Cereal grains having thickened aleurone

Abstract

The present invention relates to a cereal grain comprising aleurone, embryo, starch endosperm and a reduced level and / or activity of a mitochondrial single-strand DNA binding (mtSSB) polypeptide, a RECA3 polypeptide or a TWINKLE polypeptide. The grain of the invention or the aleurone produced therefrom has improved nutritional properties and is therefore particularly suitable for use in human and animal feed products.

Description

Technical Field

[0001] This invention relates to a cereal grain comprising aleurone, embryo, starch endosperm, and mitochondrial single-stranded DNA-binding (mtSSB) polypeptides, RECA3 polypeptides, or TWINKLE polypeptides with reduced levels and / or activity. The cereal grains of this invention, or the aleurone derived therefrom, have improved nutritional properties and are therefore particularly suitable for human and animal feed products. Background Technology

[0002] Globally, cereal grains, such as wheat, rice, corn, and to a lesser extent barley, oats, and rye, are the primary source of calories for humans from the starch content of cereal grains. Cereal grains are also important in providing other nutrients, such as protein, vitamins, minerals, and dietary fiber. Different parts of the grain contribute differently to these nutrients. Starch is stored in the starchy endosperm of the cereal grain, while other nutrients are more concentrated in the embryo and bran (Buri et al., 2004). However, the bran is often removed before being used in food, especially in rice, which is then consumed as white rice.

[0003] Cereal grains develop from a double fertilization event between the maternal and paternal gametophytes. One of the two sperm cells in the pollen tube fuses with the egg to produce a zygote that develops into an embryo, while the other sperm cell fuses with the diploid centrocell of the macrogametophyte to produce the nucleus of the primary endosperm cell, from which the genetically triploid endosperm develops. Therefore, the endosperm containing aleurone is triploid, meaning it has two copies of the maternal haploid genome and one copy of the paternal haploid genome. In dicotyledonous seeds, the endosperm is consumed by the developing embryo, while in monocotyledonous plants, such as rice, the endosperm continues to form the majority of the mature grain.

[0004] The mature endosperm of cereals has four distinct cell types: starch endosperm, characterized by its rich content of starch granules and storage proteins; epidermal aleurone, which is typically a thick layer of cells surrounding most of the starch endosperm; transgenic cells, located at the base of the seed above the main maternal vascular system; and a layer of cells surrounding the embryo, which forms the lining of the embryo early in grain development but may later surround only the stalk connecting the embryo to the starch endosperm (Becraft et al., 2001a). The embryo forms within the cavity of the starch endosperm. Therefore, the cereal aleurone tissue comprises the outermost layer of the endosperm in the cereal grain and surrounds a portion of the starch endosperm and the embryo.

[0005] Aleurone cells differ from starch endosperm cells in their morphology, biochemical composition, and gene expression profiles (Becraft and Yi, 2011). Aleurone cells are typically rich in oil and protein and secrete enzymes that mobilize endosperm reserves during seed germination. Each aleurone cell is enclosed within a fibrous cell wall, which is thicker than the endosperm cell wall and is primarily composed of varying ratios of arabinoxylan and β-glucan, exhibiting high autofluorescence. The aleurone layer is the only layer in the endosperm that sometimes contains anthocyanins.

[0006] In wheat and wild-type maize, cereal aleurone consists of only a single-layered cell structure (Buttrose 1963; Walbot, 1994). In rice, the cell structure on the dorsal side of the endosperm is mostly single-layered, but at most three-layered (Hoshikawa, 1993), and in wild-type barley, it is three-layered (Jones, 1969). In normal endosperm, aleurone is very regular, and the pattern of cell division is highly organized. The cross-section of mature wild-type aleurone cells with dense cytoplasm is nearly cuboid, containing granules, small vacuoles, and inclusion bodies composed of proteins, lipids, and phytin or proteins plus carbohydrates. In mature cereal grains, aleurone is the only endosperm tissue that remains active, although in a dormant, dried form. During absorption, the embryo produces gibberellins, which induce the synthesis of amylase and other hydrolases from aleurone. The aleurone is released into the starchy endosperm to break down stored compounds to form sugars and amino acids for early embryonic growth into seedlings.

[0007] Becraft and Yi (2011) reviewed the regulation of aleurone development in cereal grains. Multiple levels of genetic regulation control aleurone cell fate, differentiation, and organization, and many genes are involved in this process, only some of which have been identified. For example, the defective kernel 1 (dek1) loss-of-function mutant in maize lacks an aleurone layer, suggesting that the wild-type Dek1 polypeptide is essential for designating the outer cell layer as aleurone (Becraft et al., 2002). The Dek1 polypeptide is a large integrated membrane protein with 21 transmembrane domains and a cytoplasmic domain containing an active calpain protein. Another gene in maize, CRINKLY4 (CR4), encodes a receptor kinase that acts as a positive regulator of aleurone fate, and the CR4 mutant exhibits reduced aleurone production (Becraft et al., 2001b).

[0008] Several cases of thickened aleurone in cereal grain mutants have been reported in the literature, but none of them have been proven useful due to pleiotropic effects or agronomic and production issues.

[0009] Shen et al. (2003) reported the identification of maize mutants with a super aleurone layer 1 (sal1) gene in different mutants, exhibiting 2–3 or up to seven layers of aleurone cells instead of the normal monolayer. The SAL1 polypeptide was identified as a class E vacuolar sorting protein. Homozygous sal1-1 mutant grains had defective embryos that could not germinate and significantly reduced starch endosperm. The less complete mutant with homozygous sal1-2 alleles exhibited a two-layered aleurone layer. However, the mutant plants grew to only 30% of the height of the wild type, had reduced root mass, and poor grain setting (Shen et al., 2003). These plants were agronomically unusable.

[0010] Yi et al. (2011) reported the identification of a thick aleurone 1 (thk1) mutant in maize. The mutant kernel exhibited multilayered aleurone. However, the mutant kernel lacked a well-developed embryo and failed to germinate at sowing. The wild-type Thk1 gene encodes the Thk1 polypeptide, which acts downstream of the Dek1 polypeptide required for aleurone development in maize (Becraft et al., 2002).

[0011] The effects of this mutation on leaf morphology led to the identification of a mutant of the maize extracellular layer (Xcl) gene. This resulted in a double aleurone layer and a multi-layered leaf epidermis (Kessler et al., 2002). The Xcl mutation is a semi-dominant mutation that disrupts the cell division and differentiation pattern of maize, resulting in thick and narrow leaves with an unusually glossy appearance.

[0012] Maize mutants of the disorgal1 and disorgal2 (dil1 and dil2) genes exhibit aleurones with irregularly shaped and sized cells of varying numbers of layers (Lid et al., 2004). However, homozygous dil1 and dil2 mutant grains are smaller due to reduced starch accumulation, and mature mutant grains have low germination rates and fail to develop into viable plants.

[0013] In barley, the elo2 mutant exhibits similar cellular disorganization and irregularities in the aleurone layer, caused by aberrant periclinal cell division (Lewis et al., 2009). The plants also show an increased cell layer in the leaf epidermis, with cells protruding and twisting. Importantly, homozygous mutant plants are dwarfed, producing grains weighing less than 60% of the wild type's and contributing nothing to grain production.

[0014] In rice, two transcription factors controlling the expression of seed storage proteins also influence aleurone cell fate (Kawakatsu et al., 2009). Reduced expression of the co-repressor construct of the gene encoding the rice alcoholic cassette-binding factor (RPBF) polypeptide, a DOF zinc finger transcription factor, resulted in sporadic, multilayered aleurone composed of large, disordered cells. The expression and accumulation of seed storage proteins were also significantly reduced, along with significantly decreased levels of starch and lipid accumulation. Reduced expression of rice homologs of the maize genes Dek1, CR4, and SAL1 also indicated that the RPBF and RISBZ1 factors operate in the same regulatory pathways as these genes.

[0015] Recently, it was determined that the mutant ROS1a gene can lead to increased aleurone thickness in rice (WO 2017 / 083920).

[0016] It is necessary to obtain cereal grains with thickened aleurone from plants, especially rice plants which are useful in agronomy. Summary of the Invention

[0017] The inventors have identified a number of genes and proteins encoded therefrom that affect aleurone development in cereal grains.

