Mycoplasma bovis fragments in the positive control samples provided by this invention have been artificially modified. The modified Mycoplasma filamentosa subsp. fragment sequence contains a BglⅡ restriction site, and the modified Mycoplasma bovis fragment sequence contains an EcoRI restriction site. Therefore, the fluorescently positive qPCR products can be detected by enzyme digestion identification to determine whether the test sample is contaminated by the positive control samples, thereby improving the accuracy of detection. Attached Figure Description

[0059] Figure 1 The electrophoresis results of the positive plasmids SEQ ID NO: 9 and SEQ ID NO: 10 prepared in this invention are shown, where lane 1 is a 2000bp marker; lane 2 represents the positive plasmid SEQ ID NO: 10; and lane 3 represents the positive plasmid SEQ ID NO: 9.

[0060] Figure 2A and Figure 2B The dual fluorescence PCR method of the present invention is used to amplify the MmmSC and M. bovis positive control samples of different concentrations, where 1: working standard 1; 2: working standard 1; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8; 9: working standard 9; 10: working standard 10; 11: working standard 11; 12: H2O.

[0061] Figure 3A and Figure 3B Electrophoresis images of MmmSC and M. bovis in positive control samples of varying concentrations using conventional PCR methods are shown. Lane 1: Working Standard 1; Lane 2: Working Standard 1; Lane 3: Working Standard 3; Lane 4: Working Standard 4; Lane 5: Working Standard 5; Lane 6: Working Standard 6; Lane 7: Working Standard 7; Lane 8: Working Standard 8; Lane 9: Working Standard 9; Lane 10: Working Standard 10; Lane 11: Working Standard 11; Lane N: H2O.

[0062] Figure 4 and Figure 5 The dual fluorescence PCR method of the present invention is for the standard curves of MmmSC and M. bovis, respectively, where 1: working standard 1; 2: working standard 1; 3: working standard 3; 4: working standard 4; 5: working standard 5; 6: working standard 6; 7: working standard 7; 8: working standard 8; 9: working standard.

[0063] Figure 6 The figure shows the specificity test results of the dual fluorescence PCR method of the present invention, where 1: MmmSC; 2: M. bovis; 3: Mycoplasma filamentosa (capsule subsp.); 4: Mycoplasma ovis (sheep pneumonia); 5: Brucella bovis A19 strain; 6: Clostridium perfringens; 7: Streptococcus suis type 2; 8: Bovine infectious rhinotracheitis virus; 9: Bovine viral diarrhea virus; 10: Bovine enterovirus; 11: Junin virus; 12: Bovine Hungarian virus; 13: H2O. Detailed Implementation

[0064] Given the shortcomings of existing methods and kits for identifying and detecting Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis in terms of low sensitivity and efficiency, this invention utilizes TaqMan probe-based quantitative real-time PCR technology. By using the differential regions of the Mycoplasma filamentum subsp. filamentum SC gene sequences 454115 to 454389 (CP002107.1) and the Mycoplasma bovis uvrC gene sequences 825959 to 827674 (CP042939.1) as molecular markers, primer and probe combinations for high-sensitivity and high-throughput identification and detection of Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis were designed and screened. Furthermore, during analysis of the amplified fragment sequences of Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis, the inventors discovered that mutating the base T to base A at position 64 of the amplified fragment sequence (SEQ ID NO: 7) of Mycoplasma filamentum subsp. filamentum can modify the sequence (SEQ ID NO: 7). A BglII restriction site (AGATCT) not present in the original sequence is generated in the modified sequence (SEQ ID NO: 9). A T base is introduced after position 66 in the amplified fragment sequence of *Mycoplasma bovis* (SEQ ID NO: 8), resulting in an EcoRI restriction site (GAATTC) not present in the original sequence in the modified sequence (SEQ ID NO: 10). Furthermore, the primers obtained from this invention, targeting *Mycoplasma filamentum* subsp. *filamentum* and *Mycoplasma bovis* respectively, can still amplify the modified sequences (SEQ ID NO: 9 and SEQ ID NO: 10). The amplified products obtained can be digested with BglII or EcoRI to obtain two different fragments. Therefore, when the nucleic acid fragment synthesized based on the modified sequence is used as a positive control for identifying *Mycoplasma filamentum* subsp. *filamentum* and *Mycoplasma bovis*, enzyme digestion can be used to determine whether the test sample is contaminated by the positive control, thereby improving the accuracy and reliability of the identification and detection of *Mycoplasma filamentum* subsp. *filamentum* and *Mycoplasma bovis*.