[0018] Therefore, in one aspect, the present invention provides a cereal grain comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide whose level and / or activity is reduced relative to the level and / or activity of a corresponding wild-type cereal grain, wherein the mitochondrial polypeptide whose level and / or activity is reduced is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide.

[0019] In a preferred embodiment, the grain includes genetic variations that reduce the level and / or activity of at least one mitochondrial polypeptide in the grain relative to the level and / or activity of the polypeptide in the corresponding wild-type cereal grain. In one example of this embodiment, the grain includes two or more genetic variations that reduce the level and / or activity of at least one mitochondrial polypeptide in the grain relative to the level and / or activity of the polypeptide in the corresponding wild-type cereal grain. In another example of this embodiment, the grain includes genetic variations that reduce the level and / or activity of two or three mitochondrial polypeptides in the grain relative to the level and / or activity of the polypeptide in the corresponding wild-type cereal grain.

[0020] In one embodiment, the genetic variation includes a mutation in an endogenous gene encoding the mitochondrial polypeptide, whereby the mutation reduces the level and / or activity of the mitochondrial polypeptide.

[0021] In one embodiment, the genetic variation includes an exogenous polynucleotide encoding a silent RNA molecule, wherein the silent RNA molecule and / or a processed RNA molecule derived from the silent RNA molecule reduces the expression of the endogenous gene, preferably wherein the exogenous polynucleotide includes a DNA region encoding the silent RNA molecule, the DNA region being operatively linked to a promoter expressed in a developing grain of a cereal plant, wherein the promoter is preferably expressed at least at a time point between pollination time and 30 days post-pollination.

[0022] In one embodiment, the genetic variation includes a modified, preferably reduced splice site mutation that produces an RNA transcript encoding an endogenous gene encoding the mitochondrial polypeptide, wherein the splice site mutation is preferably a single nucleotide substitution at the splice site, more preferably an adenine nucleotide at a location corresponding to nucleotide number 2126 of SEQ ID NO:4.

[0023] In one embodiment, the genetic variation includes a deletion or insertion within the endogenous gene encoding the mitochondrial polypeptide, preferably a deletion introduced by mutagenesis of cereal progenitor cells.

[0024] In one embodiment, the genetic variation includes a premature translation stop codon in the protein-coding region of an endogenous gene encoding the mitochondrial polypeptide.

[0025] In one embodiment, the genetic variation includes a mutation in an endogenous gene encoding the mitochondrial polypeptide, such that it encodes a polypeptide with reduced activity relative to the wild-type polypeptide, preferably wherein the mutation is a nucleotide substitution in the endogenous gene, thereby including the mutated endogenous gene encoding a polypeptide having amino acid substitutions relative to SEQ ID NO:3.

[0026] In one embodiment, the genetic variation includes a mutation in an endogenous gene encoding the mitochondrial polypeptide, such that when the gene with the mutation is expressed, the level of the polypeptide produced is reduced relative to the corresponding wild-type gene. For example, the genetic variation includes a splice site mutation that leads to reduced expression levels of the gene, or a mutation in the promoter of the gene that leads to reduced gene expression.

[0027] In one embodiment, the genetic variation is an introduced genetic variation.

[0028] In one embodiment, the grain is heterozygous for the genetic variation. In another embodiment, the grain is homozygous for the genetic variation.

[0029] In a preferred embodiment, the grain has a thickened aleurone layer. In one embodiment, the grain has a thickened aleurone layer on day 20 post-pollination. In one embodiment, the thickened aleurone layer comprises at least two, at least three, at least four, or at least five cell layers, about three, about four, about five, or about six cell layers, or 2-8, 2-7, 2-6, 2-5, or 3-5 cell layers, or multiple cell layers between 2 and 8, between 2 and 7, or between 2 and 6.

[0030] In one embodiment, when compared to a corresponding wild-type cereal grain, the grain comprises one or more of the following, respectively, based on weight:

[0031] i) Higher fat content,

[0032] ii) Higher ash content,

[0033] iii) Higher fiber content,

[0034] iv) Lower starch content,

[0035] v) Higher mineral content, preferably the mineral content being one or more of the following: calcium, iron, zinc, potassium, magnesium, phosphorus, and sulfur.

[0036] vi) Higher antioxidant content,

[0037] vii) Higher phytate content

[0038] viii) Higher levels of one or more of vitamins B3, B6, and B9.

[0039] ix) Higher sucrose content,

[0040] x) Higher content of neutral non-starch polysaccharides, and

[0041] xi) Higher monosaccharide content.

[0042] In one embodiment, the grains include a higher degree of chalkiness when compared to corresponding wild-type cereal grains.

[0043] In one embodiment, the grain comprises a greater number of aleurone cells compared to a corresponding wild-type cereal grain.

[0044] In one embodiment, the grain is a whole grain or a broken grain.

[0045] In one embodiment, the germination rate of the grain is between about 40% and about 100% relative to the germination rate of the corresponding wild-type cereal grain.

[0046] In one embodiment, the grains exhibit increased α-amylase activity during germination compared to the corresponding wild-type cereal grains.

[0047] In one embodiment, the grain has irregularly shaped starch granules that are more loosely packed compared to the corresponding wild-type cereal grain.

[0048] In one embodiment, when compared with a corresponding wild-type cereal grain, the grain has one or more of the following: substantially the same length, width, thickness, protein level, and grain shape.

[0049] In one embodiment, the grains have been processed to prevent germination, preferably by heat treatment, and more preferably by cooking.

[0050] In one embodiment, the polypeptide is expressed in one or more of the developing endosperm, seed coat, aleurone, and embryo of a developing grain.

[0051] In one embodiment, the outer layer of the grain is colored.

[0052] Examples of cereal grains in this invention include, but are not limited to, rice grains, wheat grains, barley grains, corn grains, sorghum grains, or oat grains. In one embodiment, the grain is a rice grain. In another embodiment, the grain is a brown rice grain or a black rice grain.

[0053] In one embodiment, the wild-type grain comprises an mtSSB polypeptide comprising an amino acid sequence as provided in any one of SEQ ID NO:3 or 15 to 39, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one or more of SEQ ID NO:3 or 15 to 39.

[0054] In one embodiment, the mtSSB polypeptide is the mtSSB-1a polypeptide. In one embodiment, the wild-type grain comprises the mtSSB-1a polypeptide, the mtSSB-1a polypeptide comprising an amino acid sequence as provided in any one of SEQ ID NO:3 or 15 to 23, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one or more of SEQ ID NO:3 or 15 to 23.

[0055] In one embodiment, the wild-type grain comprises the mtSSB-1a polypeptide, which comprises an amino acid sequence as provided in SEQ ID NO:3, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to that in SEQ ID NO:3.

[0056] In one embodiment, the wild-type grain comprises an mtSSB polypeptide, the mtSSB polypeptide comprising one or more or all of the following motifs: FRGVHRAI(I / L)CGKVGQ(V / A)P(V / L)QKILRNG(R / H)T(V / I)T(V / I)FT(V / I)GTGGMFDQR (SEQ ID NO:45); P(K / M)PAQWHRI(A / S)(V / I)H(N / S)(D / E) (SEQ ID NO:46); AVQ(K / Q)L(V / T)KNS(A / S)VY(V / I)EG(D / E)IE(T / I)R(V / I)YND (SEQ ID NO:47); and IC(L / V / I)R(R / G)DGKI (SEQ ID NO:48).

[0057] In one embodiment, the grain includes an endogenous gene encoding a truncated mtSSB polypeptide, preferably a truncated mtSSB-1a polypeptide. In one embodiment, the truncated mtSSB polypeptide is C-terminated. In one embodiment, the length of the truncated mtSSB polypeptide is less than 200 amino acids. Examples of truncated mtSSB polypeptides in cereal grains of the present invention include, but are not limited to, those consisting of amino acid sequences selected from: SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, or truncated versions of any one thereof.

[0058] In one embodiment, the reduced mtSSB activity is one or more or all of the following:

[0059] i) Reduced ability to bind to single-stranded DNA;

[0060] ii) Reduced ability to bind to RECA3 peptides; and

[0061] iii) Reduced ability to bind to TWINKLE peptides.