[0065] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings.

[0066] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0067] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.

[0068] The primers and probes used were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0069] The embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. The embodiments will help to understand the present invention, but should not be regarded as limiting the content of the present invention.

[0070] Example 1: Design and determination of primers and TaqMan probes for dual real-time fluorescence PCR to identify and detect Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis.

[0071] As recommended by the World Organisation for Animal Health, the SC sequence of Mycoplasma filamentosa and the uvrC sequence of Mycoplasma bovis were retrieved from the NCBI nucleic acid database GenBank (http: / / www.ncbi.nlm.nih.gov). Based on the primer and TaqMan probe design principles, multiple primer and TaqMan probe combinations were designed for dual real-time fluorescent PCR detection of Mycoplasma filamentosa and Mycoplasma bovis. However, after verifying the sensitivity and specificity of the designed primer and TaqMan probe combinations for dual real-time fluorescent PCR detection of Mycoplasma filamentosa and Mycoplasma bovis (detailed in Example 4 below), and considering the applicability of their amplification products in preparing positive control samples that can determine whether the test sample is contaminated (detailed in Example 2 below), the following primer and TaqMan probe combination was finally determined.

[0072] Specific primers and TaqMan probes for Mycoplasma filamentosa subspecies SC:

[0073] Upstream primer MmmSC-F: ATCCCATATTTTAGAATAAGAGT (SEQ ID NO:1)

[0074] Downstream primer MmmSC-R: CAAAATATGAACTAACAAAGATG (SEQ ID NO:2)

[0075] Detection probe MmmSC-P: Cy5-ACTAGATATGGGGTTTTCGTAATTTCT-BHQ3 (SEQ ID NO:5)

[0076] Specific primers and TaqMan probes targeting the uvrC sequence of Mycoplasma bovis:

[0077] Upstream primer M. Bovis-F: ATCGCCTATGGAATATTAATCA (SEQ ID NO:3)

[0078] Downstream primer M. Bovis-R: GTTTAAAAGTTCTTCCTGTAC (SEQ ID NO:4)

[0079] Detection probe M.Bovis-P: FAM-ATTCCACTAGGTTTAAGTGTTGATG-BHQ1 (SEQ ID NO:6).

[0080] Example 2: Design of positive control samples for the identification and detection of Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis

[0081] The amplification fragment sequences of the specific primers for Mycoplasma filamentosa subspecies SC, determined in Example 1, are shown below:

[0082] atcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcTgatctaaaatatcatctttgttagttcatattttg (SEQ ID NO: 7);

[0083] The amplification fragment sequences of the primers specific to bovine mycoplasma determined in Example 1 are shown below:

[0084] atcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgatgaatcacttagagttttctttgaacaattctatga ggataaaatactgccagataatttaattgtacaggaagaacttttaaac (SEQ ID NO: 8).

[0085] Analysis of the sequences SEQ ID NO: 7 and SEQ ID NO: 8 revealed that a small mutation, replacing the base T at position 64 of SEQ ID NO: 7 with base A, introduces a BglⅡ restriction site (AGATCT) not present in the original sequence into the modified sequence (as shown in SEQ ID NO: 9 below). Similarly, introducing a base T after position 66 of SEQ ID NO: 8 introduces an EcoRI restriction site (GAATTC) not present in the original sequence into the modified sequence (as shown in SEQ ID NO: 10 below). Furthermore, these modifications do not affect the amplification of the modified sequence by the specific primer pair. The gel electrophoresis results of the amplification products of SEQ ID NO: 9 and SEQ ID NO: 10 are shown below. Figure 1 As shown in lanes 3 and 2. The above-mentioned minor modifications to the amplified fragment can reduce the workload of researchers and avoid the generation of multiple restriction enzyme sites in the sequence (the inventors found that directly inserting restriction enzyme sites into the sequence would cause the generation of multiple local restriction enzyme sites). This reduces the difficulty for researchers to ligate it to other vectors and broadens the range of vectors that can be selected.

[0086] atcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcAgatctaaaatatcatctttgttagttcatattttg (SEQ ID NO: 9);

[0087] atcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgatgaatTcacttagagttttctttgaacaattctatg aggataaaatactgccagataatttaattgtacaggaagaacttttaaac (SEQ ID NO: 10);

[0088] For the modified sequence SEQ ID NO: 9, enzyme digestion with BglⅡ yielded two fragments of 64 bp and 35 bp (difference of 29 bp, clearly distinguishable on gel electrophoresis images), thus identifying SEQ ID NO: 9. Similarly, for the modified sequence SEQ ID NO: 10, enzyme digestion with EcoRI yielded two fragments of 63 bp and 84 bp (difference of 21 bp, clearly distinguishable on gel electrophoresis images), also identifying SEQ ID NO: 10. Therefore, sequences SEQ ID NO: 9 and SEQ ID NO: 10 can be used as positive control samples for identifying Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, and enzyme digestion can be used to determine whether the positive control sample contaminates the test sample (the specific enzyme digestion method is detailed in Example 3 below).

[0089] Therefore, this invention provides a positive control sample for identifying and detecting Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis. It can serve not only as a standard DNA template but also as a means to identify whether a test sample is contaminated by these contaminants. The nucleotide sequence of the positive control sample provided by this invention may contain sequences SEQ ID NO: 9 and SEQ ID NO: 10, and its general formula may be: R1-R2-R3-R4-R5-R6-R7; wherein: R1 may be empty or any fragment of length 1-118 (e.g., lengths of 1, 2, 3, 4, ..., 118) as shown in SEQ ID NO: 11 below; R2 is the sequence shown in SEQ ID NO: 9; R3 may be empty or as shown in SEQ ID NO: 11 below. The sequence shown in NO: 12 has a length of 1-58 (e.g., lengths of 1, 2, 3, 4, ..., 58). R4 can be empty or selected from restriction sites other than BglⅡ and EcoRI (e.g., SalⅠ restriction site: GTCGAC, which can cleave the positive control into positive controls containing only Mycoplasma filamentosa subsp. filamentosa nucleic acid fragments (e.g., its nucleotide sequence formula can be R1-R2-R3) and positive controls containing only Mycoplasma bovis nucleic acid fragments (e.g., its nucleotide sequence formula can be R5-R6-R7)). R5 can be empty or a sequence of 1-24 (e.g., lengths of 1, 2, 3, 4, ..., 24) as shown in SEQ ID NO: 13 below. R6 is the sequence shown in SEQ ID NO: 10. R7 can be empty or as shown in SEQ ID NO: 13 below. NO: Any segment of length 1-30 (e.g., lengths 1, 2, 3, 4, ..., 30) in the sequence shown in NO:14;

[0090] ctgattatgatgacagtggtcatattctaaatctttaatttttattagaagaacataaaatatattgagtttattgtaataagatattcttaaaaaattt tcttatttttaattttaa (SEQ ID NO: 11) is derived from the SC sequence of Mycoplasma filamentosa, and is the upstream fragment of sequence SEQ ID NO: 7;

[0091] attttttctttattaatgtattctataagattaaatcatattactagaacagaagtat (SEQ ID NO: 12) is derived from the SC sequence of Mycoplasma filamentosa subspecies and is a downstream fragment of the sequence SEQ ID NO: 7;

[0092] taatttttgctacagttttgttct (SEQ ID NO: 13) is derived from the bovine mycoplasma uvrC sequence and is the upstream fragment of sequence SEQ ID NO: 8;

[0093] tttgatctaaacctatcaagtgaatataaa (SEQ ID NO: 14) is derived from the bovine mycoplasma uvrC sequence and is a downstream fragment of the sequence SEQ ID NO: 8.