[0062] In one embodiment, the wild-type grain comprises a RECA3 polypeptide comprising an amino acid sequence provided in any one of SEQ ID NO: 61, 67, 69, 71, 73, 75, 77 or 79, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one or more of SEQ ID NO: 61, 67, 69, 71, 73, 75, 77 or 79.

[0063] In one embodiment, the wild-type grain comprises a RECA3 polypeptide comprising an amino acid sequence as provided in SEQ ID NO:61, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to that in SEQ ID NO:61.

[0064] In one embodiment, the reduced RECA3 peptide activity is one or both of the following:

[0065] i) Reduced ability to bind to mtSSB peptides; and

[0066] ii) Reduced recombinase activity.

[0067] In one embodiment, the wild-type grain comprises a Twinkle polypeptide comprising an amino acid sequence provided in any one of SEQ ID NO: 64, 80, 82, 84, 86, 88, 90, 92, 94 or 96, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one or more of SEQ ID NO: 64, 80, 82, 84, 86, 88, 90, 92, 94 or 96.

[0068] In one embodiment, the wild-type grain comprises a Twinkle polypeptide comprising an amino acid sequence as provided in SEQ ID NO:64, or an amino acid sequence that is at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to that in SEQ ID NO:64.

[0069] In one embodiment, the reduced TWINKLE peptide activity is one or both of the following:

[0070] i) Reduced ability to bind to mtSSB peptides; and

[0071] ii) Decreased helicase activity.

[0072] A mutant mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, a mutant RECA3 polypeptide, or a mutant TWINKLE polypeptide is also provided, the amino acid sequence of which is different from the amino acid sequence of the corresponding wild-type mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide, and the polypeptide has reduced activity compared with the corresponding wild-type polypeptide. Preferably, the polypeptide is encoded by an endogenous gene of cereal plants including the genetic variation of the present invention.

[0073] On the other hand, the present invention provides a polynucleotide encoding the mutant mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide of the present invention, wherein the polynucleotide is preferably an endogenous gene of cereal plants that includes the genetic variation of the present invention.

[0074] In one embodiment, the polynucleotide is operatively linked to a promoter expressed in the grains of cereal plants.

[0075] In another aspect, the present invention provides isolated and / or exogenous polynucleotides that, when present in cereal grains, reduce the expression of genes encoding mitochondrial single-stranded DNA-binding (mtSSB) peptides, RECA3 peptides, or TWINKLE peptides.

[0076] In one embodiment, the polynucleotide is operatively linked to a promoter expressed in the grains of cereal plants.

[0077] Polynucleotides in the aforementioned aspects are also provided when used to reduce gene expression in developing grains of cereal plants at least between the time of pollination and 30 days post-pollination.

[0078] Those skilled in the art are well aware of the different types of polynucleotides that can be used to reduce the expression of target genes, and how to design these polynucleotides. Examples include, but are not limited to, double-stranded RNA (dsRNA) molecules or their processed RNA products, microRNAs, antisense polynucleotides, sense polynucleotides, or catalytic polynucleotides.

[0079] In one embodiment, the polynucleotide is a dsRNA molecule or its processed RNA product comprising at least 95% identical to a complement of the gene encoding a cereal mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, a RECA3 polypeptide, or a TWINKLE polypeptide (where thymine (T) is uracil (U)), or at least 19, at least 20, or at least 21 consecutive nucleotides identical to a complement of the mRNA encoding a cereal mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, a RECA3 polypeptide, or a TWINKLE polypeptide. For example, in one embodiment, the polynucleotide is a dsRNA molecule or its processed RNA product comprising at least 95% identical to a complement of SEQ ID NO:1 (where thymine (T) is uracil (U)), or at least 95% identical to a complement of the mRNA encoding an mtSSB polypeptide comprising the amino acid sequence provided in SEQ ID NO:3.

[0080] In another embodiment, the dsRNA molecule is a microRNA (miRNA) precursor and / or the RNA product of its processing is miRNA.

[0081] On the other hand, the present invention provides a nucleic acid construct and / or vector encoding the polynucleotide of the present invention, wherein the nucleic acid construct or vector includes a DNA region encoding the polynucleotide, the DNA region being operatively linked to a promoter that is expressed in developing grains of cereal plants at least at a time point between pollination time and 30 days post-pollination.

[0082] On the other hand, the present invention provides a cell, tissue, organ, plant part or plant comprising the polynucleotide or nucleic acid construct and / or vector of the present invention.

[0083] In one embodiment, the polynucleotide, nucleic acid construct or vector is integrated into the genome of the cell, tissue, organ, plant part or plant, preferably into the nuclear genome.

[0084] On the other hand, the present invention provides a cereal cell, the resulting seed or tissue, said cell, the resulting seed or tissue comprising at least one mitochondrial polypeptide with reduced level and / or activity relative to the level and / or activity of a polypeptide in a corresponding wild-type cereal cell, wherein said mitochondrial polypeptide with reduced level and / or activity is at least one of mitochondrial single-stranded DNA binding (mtSSB) polypeptide, RECA3 polypeptide and TWINKLE polypeptide.

[0085] In one embodiment, the cell, the resulting seed, or tissue is or includes endosperm, seed coat, aleurone, or embryonic cell.

[0086] In one embodiment, the cells are aleurone cells.

[0087] On the other hand, the present invention provides a cereal plant that produces the grains of the present invention, and / or it includes one or more or all of the polypeptides, polynucleotides, nucleic acid constructs and / or carriers of the present invention, or cells, seeds or tissues of the present invention.

[0088] In one embodiment, the height of the plant of the present invention is approximately the same as the height of the corresponding wild-type plant.

[0089] In one embodiment, the plant of the present invention reproduces in both male and female forms.

[0090] In one embodiment, the plant of the present invention exhibits delayed grain maturation.

[0091] A population of at least 100 cereal plants of the present invention growing in a field is also provided.

[0092] On the other hand, the present invention provides a method for producing the cells of the present invention, the method comprising the steps of: introducing the genetic variation of the present invention, the polynucleotide of the present invention or the nucleic acid construct and / or vector of the present invention into cells, preferably cereal plant cells.

[0093] On the other hand, the present invention provides a method for producing cereal plants or grains derived from said cereal plants, the method comprising the following steps:

[0094] i) Introducing the genetic variations, polynucleotides, or nucleic acid constructs and / or vectors of the present invention into cereal cell;

[0095] ii) Obtain cereal plants containing the genetic variation or polynucleotide from the cells obtained in step i); and

[0096] iii) Optionally, grains are collected from the plant of step ii), the grains comprising the genetic variation or being transgenic to the polynucleotide, nucleic acid construct, or vector; and

[0097] iv) Optionally, one or more generations of progeny plants are produced from the grain, said progeny plants comprising the genetic variations or being transgenic to the polynucleotide, nucleic acid construct, or vector.

[0098] This produces the cereal plants or grains.

[0099] On the other hand, the present invention provides a method for producing cereal plants or grains derived from said cereal plants, the method comprising the following steps:

[0100] i) Introducing a mutation into an endogenous gene encoding a mitochondrial single-stranded DNA binding (mtSSB) peptide, a RECA3 peptide, or a TWINKLE peptide into cereal cells, such that the level and / or activity of the mitochondrial single-stranded DNA binding (mtSSB) peptide, a RECA3 peptide, or a TWINKLE peptide in the cells is reduced relative to the level and / or activity of the peptide in the corresponding wild-type cereal cells.

[0101] ii) Obtaining cereal plants from the cells of step i), said cereal plants comprising the mutation of said endogenous gene; and

[0102] iii) Optionally, collect grains from the plant of step ii), the grains comprising the mutation; and iv) Optionally, generate one or more generations of progeny plants from the grains, the progeny plants comprising the mutation.

[0103] This produces the cereal plants or grains.

[0104] On the other hand, the present invention provides a method for selecting the cereal plants or grains of the present invention, the method comprising the following steps:

[0105] i) Screening cereal populations or grain populations, each of which is obtained from mutagenesis of cereal progenitor cells, grains, or plants, for the purpose of producing the grains of the present invention, or for inducing mutations in genes encoding mitochondrial single-stranded DNA-binding (mtSSB) polypeptides, RECA3 polypeptides, or TWINKLE polypeptides; and

[0106] ii) Select cereal plants from the population of step (i) that produce the grains of the present invention or include the mutations in the genes described herein.