[0094] Optionally, for the convenience of using positive control samples (e.g., for ligation with other plasmids), an enzyme restriction site other than the BglⅡ restriction site and the EcoRI restriction site can be added upstream of R1 and downstream of R7, respectively. The two restriction sites added are different. For example, a BamHI restriction site can be added upstream of R1 and a HindⅢ restriction site can be added downstream of R7.

[0095] In the following examples, as an example, the sequence shown in SEQ ID NO: 15 is used as a positive control, which is synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0096] GGATCCctgattatgatgacagtggtcatattctaaatctttaatttttattagaagaacataaaatatattgagtttattgtaataagatattcttaaaaaattttcttatttttaattttaa atcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcAgatctaaaatatcatctttgttagttcatattttgattttttctttattaatgtattctat aagattaaatcatattactagaacagaagtatGTCGACtaatttttgctacagttttgttctatcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgat gaatTcacttagagttttctttgaacaattctatgaggataaaatactgccagataatttaattgtacaggaagaacttttaaactttgatctaaacctatcaagtgaatataaaAAGCTT(SEQ ID NO: 15).

[0097] Example 3: A method for identifying and detecting Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis.

[0098] 3.1 Establishment of a dual real-time fluorescence PCR standard curve for the identification and detection of Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis.

[0099] (1) Using gradient concentrations (11.495×10 9 copies / μL ~11.495×10 -1The positive control sample (SEQ ID NO: 15 in Example 2) of the working standards 1-11 (copies / μL) was used as the standard DNA template. qPCR amplification of different concentrations of DNA template was performed using the primers and probes determined in Example 1. The 20 μL PCR reaction system included: 10 μL of 2×Premix Ex Taq, 0.7 μL each of 10 μmol / L MmmSC-F and MmmSC-R primers, 0.5 μL of 10 μmol / L MmmSC-P, 0.8 μL each of 10 μmol / L M.Bovis-F and M.Bovis-R primers, 0.9 μL of 10 μmol / L M.Bovis-P, 2 μL of DNA template, and ddH2O to make up to 20 μL. The qPCR reaction conditions were: 95℃ for 30 s; 95℃ for 10 s, 56℃ for 30 s, for a total of 40 cycles. At the end of each annealing cycle, Cy5 and FAM signals were simultaneously acquired to obtain amplification curves for Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, respectively. Figure 2A and Figure 2B As shown.

[0100] (2) The copy number of the standard DNA template (in 10, respectively) was used to determine the copy number of the standard DNA template. 9 -10 -1 Using copies / μL as the x-axis and the detected Ct value as the y-axis, a standard curve is plotted.

[0101] Depend on Figure 2A and Figure 2B The results show that the limit of detection for *Mycoplasma filamentosa* subsp. *filamentosa* using this method is the working standard 10, i.e., the sensitivity is 11.495 copies / μL. A standard curve was plotted using working standards 1-9, and the results are as follows... Figure 4 As shown, the linear equation of the standard curve is y = -3.419x + 38.561, R0 2 =0.999, amplification efficiency E = 96.091%; the limit of detection for bovine mycoplasma using this method is working standard 10, and the sensitivity is 11.495 copies / μL. A standard curve was plotted using working standards 1-9, and the results are as follows. Figure 5 As shown, the linear equation of the standard curve is y = -3.404x + 38.636, R0 2 =1, amplification efficiency E = 96.701%. The above standard curves can be used for dual real-time quantitative PCR detection of Mycoplasma filamentosa subsp. and Mycoplasma bovis, respectively.

[0102] 3.2. Dual real-time quantitative PCR detection of Mycoplasma filamentosa subsp. and Mycoplasma bovis.

[0103] (1) The DNA nucleic acid of the sample to be tested was extracted using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 according to the kit instructions and stored for later use.

[0104] (2) Using the extracted DNA nucleic acid from the sample to be tested as a template, SEQ ID NO: 15 provided in Example 2 as a positive control, and enzyme-free water as a negative control, the presence of Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis in the sample to be tested is determined based on the results of dual real-time quantitative PCR detection of Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis in the positive sample to be tested is quantified. Optionally, the contamination of the positive sample to be tested by the positive control can also be detected and determined.