[0107] Therefore, the cereal plants or grains are selected.

[0108] On the other hand, the present invention provides a method for selecting cereal plants according to the present invention, the method comprising the following steps:

[0109] i) Producing one or more offspring plants from cereal grains, wherein the cereal grains are derived from a hybrid of two parent cereal plants;

[0110] ii) Screening one or more progeny plants from step i) for use in producing the grains of the present invention; and

[0111] iii) Select the progeny plants that produce the grains,

[0112] Therefore, the aforementioned cereal plants were selected.

[0113] In one embodiment, step ii) includes analyzing the genetic variations in a sample comprising DNA from the progeny plant.

[0114] In one embodiment, step ii) includes analyzing the thickness of the aleurone from the grains obtained from the progeny plants.

[0115] In one embodiment, step ii) includes analyzing the nutritional content of the grain or a portion thereof.

[0116] In one embodiment, step iii) includes selecting offspring plants that are homozygous for the genetic variation.

[0117] In one embodiment, step iii) includes selecting progeny plants whose grains have an increased aleurone thickness compared to the corresponding wild-type cereal grains.

[0118] In one embodiment, step iii) includes selecting offspring plants whose nutrient content of the grain or a portion thereof is altered compared to the nutrient content of the corresponding wild-type cereal grain or a portion thereof.

[0119] In one embodiment, the method further includes:

[0120] i) Hybridizing two parent cereal plants, preferably one of said parent cereal plants produces the grains of the present invention; or

[0121] ii) Backcrossing one or more progeny plants from step i) with plants having the same genotype as the first parent cereal plant that does not produce the grains of the present invention a sufficient number of times to produce plants having most of the genotype of the first parent cereal plant but producing the grains of the present invention; and

[0122] iii) Selecting offspring plants that produce the grains of the present invention.

[0123] A cereal plant produced using the method of the present invention is also provided.

[0124] Also provided is the use of the polynucleotide or nucleic acid construct and / or vector of the present invention for producing cells, cereal plants or plant parts, such as cereal grains.

[0125] In one embodiment, the use is for producing the grains of the present invention.

[0126] In another aspect, the present invention provides a method for identifying cereal plants that produce the grains of the present invention, the method comprising the following steps:

[0127] i) Obtaining nucleic acid samples from cereal plants; and

[0128] ii) Screening the samples for the presence or absence of genetic variations that, when compared to the activity levels of peptides in the corresponding wild-type cereals, reduce the activity levels of mitochondrial single-stranded DNA-binding (mtSSB) peptides, RECA3 peptides, or TWINKLE peptides in the plant.

[0129] In one embodiment, the genetic variation is one or both of the following:

[0130] a) A nucleic acid construct expressing a polynucleotide, or a polynucleotide encoded therefrom, which, when present in cereal plants, reduces the expression of genes encoding mitochondrial single-stranded DNA-binding (mtSSB) polypeptides, RECA3 polypeptides, or TWINKLE polypeptides; and

[0131] b) A mutant of a gene or the mRNA encoded therefrom, whose expression activity is reduced, preferably a truncated mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide.

[0132] In one embodiment, the presence of the genetic variation indicates that the grains of the cereal have a thicker aleurone layer compared to the corresponding cereal lacking the genetic variation.

[0133] On the other hand, the present invention provides a method for identifying cereal plants that produce the grains of the present invention, the method comprising the following steps:

[0134] i) Obtaining grains from cereal plants; and

[0135] ii) Screening the grain or a portion thereof for one or more of the following:

[0136] a) Thickened aleurone

[0137] b) The amount and / or activity of the mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide in the grain; and

[0138] c) The amount of mRNA encoded by the gene encoding the mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide in the grain.

[0139] In one embodiment, the method is used to identify the cereal plants of the present invention.

[0140] In another aspect, the present invention provides a method for producing cereal plant parts, the method comprising:

[0141] a) Planting the cereal plants of the present invention or at least 100 such cereal plants in a field; and

[0142] b) Harvest the cereal portion from the one or more cereal plants.

[0143] In another aspect, the present invention provides a method for producing flour, bran, whole wheat, malt, starch, or oil from processed grains or grains, the method comprising:

[0144] a) Obtaining the grains of the present invention; and

[0145] b) Process the grains to produce processed grains, flour, bran, whole wheat, malt, starch, or oil.

[0146] A product is also provided, which is produced from the grains of the present invention, or the cereal plants of the present invention, or from the portion of said grains or cereal plants including said genetic variation.

[0147] In one embodiment, the product comprises one or more or all of the following: the genetic variation, the polynucleotide, the nucleic acid construct or the vector, and the thickened aleurone.

[0148] In one embodiment, the portion is cooked, boiled, partially cooked, baked, roasted, refined, cracked, puffed, ground, or flaked grains or bran.

[0149] In one embodiment, the product is a food ingredient, a beverage ingredient, or a food or beverage product.

[0150] In one embodiment, the food or beverage ingredient is selected from the group consisting of: roasted grains, refined grains, cracked grains, puffed grains, milled grains, hulled grains, whole wheat, flour, bran, starch, malt, and oil.

[0151] In one embodiment, the food is selected from the group consisting of: processed grains, cooked grains, boiled grains, porridge, fermented or unfermented bread, pasta, noodles, animal feed, breakfast cereals, snack foods, cakes, pastries, and foods containing flour-based sauces.

[0152] In one embodiment, the beverage product is tea, packaged beverage, or a beverage containing ethanol.

[0153] In another aspect, the present invention provides a method for preparing the food or beverage ingredient of the present invention, the method comprising processing the grains of the present invention, or processing bran, flour, whole wheat, malt, starch or oil from said grains to produce said food or beverage ingredient.

[0154] In another aspect, the present invention provides a method for preparing the food or beverage product of the present invention, the method comprising processing grains, preferably by cooking, boiling, baking or degumming the grains, or mixing the grains of the present invention or bran, flour, whole wheat, malt, starch or oil from said grains with another food or beverage ingredient.

[0155] Also provided is the use of the grains or portions thereof of the present invention, or the cereal plants or portions thereof of the present invention, as animal feed or food or for producing feed for animals or food for humans.

[0156] On the other hand, the present invention provides a composition comprising one or more of the polypeptides, polynucleotides, nucleic acid constructs and / or carriers, or cells of the present invention, and one or more acceptable carriers, preferably another food ingredient.

[0157] Unless otherwise expressly stated, any embodiments herein should be considered applicable to any other embodiments after necessary modifications.

[0158] The scope of this invention is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. As described herein, functionally equivalent products, compositions, and methods are obviously within the scope of this invention.

[0159] Throughout this specification, unless otherwise expressly stated or required by the context, references to a single step, a composition of substance, a group of steps, or a group of compositions of substance shall be deemed to cover one or more of such steps, compositions of substance, groups of steps, or groups of compositions of substance (i.e., one or more).

[0160] The invention is described below by way of the following non-limiting examples and with reference to the accompanying drawings. Attached Figure Description

[0161] Figure 1 Mature caryopsis of ta1-1 exhibits a thick aleurone phenotype. Mature caryopsis of wild type (ZH11, A) and ta1-1 (B); cross-section of mature caryopsis of ZH11 (C) and ta1-1 (D); Lugol staining of mature caryopsis of ZH11 (E) and ta1-1 (F), with arrows pointing towards the aleurone; PAS and Coomassie Brilliant Blue (G-250) staining of ZH11 5DAP (G), 10DAP (I), 30DAP (K) and ta1-1 5DAP (H), 10DAP (J), 30DAP (L). Bar graphs: A and B: 2 mm, C, D, E and F: 1 mm, G, H, I, J, K and L: 20 μm. DAP: days after pollination.

[0162] Figure 2: The average number of aleurone cell layers in mature grains of wild type and ta1-1 at different locations in the caryopsis. Values ​​represent the mean ± SD (n = 15). ** P<0.01.

[0163] Figure 3 Analysis of changes in grain dry weight over time. DAP: Days after pollination. Data are presented as mean ± SD (n = 10). ** P<0.01.

[0164] Figure 4 Nutritional content of mature caryopsis fruits of ZH11 (wild type) and ta1-1. The contents of total protein (A), crude lipids (B), dietary fiber (C), calcium (D), iron (E), zinc (F), vitamin B2 (G), and vitamin B3 (H) in mature caryopsis fruits were measured. Data are shown as mean ± SEM, n = 3. * P<0.05; ** (P<0.01).

[0165] Figure 5 α-Amylase activity assay of ta1-1 endosperm and aleurone from germinated grains after absorption. The darker bars represent ta1-1 grains. The difference between ZH11 and ta1 was significant, as determined by the Student t-test. * P<0.05; ** P < 0.01. Each bar represents the average of 3 samples.

[0166] Figure 6 Cloning based on the TA1 map shows the Indel marker mapped onto chromosome 5 of rice. Each linear map represents a segment magnified from the map directly above. n indicates the number of recombinants used at each stage of the mapping process. Indel = insertion or deletion, identified by a number. The number below each vertical line indicates the number of recombinants between the Indel marker and the ta1-1 mutation. Mb: million base pairs, Kb: thousand base pairs. The bottom line is a schematic diagram of the TA1 gene, where filled rectangles represent exons (Arabic numerals 1-6) within the protein-coding region, and lines represent introns (Roman numerals IV) within the protein-coding region. Arrows labeled G to A indicate the location of G to A point mutations in the ta1-1 allele responsible for the thick aleurone phenotype.

[0167] Figure 7Alignment of three nucleotide sequences (SEQ ID NO:12-14) of cDNA regions generated from different ta1-1 RNAs labeled ta1 I, ta1 II, and ta1 III with the corresponding nucleotide sequence (SEQ ID NO:11) of wild-type TA1 cDNA (ZH11). This region is involved in alternative splicing of the transcript of the mutant ta1-1 gene.

[0168] Figure 8 Predicted amino acid sequences (SEQ ID NO: 8, 9 and 10) of three different RNA-translated polypeptides produced from TA1-1 grains compared to the wild-type TA1 polypeptide sequence (ZH11, SEQ ID NO: 3).

[0169] Figure 9 The amino acid sequence of the wild-type OsTA1 polypeptide (SEQ ID NO:3) was compared with homologs in maize (Zea mays) (SEQ ID NO:16), sorghum (Sorghum bicolor) (SEQ ID NO:17), barley (Hordeum vulgare) (SEQ ID NO:18), wheat (Triticum aestivum) (SEQ ID NO:19), Brachypodium distachyon (SEQ ID NO:20), Arabidopsis thaliana (SEQ ID NO:15), and poplar (SEQ ID NO:21). The associated rice sequence (OsTA1L; SEQ ID NO:24) was also used for comparison. Completely conserved amino acids in the nine sequences are indicated by asterisks, most conserved amino acids by semicolons, and similar amino acids by dots. Single-stranded DNA-binding (SSB) domains are indicated by solid bars, while predicted cleavage sites for the removal of mitochondrial transport peptides (MTPs) are indicated by arrows.

[0170] Figure 10 : Relative expression levels of the TA1 gene in different rice tissues. SAM: shoot apical meristem; DAP: days post-pollination. All expression levels were normalized relative to the actin gene. Each sample was tested in triplicate and expressed as mean ± SD.

[0171] Figure 11Biotin-labeled 45-nucleotide ssDNA molecules were used as probes to bind 6x His-TA1 protein to ssDNA (lane 2). Unlabeled ssDNA was added as competitive ssDNA at 2x (lane 3), 20x (lane 4), and 200x (lane 5), gradually reducing the amount of biotin-labeled ssDNA with varying migration rates in the presence of TA1 protein.

[0172] Figure 12 Using biotin-labeled 45-nucleotide ssDNA molecules as probes, EMSA experiments were performed to detect the binding of 6xHis-TA1 and its mutant form, 6xHis-ta1-1 polypeptide (a truncated TA1 polypeptide), to ssDNA. 2 μg of recombinant TA1 protein was used for the following assays: Figure 11 The assays were performed using recombinant 6xHis-ta1-1 peptide at gradients of 2 μg, 4 μg, and 8 μg under the same conditions.

[0173] Figure 13 Expression of TA1 in aleurone and embryo of rice caryopsis at different developmental stages. GUS activity of caryopsis from pTA1:TA1-GUS transgenic plants was stained at 5 DAP (A and G), 7 DAP (B and H), 9 DAP (C and I), 11 DAP (D and J), 18 DAP (E and K), and 24 DAP (F and L). Arrows in C, D, I, and J indicate aleurone cell layers. Bar graphs = A, B, C, D, E, and F: 0.2 cm; G, H, I, J, K, and L: 0.1 cm. DAP: days post-pollination.

[0174] Figure 14 A: Number of mitochondria per slice of aleurone cells in developing ta1-1 grains at 15 DAP (n=10) compared to wild-type grains. B: ATP content of wild-type and ta1-1 aleurone at 11 DAP. Data are shown as mean ± SD. n=3, ** The indicator is P<0.01.

[0175] Figure 15 : Downregulation of the RecA3 and TWINKLE genes in rice using RNAi. The figure above shows a schematic map of the RecA3 and TWINKLE genes, where exons are indicated by black boxes and introns by lines between the boxes. Gene regions selected for the RNAi constructs are shown (exons only). b and c: mRNA levels of each RNAi construct in grains from three transformed rice plants were measured using quantitative RT-PCR, showing reduced expression in each selected plant.

[0176] Figure 16Phylogenetic analysis of mtSSB proteins from different plant species, primarily cereals. Protein sequences were aligned with ClustalW and phylogenetically analyzed using MEGA7 using the neighbor-joining method.

[0177] Figure 17 Phylogenetic analysis of TWINKLE proteins from different plant species, including some cereal grains. Protein sequences were aligned with ClustalW and phylogenetically analyzed using MEGA7 using the neighbor-joining method.

[0178] Sequence List Symbol Explanation

[0179] SEQ ID NO:1 - The nucleotide sequence of the wild-type rice TA1 gene at locus Os05g43440. Nucleotides 1-1024: TA1 promoter and 5' UTR; 1025-1027: ATG translation start codons; Protein-coding region: nucleotides 1025-1094, 1176-1339, 1425-1633, 1771-1871, 2127-2186, and 2353-2369. Nucleotides 1095-1175: Intron 1; 1340-1424: Intron 2; 1634-1770: Intron 3; 1872-2126: Intron 4; 2187-2352: Intron 5. Translation termination is nucleotides 2367-2369.

[0180] SEQ ID NO:2 - The nucleotide sequence of the protein-coding region of the cDNA of the wild-type TA1 gene, containing the TAG stop codon.

[0181] The amino acid sequence of the wild-type TA1(OsmtSSB) polypeptide, SEQ ID NO:3.

[0182] SEQ ID NO:4 - Rice ta1-1 (mutant) gene, nucleotide sequence of locus Os05g43440. The ta1-1 mutation is located at nucleotide 2126 (G2126A), i.e., the last nucleotide of intron 4. Nucleotides 1-1024: TA1 promoter and 5'UTR; 1025-1027: ATG translation start codon; protein coding region: nucleotides 1025-1094, 1176-1339, 1425-1633, 1771-1871, 2127-2186, and 2353-2369. Nucleotides 1095-1175: intron 1; 1340-1424: intron 2; 1634-1770: intron 3; 1872-2126: intron 4; 2187-2352: intron 5. Translation terminates at nucleotides 2367-2369.

[0183] The nucleotide sequence of SEQ ID NO:5-ta1-1 I cDNA, from the translation initiation codon ATG to the wild-type TA1 stop codon TAG.

[0184] The nucleotide sequence of SEQ ID NO:6-ta1-1 II cDNA, from the translation initiation codon ATG to the wild-type TA1 stop codon TAG.

[0185] The nucleotide sequence of SEQ ID NO:7-ta1-1 III cDNA, from the translation initiation codon ATG to the wild-type TA1 stop codon TAG.

[0186] Predicted amino acid sequence of SEQ ID NO:8-ta1-1 I polypeptide.

[0187] The predicted amino acid sequence of the SEQ ID NO:9-ta1-1 II polypeptide.