[0105] The specific testing method includes the following steps:

[0106] 1) Using DNA extracted from the sample as a template, dual real-time quantitative PCR was performed under the guidance of the primers and probes determined in Example 1. The PCR reaction system was 20 μL and the PCR reaction procedure was as described in Experiment 3.1 above. Fluorescence signal was detected at the end of the annealing cycle.

[0107] 2) Qualitative detection of Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis is achieved using the obtained Ct values ​​or changes in fluorescence signals. Typical amplification curves appear in different fluorescence channels, indicating that the sample contains Mycoplasma filamentosa subsp. filamentosa nucleic acid and / or Mycoplasma bovis nucleic acid. Based on the Ct values ​​and the standard curve in Experiment 3.1, the copy number of Mycoplasma filamentosa subsp. filamentosa nucleic acid and / or Mycoplasma bovis nucleic acid in the sample is determined, thus achieving quantitative detection.

[0108] 3) Specific determination method:

[0109] If the sample to be tested only shows a typical amplification curve in the Cy5 channel and the Ct value is <40.0, the result is determined to be positive for Mycoplasma filamentosa subsp. nucleic acid.

[0110] If the sample to be tested only shows a typical amplification curve in the FAM channel and the Ct value is <40.0, the result is determined to be positive for bovine mycoplasma nucleic acid.

[0111] If the sample to be tested shows typical amplification curves in both the FAM and Cy5 channels, and the Ct value is <40.0, the result is determined to be positive for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid.

[0112] If the sample to be tested has no Ct value, or a Ct value ≥ 40, or no typical amplification curve, the result is determined to be negative for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid.

[0113] 4) For test samples that are determined to be positive for nucleic acid, the following steps can be used to determine whether they have been contaminated by positive quality control samples, thereby enabling more accurate identification and detection of Mycoplasma filamentosa subsp. filamentosa and / or Mycoplasma bovis contained in the positive test samples:

[0114] 4.1) qPCR products with positive nucleic acids as determined by fluorescence results were recovered by gel extraction and subjected to enzyme digestion for identification. The enzyme digestion reaction system for positive qPCR gel products from *Mycoplasma filamentosa* subsp. *filamentosa* was as follows: 1-2 μg of qPCR gel product, 0.2-1 μL of 10 U / μL BglⅡ, 2 μL of 10×H Buffer, and ddH2O to a final volume of 20 μL. The enzyme digestion reaction system for positive qPCR gel products from *Mycoplasma bovis* was as follows: 1-2 μg of qPCR gel product, 0.2-1 μL of 15 U / μL EcoRI, 2 μL of 10×H Buffer, and ddH2O to a final volume of 20 μL. The reaction conditions for enzyme digestion identification were as follows: for positive qPCR gel products from *Mycoplasma filamentosa* subsp. *filamentosa*, 30±1℃ for 1-2 h; for positive qPCR gel products from *Mycoplasma bovis*, 37±1℃ for 1-2 h.

[0115] 4.2) Determine whether the sample to be tested is contaminated by the positive control based on the enzyme digestion identification results. The determination principle is as follows: if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma filamentosa subsp. filamentosa show both 35bp and 64bp bands on the agarose gel, the sample to be tested is determined to be contaminated by the positive control; if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma bovis show both 63bp and 84bp bands on the agarose gel, the sample to be tested is determined to be contaminated by the positive control.

[0116] Example 4: Specificity, sensitivity, and repeatability tests of methods for identifying and detecting Mycoplasma filamentosa subspecies and Mycoplasma bovis.

[0117] 4.1 Specificity Test

[0118] (1) Experimental materials: pathogen nucleic acid

[0119] DNA, goatpox virus nucleic acid, goat pox virus nucleic acid, mycoplasma goat subsp. filamentosa nucleic acid, mycoplasma ovis nucleic acid, bovine mycoplasma pneumoniae nucleic acid, bovine brucellosis strain A19 nucleic acid, Clostridium perfringens nucleic acid, Streptococcus suis type 2 nucleic acid, bovine infectious rhinotracheitis virus nucleic acid, bovine viral diarrhea virus nucleic acid, bovine enterovirus nucleic acid, Junin virus nucleic acid, and bovine Hungarian AIDS virus nucleic acid were extracted from inactivated Mycoplasma filamentosa subsp. filamentosa SC and positive Mycoplasma bovis samples using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0.

[0120] (2) The pathogen nucleic acid in (1) above was amplified by double fluorescent qPCR according to the method of test 3.2 in Example 3 to verify the specificity of the method.

[0121] The results are as follows Figure 6 As shown, only the SC type of Mycoplasma filamentosa subspecies (filamentous mycoplasma) is observed. Figure 6 (Curve 1) and Bovine Mycoplasma ( Figure 6 In curve 2), the nucleic acid was detected as positive, while the nucleic acid detection results of other pathogens were all negative, indicating that the dual fluorescence qPCR method established in this invention has good detection specificity for Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis.

[0122] 4.2 Sensitivity Test

[0123] qPCR amplification reactions were performed on the positive control samples at gradient concentrations according to the method in Experiment 3.1 of Example 3 above. Additionally, in this experiment, a dual conventional PCR method (using primers MmmSC-F, MmmSC-R, M.Bovis-F, and M.Bovis-R obtained in Example 1) was also used to detect the positive control samples at gradient concentrations.

[0124] The results of qPCR amplification detection of Mycoplasma filamentosa subspecies SC and Mycoplasma bovis are as follows: Figure 2A and Figure 2B As shown, the limit of detection (LOD) for *Mycoplasma filamentosa* subsp. *filamentosa* using this method is working standard 10, meaning its sensitivity is 11.495 copies / μL. The LOD for *Mycoplasma bovis* is also working standard 10, meaning its sensitivity is 11.495 copies / μL. The results of conventional PCR amplification detection of *Mycoplasma filamentosa* subsp. *filamentosa* SC type and *Mycoplasma bovis* are as follows... Figure 3A and Figure 3B As shown, the limit of detection for detecting Mycoplasma filamentosa subsp. filamentosa using conventional PCR is the working standard 7, meaning its sensitivity is 11.495 × 10⁻⁶. 3 The limit of detection for Bovine Mycoplasma is 7 copies / μL, meaning its sensitivity is 11.495 × 10⁻⁶. 3 The results indicate that the dual-fluorescence qPCR method established in this invention for identifying and detecting Mycoplasma filamentosa subspecies and Mycoplasma bovis has high detection sensitivity, which is 1000 times that of ordinary PCR methods.

[0125] 4.3 Repeatability Test

[0126] Using the method described in Experiment 3.2 of Example 3 above, three repeated fluorescent PCR tests were performed on Mycoplasma filamentosa subspecies and working standards 2, 4, and 6 of Mycoplasma bovis, and the inter-batch coefficient of variation was calculated. The same fluorescent PCR test was repeated three times, and the intra-batch coefficient of variation was calculated. The coefficient of variation (Ct) for inter-batch and intra-batch replicates was calculated according to the formula: coefficient of variation CV% = (standard deviation SD / mean Mean) × 100%.

[0127] The results are shown in Table 1 below. It can be seen that the intra-assay coefficient of variation (Ct) for detecting different concentrations of Mycoplasma filamentosa subsp. nucleic acid ranged from 0.56% to 1.61%; the intra-assay coefficient of variation (Ct) for detecting different concentrations of Mycoplasma bovis nucleic acid ranged from 1.06% to 1.77%. This indicates that the dual fluorescence qPCR method established in this invention has good reproducibility for the detection of Mycoplasma filamentosa subsp. and Mycoplasma bovis.

[0128] Table 1: Results of inter-group repeatability testing of Mycoplasma filamentosa subspecies and Mycoplasma bovis in the samples

[0129]

[0130] Example 5: Dual-fluorescent PCR detection kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis

[0131] The dual fluorescent PCR detection kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis provided in this embodiment includes:

[0132] The primers (MmmSC-F, MmmSC-R, M.Bovis-F and M.Bovis-R primers) and TaqMan probes (MmmSC-P, M.Bovis-P) identified in Example 1 for the identification and detection of Mycoplasma filamentosa subspecies and Mycoplasma bovis.