[0188] Predicted amino acid sequence of SEQ ID NO:10-ta1-1 II polypeptide.

[0189] SEQ ID NO:11 - Nucleotide sequence from the cDNA region of the wild-type TA1 gene.

[0190] SEQ ID NO:12 - Nucleotide sequence from cDNA region I of the ta1-1 gene.

[0191] SEQ ID NO:13 - Nucleotide sequence from cDNA region II of the ta1-1 gene.

[0192] SEQ ID NO:14 - Nucleotide sequence from cDNA region III of the ta1-1 gene.

[0193] SEQ ID NO:15 - Amino acid sequence of TA1 homologous protein in Arabidopsis thaliana.

[0194] SEQ ID NO:16 - Amino acid sequence of TA1 homologous protein in maize.

[0195] SEQ ID NO:17 - Amino acid sequence of TA1 homologous protein in sorghum.

[0196] SEQ ID NO:18 - Amino acid sequence of TA1 homologous protein in barley.

[0197] SEQ ID NO:19 - Predicted amino acid sequence of TamtSSB-1a;D in common wheat.

[0198] SEQ ID NO:20 - Amino acid sequence of TA1 homologous protein from *Bruguiera divaricata*.

[0199] SEQ ID NO:21 - Amino acid sequence of TA1 homologous protein from Populus trichocarpa.

[0200] Predicted amino acid sequence of TamtSSB-1a;B from common wheat (SEQ ID NO:22).

[0201] Predicted amino acid sequence of SimtSSB-1a in Setaria italica (SEQ ID NO:23).

[0202] SEQ ID NO:24 - Amino acid sequence of TA1-like protein (OsmtSSB-1b) in rice (Oryza sativa).

[0203] SEQ ID NO:25 - Predicted amino acid sequence of SimtSSB-1b from millet.

[0204] SEQ ID NO:26 - Predicted amino acid sequence of HvmtSSB-1b in common barley subsp. vulgare.

[0205] Predicted amino acid sequence of TamtSSB-1b;A in common wheat (SEQ ID NO:27).

[0206] Predicted amino acid sequence of TamtSSB-1b;B from common wheat (SEQ ID NO:28).

[0207] Predicted amino acid sequence of TamtSSB-1b;D from common wheat (SEQ ID NO:29).

[0208] SEQ ID NO:30 - Predicted amino acid sequence of OsmtSSB-2 in the Oryza sativa Japonica Group.

[0209] SEQ ID NO:31 - Predicted amino acid sequence of AtmtSSB-2 in Arabidopsis thaliana.

[0210] SEQ ID NO:32 - Predicted amino acid sequence of SbmtSSB-2 in sorghum.

[0211] SEQ ID NO:33 - Predicted amino acid sequence of ZmmtSSB-2 in maize.

[0212] SEQ ID NO:34 - Predicted amino acid sequence of SimtSSB-2 in millet.

[0213] SEQ ID NO:35 - Predicted amino acid sequence of HvmtSSB-2 from common barley subspecies.

[0214] Predicted amino acid sequence of TamtSSB-2;A in common wheat (SEQ ID NO:36).

[0215] SEQ ID NO:37 - Predicted amino acid sequence of TamtSSB-2;B in common wheat.

[0216] Predicted amino acid sequence of TamtSSB-2;D in common wheat (SEQ ID NO:38).

[0217] Predicted amino acid sequence of PtmtSSB-2 in Populus tomentosa, SEQ ID NO:39.

[0218] Predicted amino acid sequence of MmmtSSB from house mouse (Mus musculus) SEQ ID NO:40.

[0219] Predicted amino acid sequence of HsmtSSB in Homo sapiens (SEQ ID NO:41).

[0220] Predicted amino acid sequence of DmmtSSB in Drosophila melanogaster (SEQ ID NO:42).

[0221] Predicted amino acid sequence of ScmtSSB from Saccharomyces cerevisiae (SEQ ID NO:43).

[0222] SEQ ID NO:44 - Predicted amino acid sequence of EcmtSSB in Escherichia coli.

[0223] SEQ ID NO:45 - Amino acid motif; 42aa.

[0224] SEQ ID NO:46 - Amino acid motif; 14aa.

[0225] SEQ ID NO:47 - Amino acid motif; 24aa.

[0226] SEQ ID NO:48 - Amino acid motif; 9aa.

[0227] SEQ ID NO:49 - Nucleotide sequence used for analyzing TA1 expression patterns. Nucleotides 1-3208 contain the TA1 promoter and 5' UTR; 3209-3211, ATG translation start codons; the protein-coding region consists of nucleotides 3209-3278, 3360-3523, 3609-3817, 3955-4055, 4311-4370, and 4537-4553. Nucleotides 3279-3359, intron 1; 3524-3608, intron 2; 3818-3954, intron 3; 4056-4310, intron 4; 4371-4536, intron 5. The translation termination region and the subsequent GUS protein-coding region are not included in this sequence.

[0228] SEQ ID NO:50 - The nucleotide sequence of the forward primer used to detect the molecular marker Indel 559 for ta1 mapping.

[0229] SEQ ID NO:51 - Nucleotide sequence of the reverse primer used to detect the molecular marker Indel 559 for ta1 mapping.

[0230] SEQ ID NO:52 - Nucleotide sequence of the forward primer used to detect the molecular marker Indel 548 for ta1 mapping.

[0231] SEQ ID NO:53 - Nucleotide sequence of the reverse primer used to detect the molecular marker Indel 548 for ta1 mapping.

[0232] SEQ ID NO:54 - Nucleotide sequence of the forward primer used to detect the molecular marker Indel 562 for ta1 mapping.

[0233] SEQ ID NO:55 - Nucleotide sequence of the reverse primer used to detect the molecular marker Indel 562 for ta1 mapping.

[0234] SEQ ID NO:56 - Nucleotide sequence of the forward primer used to detect the molecular marker Indel 583 for ta1 mapping.

[0235] SEQ ID NO:57 - Nucleotide sequence of the reverse primer used to detect the molecular marker Indel 583 for ta1 mapping.

[0236] SEQ ID NO:58 - Nucleotide sequence of the forward primer used to detect transcripts of the TA1 and ta1-1 genes.

[0237] SEQ ID NO:59 - The nucleotide sequence of the reverse primer used to detect transcripts of the TA1 and ta1-1 genes.

[0238] SEQ ID NO:60 - Nucleotide sequence of the probe used in EMSA experiments.

[0239] SEQ ID NO:61 - Amino acid sequence of rice RECA3 DNA repair protein from the Japonica rice group.

[0240] SEQ ID NO:62 - Nucleotide sequence of the RECA3 gene on chromosome 1 of the rice variety Nipponbare (Oryza sativa Japonica Groupcultivar Nipponbare).

[0241] SEQ ID NO:63 - Nucleotide sequence of the cDNA of the rice RECA3 gene of the mitochondrial RECA3 of the Japonica rice variety Nipponbare.

[0242] SEQ ID NO:64 - Amino acid sequence of rice TWINKLE chloroplast / mitochondrial DNA repair protein from the Japonica rice group.

[0243] SEQ ID NO:65 - The nucleotide sequence of the rice TWINKLE gene on chromosome 6 of the Japonica rice variety Nipponbare 6.

[0244] SEQ ID NO:66 - Nucleotide sequence of the rice TWINKLE gene (chloroplast / mitochondrial) from the rice cultivar Nipponbare (Japonica rice group). The protein coding region is nucleotides 153-2321.

[0245] SEQ ID NO:67 - Amino acid sequence of RECA3 DNA repair protein in the mitochondria of *Bruguiera divaricata*.

[0246] SEQ ID NO:68 - Nucleotide sequence of the cDNA of the RECA3 gene from the mitochondria of *Brachys bipinnatus*. The protein coding region is nucleotides 196-1482.

[0247] SEQ ID NO:69 - Amino acid sequence of RECA3 DNA repair protein in sorghum mitochondria.

[0248] SEQ ID NO:70 - Nucleotide sequence of the cDNA of the sorghum RECA3 gene from mitochondria in sorghum. The protein coding region is nucleotides 230-1510.

[0249] SEQ ID NO:71 - Amino acid sequence of maize RECA3 DNA repair protein from maize mitochondria.