[0133] For convenient and accurate detection, the PCR detection kit provided in this embodiment also includes the positive control obtained in Example 2 above. The positive control can be two positive control samples targeting Mycoplasma filamentum subsp. and Mycoplasma bovis, respectively. The positive control for Mycoplasma filamentum subsp. contains the nucleotide sequence shown in SEQ ID NO: 9, and the positive control for Mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO: 10. The positive control can also be a single positive control sample targeting both Mycoplasma filamentum subsp. and Mycoplasma bovis, containing both the nucleotide sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10, as specifically described in Example 2 above.

[0134] For ease of testing, the kit also includes the standard curve obtained in Example 3 and instructions for use.

[0135] Example 6: Application of a dual-fluorescent PCR detection kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis.

[0136] Ten bovine fecal samples (numbered 1-10) provided by the Guangxi Zhuang Autonomous Region Animal Disease Prevention and Control Center were tested using the kit from Example 5. The testing method was the same as in Experiment 3.2 of Example 3 (the positive control used was SEQ ID NO: 15). The test results are shown in Table 2 below. Four samples were positive only for Mycoplasma filamentum subsp. nucleic acid, three samples were positive only for Mycoplasma bovis nucleic acid, one sample was positive for both Mycoplasma filamentum subsp. nucleic acid and Mycoplasma bovis nucleic acid, and two samples were negative for nucleic acid. Additionally, the contamination of the nucleic acid-positive samples with the positive control was tested, using the same method as in Experiment 3.2 of Example 3. The test results are shown in Table 2 below. Two samples (sample 2 and sample 8) were contaminated with the positive control. As can be seen from the results of this embodiment, the kit for dual real-time quantitative PCR detection of Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis provided by the present invention can detect Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis in clinical samples, and can also determine whether the clinical sample has been contaminated by positive quality control products, providing strong evidence for environmental monitoring, pathogen identification and detection, etc.

[0137] Table 2: Test results of 10 samples

[0138]

[0139] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An oligonucleotide combination for identifying Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, comprising dual real-time fluorescent PCR primers and a TaqMan probe for detecting Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis, and a positive control, wherein: The PCR primers include: an upstream primer MmmSC-F and a downstream primer MmmSC-R for detecting Mycoplasma filamentosa subspecies, wherein the nucleotide sequence of the upstream primer MmmSC-F is shown in SED ID NO: 1, and the nucleotide sequence of the downstream primer MmmSC-R is shown in SED ID NO: 2; and an upstream primer M.Bovis-F and a downstream primer M.Bovis-R for detecting Mycoplasma bovis, wherein the nucleotide sequence of the upstream primer M.Bovis-F is shown in SED ID NO: 3, and the nucleotide sequence of the downstream primer M.Bovis-R is shown in SED ID NO: 4; The TaqMan probes include: TaqMan probe MmmSC-P for detecting Mycoplasma filamentosa subspecies, whose nucleotide sequence is shown in SED ID NO: 5; and TaqMan probe M.Bovis-P for detecting Mycoplasma bovis, whose nucleotide sequence is shown in SED ID NO:

6. The positive control is a positive control that is effective against both Mycoplasma filamentosa subsp. and Mycoplasma bovis, and its nucleotide sequence is shown in SED ID NO:

15.

2. The oligonucleotide combination according to claim 1, wherein the TaqMan probe is fluorescently labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

3. A positive control for identifying Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis, specifically used in the oligonucleotide combination described in claim 1 or 2, wherein the positive control is a positive control for both Mycoplasma filamentum subsp. filamentum and Mycoplasma bovis, and its nucleotide sequence is shown in SED ID NO:

15.

4. The use of the oligonucleotide combination of claim 1 or 2 or the positive control of claim 3 in the preparation of a detection product for identifying Mycoplasma filamentosa subsp. filamentosa and Mycoplasma bovis.

5. A dual real-time fluorescence PCR kit for identifying Mycoplasma filamentosa subspecies and Mycoplasma bovis, comprising the oligonucleotide combination as described in claim 1 or 2.

6. A method for identifying and detecting Mycoplasma filamentosa subsp. and Mycoplasma bovis for non-disease diagnostic purposes, comprising the following steps: S1: Extract genomic DNA from the sample to be tested, and use the extracted genomic DNA as a template to perform dual real-time fluorescence PCR detection under the guidance of the PCR primers and TaqMan probe in the oligonucleotide combination described in claim 1 or 2. S2: Use the specific amplification curves and Ct values ​​to identify and detect Mycoplasma filamentosa subsp. and Mycoplasma bovis; S3: qPCR products showing positive fluorescence results for nucleic acids were recovered via gel extraction and identified by enzyme digestion; and S4: Determine whether the sample to be tested is contaminated by the positive quality control based on the enzyme digestion identification results; The principle for identification and detection in step S2 is as follows: If the sample to be tested shows a typical amplification curve only in the signal channel labeled by the TaqMan probe MmmSC-P, and the Ct value is <40.0, the result is determined to be positive for Mycoplasma filamentosa subsp. nucleic acid. If the sample to be tested shows a typical amplification curve only in the signal channel labeled by the TaqMan probe M.Bovis-P, and the Ct value is <40.0, the result is determined to be positive for bovine mycoplasma nucleic acid; If the sample to be tested shows typical amplification curves in the signal channels labeled by TaqMan probe MmmSC-P and TaqMan probe M.Bovis-P, and the Ct value is <40.0, the result is determined to be positive for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid. If the sample to be tested has no Ct value or a Ct value ≥ 40 or no typical amplification curve, the result is determined to be negative for Mycoplasma filamentosa subsp. and Mycoplasma bovis nucleic acid. The judgment principle in step S4 is as follows: if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma filamentosa subsp. filamentosa show bands of 35 bp and 64 bp on the agarose gel at the same time, the sample to be tested is judged to be contaminated by the positive quality control; if the enzyme digestion products of the positive qPCR gel recovery product of Mycoplasma bovis show bands of 63 bp and 84 bp on the agarose gel at the same time, the sample to be tested is judged to be contaminated by the positive quality control.

7. The method according to claim 6, wherein the system for dual real-time fluorescence PCR detection in step S1 comprises: 1-3 μL DNA template, 8-12 μL 2×Premix Ex Taq real-time PCR reaction solution, 0.5-1.0 μL each of 10 μmol / L upstream primer MmmSC-F and downstream primer MmmSC-R, 0.5-1.0 μL of 10 μmol / L TaqMan probe MmmSC-P, 0.7-1.0 μL each of 10 μmol / L upstream primer M.Bovis-F and downstream primer M.Bovis-R, 0.8-1.0 μL of 10 μmol / L TaqMan probe M.Bovis-P, 2-4 μL ddH2O; and / or The PCR reaction conditions for dual real-time fluorescence PCR detection in step S1 are: 95℃ for 30s; 95℃ for 10s, 56℃ for 30s, for a total of 40 cycles. Fluorescence signal detection is performed at the end of the annealing at the end of each cycle.

8. The method according to claim 6 or 7, In step S3, the enzyme digestion reaction system for the positive qPCR gel recovery product of Mycoplasma filamentosa subsp. filamentosa is as follows: 1-2 μg of qPCR gel recovery product, 10 U / μL of... Bgl II is 0.2-1 μL, 10×H Buffer is 2 μL, and ddH2O is added to make up to 20 μL; the enzyme digestion reaction system for bovine mycoplasma-positive qPCR gel recovery products is: 1-2 μg of qPCR gel recovery product, 15 U / μL of... Eco RⅠ is 0.2-1 μL, 10×H Buffer is 2 μL, and ddH2O is added to make up to 20 μL.

9. According to the method of claim 6 or 7, the reaction conditions for enzyme digestion identification in step S3 are as follows: for the enzyme digestion reaction of positive qPCR gel recovery products of Mycoplasma filamentosa subsp. filamentosa, the reaction conditions are 30±1℃ for 1-2 h; for the enzyme digestion reaction of positive qPCR gel recovery products of Mycoplasma bovis, the reaction conditions are 37±1℃ for 1-2 h.

Images