[0250] SEQ ID NO:72 - Nucleotide sequence of the maize RECA3 gene cDNA from maize mitochondria. The protein coding region is nucleotides 59-1333.

[0251] SEQ ID NO:73 - Amino acid sequence of the RECA3 DNA repair protein of barley from the mitochondria of the common barley subspecies.

[0252] SEQ ID NO:74 - Nucleotide sequence of the cDNA of the barley RECA3 gene from the mitochondrial RECA3 subspecies of common barley. The protein coding region is nucleotides 122-1408.

[0253] SEQ ID NO:75 - Amino acid sequence of wheat RECA3 DNA repair protein in the mitochondria of common wheat variety (Triticum aestivum cultivar).

[0254] SEQ ID NO:76 - Nucleotide sequence of the cDNA of the wheat RECA3 gene from the common wheat variety Chinese Spring. The protein coding region is nucleotides 112-1416.

[0255] SEQ ID NO:77 - Amino acid sequence of RECA3 DNA repair protein from mitochondria of Aegilops tauschii subsp. tauschii.

[0256] SEQ ID NO:78 - Nucleotide sequence of the cDNA encoding the RECA3 gene from the subspecies *Alternaria alternata*, encoding mitochondrial RECA3. The protein-coding region is nucleotides 129-1427.

[0257] SEQ ID NO:79 - Amino acid sequence of RECA3 DNA repair protein from mitochondria of Triticum turgidum subsp. durum.

[0258] SEQ ID NO:80 - Amino acid sequence of TWINKLE homologous protein from chloroplasts / mitochondria of Brachypodium diplostis.

[0259] SEQ ID NO:81 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from *Brachys bipinnatus*. The protein coding region is nucleotides 132-2300.

[0260] SEQ ID NO:82 - Amino acid sequence of a Twinkle homologous protein from chloroplasts / mitochondria of sorghum.

[0261] SEQ ID NO:83 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from sorghum. The protein coding region is nucleotides 154-2436.

[0262] SEQ ID NO:84 - Amino acid sequence of a Twinkle homologous protein from maize chloroplasts / mitochondria.

[0263] SEQ ID NO:85 - Nucleotide sequence of the cDNA of the TWINKLE gene from maize, which encodes the TWINKLE protein for chloroplasts / mitochondria. The protein coding region is nucleotides 144-2351.

[0264] SEQ ID NO:86 - Amino acid sequence of TWINKLE homologous protein from chloroplasts / mitochondria of the jointed goat subspecies.

[0265] SEQ ID NO:87 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from the subspecies *Gnaphalium affine*, transcript variant X1. The protein-coding region is nucleotides 32-2209.

[0266] SEQ ID NO:88 - Amino acid sequence of a Twinkle homologous protein from the chloroplasts / mitochondria of Panicum hallii, isotype X1.

[0267] SEQ ID NO:89 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from Halidomia spp., transcript variant X1. The protein coding region is nucleotides 100-2343.

[0268] SEQ ID NO:90 - Amino acid sequence of a Twinkle homologous protein from the chloroplasts / mitochondria of Setaria viridis, isotype X1.

[0269] SEQ ID NO:91 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from *Setaria viridis* transcript variant X1. The protein coding region is nucleotides 70-2346.

[0270] SEQ ID NO:92 - Amino acid sequence of TWINKLE homologous protein from chloroplasts / mitochondria of common tobacco (Nicotiana tabacum).

[0271] SEQ ID NO:93 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from common tobacco. The protein coding region is nucleotides 103-2199.

[0272] SEQ ID NO:94 - Amino acid sequence of a Twinkle homologous protein from chloroplasts / mitochondria of potato (Solanum tuberosum).

[0273] SEQ ID NO:95 - Nucleotide sequence of the cDNA of the TWINKLE gene from potato, which encodes the TWINKLE protein for chloroplasts / mitochondria. The protein-coding region is nucleotides 92-2176.

[0274] SEQ ID NO:96 - Amino acid sequence of a Twinkle homologous protein from the chloroplast / mitochondria of isotype X1 of tomato (Solanum lycopersicum).

[0275] SEQ ID NO:97 - Nucleotide sequence of the cDNA of the TWINKLE gene encoding the chloroplast / mitochondrial TWINKLE protein from tomato transcript variant X1. The protein coding region is nucleotides 138-2228.

[0276] SEQ ID NO:98 - TA1-1F primers for TILLING assay.

[0277] SEQ ID NO:99 - TA1-1R primers for TILLING assay. Detailed Implementation

[0278] General techniques and definitions

[0279] Unless otherwise specified, all technical and scientific terms used herein should be regarded as having the same meaning as commonly understood by a person skilled in the art (e.g., in cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).

[0280] Unless otherwise stated, the recombinant proteins, cell culture, and immunological techniques used in this invention are standard procedures well known to those skilled in the art. Such techniques are described and explained in the following sources: J. Perbal, *A Practical Guide to Molecular Cloning*, John Wiley and Sons (1984); J. Sambrook et al., *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbour Laboratory Press (1989); T.A. Brown (ed.), *Essential Molecular Biology: A Practical Approach*, Volumes 1 & 2, IRL Press (1991); D.M. Glover and B.B. Hames (ed.), *DNA Cloning: A Practical Approach*, Volumes 1–4, IRL Press (1995 and 1996); and F.M. Ausubel et al. (ed.), *Current Protocols in Molecular Biology*. Biology), Greene Pub. Associates and Wiley-Interscience (1988, with all updates to date); Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); and J. E. Corpan et al. (eds.), Current Protocols in Immunology, John Wiley & Sons (with all updates to date).

[0281] The term “and / or”, such as “X and / or Y”, should be understood to mean “X and Y” or “X or Y”, and should be regarded as providing explicit support for both meanings or either meaning.

[0282] As used herein, unless otherwise stated, the term “about” means + / - 10% of a specified value, more preferably + / - 5%, more preferably + / - 2.5%, and even more preferably + / - 1%. The term “about” includes exact specified values.

[0283] Throughout this specification, the word “comprise” or its variations (such as “comprises” or “comprising”) will be understood to mean including the stated elements, whole or steps, or groups of elements, whole or steps, but not excluding any other elements, whole or steps, or groups of elements, whole or steps.

[0284] Selected definition

[0285] The terms "aleurone" and "aleurone layer" are used interchangeably herein. Unlike the inner starch endosperm, the aleurone layer is the outermost layer of the endosperm of a cereal grain and the portion surrounding the starch endosperm and embryo. Therefore, the cells constituting the aleurone layer are the endosperm, the outermost cells of the starchy component of a cereal grain. While technically, aleurone, as part of the endosperm, is sometimes referred to as the peripheral endosperm, from a practical standpoint, it is considered part of the bran because it is removed along with the pericarp and seed coat layers of the bran when the grain is refined, for example, when rice grains are milled to produce "white rice." Unlike the cells of the starch endosperm, aleurone cells remain active as the grain matures. The aleurone layer is an important part of the nutritional value of a cereal grain, including minerals, vitamins such as vitamins A and B, phytochemicals, and fiber.

[0286] Embodiments of the invention relate to a range of “cell layers”, at least in part because the cell layers observed at any single point within or between cross-sections of the grain of the invention can vary to some extent. More specifically, aleurone having, for example, seven cell layers may not have seven layers surrounding the entire internal starch endosperm, but rather seven layers surrounding at least a portion, preferably at least half, of the internal starch endosperm.

[0287] The term "thickened" when used with respect to the aleurone of the grains of the present invention is a relative term used when comparing the grains of the present invention to a corresponding wild-type cereal grain. In this context, the grains of the present invention include genetic modifications that produce a thickened aleurone, relative to wild-type cereal grains lacking genetic modification. The aleurone of the grains of the present invention exhibits an increased number of cells and / or an increased number of cell layers, preferably both, compared to the aleurone of a corresponding wild-type cereal grain. The thickness of the aleurone thus increases, if measured in μm, for example, as determined by microscopy. In one embodiment, the thickness increases by at least 50%, preferably at least 100%, and can increase by up to 500% or 600%, each percentage relative to the thickness of the aleurone of a corresponding wild-type cereal grain. In one embodiment, the increase is between 50% and 100%, or between 100% and 200%, or between 200% and 300%, or between 300% and 400% or 500%. In one embodiment, each percentage increase or range of percentage increases is an average increase at least on the ventral side of the grain and preferably across the entire grain. In a preferred embodiment, the thickness of the aleurone layer is determined across the entire cross-section of the grain. In one embodiment, the thickness of the aleurone is determined by analysis on at least the ventral side of the grain. In another embodiment, the thickened aleurone of the grains of the present invention comprises cells of different sizes and irregular orientations, compared to the aleurone of corresponding wild-type cereal grains in which the aleurone typically has regularly oriented rectangular cells. Combinations of all these characteristics of the “thickened aleurone” are conceivable.

[0288] polypeptide

[0289] The terms “peptide” and “protein” are generally used interchangeably in this document and refer to a polymer of amino acids linked by peptide bonds.

[0290] As used herein, the term "reduced level" or similar phrase for at least one mitochondrial polypeptide is a relative term for a reduction in total protein content relative to the polypeptide level of a corresponding wild-type cereal grain. This can be achieved using standard techniques in the art, for example, by partially or completely deleting the gene encoding the polypeptide, resulting in a polypeptide deficiency in the grain. Such mutations are null mutations. In one embodiment, the protein level / amount is reduced by at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or completely absent compared to a corresponding wild-type cereal grain.

[0291] As used herein, the term "reduced activity" or similar phrase for at least one mitochondrial polypeptide is a relative term for a reduction in the total activity of a specific protein, relative to the activity of the corresponding polypeptide in the corresponding wild-type cereal grain. In one embodiment, the protein activity is reduced by at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or completely eliminated when compared to the corresponding wild-type cereal grain. In this case, the total protein content in the grain of the present invention may be substantially the same when compared to the total protein content in the corresponding wild-type cereal grain, but the polypeptide in the grain of the present invention has at least one amino acid difference when compared to the corresponding polypeptide in the corresponding wild-type cereal grain, resulting in a reduction in the protein function of the grain of the present invention.

[0292] As used herein, the term "mitochondrial single-stranded DNA-binding polypeptide" or "mtSSB" refers to a member of a protein family that binds to single-stranded DNA and can be present in the mitochondria of cereal grains, as well as homologous proteins modified to have reduced or no binding activity. Wild-type proteins play a role in DNA replication, recombination, and repair by binding to single-stranded DNA, as do modified proteins. The mitochondria of cereal grains typically have three distinct mtSSB subfamilies, designated mtSSB-1a, mtSSB-1b, and mtSSB-2, although some cereals have only two subfamilies, mtSSB-1 and mtSSB-2. The inventors have discovered that, relative to the wild type, reduced mtSSB-1a or mtSSB-1 binding activity in cereal grains results in increased aleurone thickness. mtSSB peptides include such peptides found in wild-type cereals and their artificially produced or naturally occurring variants, and may or may not have single-stranded DNA binding activity, including mtSSB peptides with some single-stranded DNA binding activity but at a reduced level compared to the corresponding wild-type mtSSB peptide. As shown herein, the wild-type mtSSB-1a peptide binds not only to ssDNA but also to two other mitochondrial peptides, namely TWINKLE and RECA3. In one embodiment, the mtSSB peptide of the present invention comprises a reduced-activity mtSSB variant that binds to the TWINKLE peptide. In one embodiment, the mtSSB peptide of the present invention comprises a reduced-activity mtSSB variant that binds to the RECA3 peptide. In one embodiment, the mtSSB peptide of the present invention is capable of forming mtSSB oligomers, specifically homodimers. In one embodiment, the wild-type grain mtSSB polypeptide comprises an amino acid sequence provided as in any one of SEQ ID NO:3 or 15 to 39, or an amino acid sequence that is at least 75% identical to any one or more of SEQ ID NO:3 or 15 to 39. In a preferred embodiment, the wild-type grain mtSSB polypeptide comprises an amino acid sequence provided as in any one of SEQ ID NO:3, 16, 20, or 23, or an amino acid sequence that is at least 75% identical to any one or more of SEQ ID NO:3, 16, 20, or 23 along the full length of a reference sequence.

[0293] The wild-type mtSSB disclosed herein, when containing a mitochondrial targeting peptide (MTP) at its N-terminus, is typically between 200 and 215 amino acid residues in length, and between 170 and 190 residues in length after MTP cleavage. Without any insertions into the mtSSB gene, the mutant mtSSB polypeptide of the present invention can be up to 215 amino acid residues in length with the MTP, but can be shorter, even shorter, if it is truncated at the C-terminus or encoded by a mutant gene including a premature translation termination mutation. In one embodiment, the mtSSB polypeptide of the present invention lacks at least a portion of the DNA-binding domain, for example, lacking the amino acid GKI at the C-terminus of the DNA-binding domain (see, for example...). Figure 8 ).

[0294] In one embodiment, the grain of the present invention has at least one mtSSB polypeptide having a sequence different from the amino acid sequence of the corresponding wild-type mtSSB polypeptide, or lacking the wild-type mtSSB polypeptide. In related embodiments, the grain of the present invention has an endogenous gene encoding at least one (mutant) mtSSB polypeptide having a sequence different from the amino acid sequence of the corresponding wild-type mtSSB polypeptide, even if the mutant polypeptide is not expressed or is unstable in the grain and does not accumulate in the grain.

[0295] As used herein, the term "having a sequence different from the amino acid sequence of the corresponding wild-type mtSSB polypeptide" or similar phrases are comparative terms for the amino acid sequence of the mtSSB polypeptide in the present invention and / or the present invention grains being different from the amino acid sequence of the most closely related proteins derived therefrom and / or found in nature. In one embodiment, the amino acid sequence of the mtSSB polypeptide may have one or more insertions, deletions, or amino acid substitutions (or combinations thereof) relative to the corresponding wild-type amino acid sequence. The mtSSB polypeptide may have 2, 3, 4, 5, or 6-10 amino acid substitutions relative to the corresponding wild-type mtSSB polypeptide. In a preferred embodiment, the mtSSB polypeptide is C-terminally truncated, for example lacking the C-terminal 14, 20, or 21 or more amino acids of the wild-type mtSSB polypeptide (see, for example, Table 4). Such truncated mtSSB polypeptides can be encoded, for example, by an mtSSB gene that includes a premature translation stop codon in the protein open reading frame relative to the wild-type mtSSB gene from which it is derived, or by a mutant gene that produces an RNA transcript with different splicing from the wild-type RNA transcript, for example, a gene including a splice site mutation. In another embodiment, the mtSSB polypeptide with reduced activity relative to the corresponding wild-type polypeptide has only a single insertion, a single deletion, or a single amino acid substitution. In this context, "single insertion" and "single deletion" include cases where multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) consecutive amino acids are inserted or deleted, and "corresponding wild-type polypeptide" means the wild-type polypeptide derived from its variants and / or the natural polypeptide most closely related to the variant. As shown in Example 13, such mutations can occur anywhere within the coding region of the protein, preferably within the region of the gene encoding the DNA-binding domain of the mtSSB polypeptide.

[0296] As used herein, the term "mtSSB peptide activity" or a variant thereof refers to at least one biological action of a wild-type mtSSB peptide or a variant thereof. In one instance, this term refers to the binding strength or lack thereof of a peptide or oligomer thereof to single-stranded DNA. Thus, in one embodiment, the single-stranded DNA binding activity of the mtSSB peptides of the present invention, such as truncated mtSSB peptides, is reduced or absent when compared to the activity of wild-type mtSSB peptides, such as peptides comprising the amino acid sequences provided in any of SEQ ID NO:3 or 15 to 39. In this context, comparison is made with the wild-type mtSSB peptide that is most sequence-closest to the mtSSB peptide of the present invention, as determined by amino acid alignment with a known mtSSB peptide sequence, or with a wild-type mtSSB peptide from which the mtSSB peptide of the present invention is derived by mutation. In one embodiment, the mtSSB peptide of the present invention lacks at least a portion of the DNA-binding domain (see [link to relevant documentation]). Figure 9 The peptide may contain a variant (e.g., a C-terminal truncated variant) that binds more weakly to single-stranded DNA compared to the corresponding wild-type mtSSB peptide (e.g., as provided in SEQ ID NO:3). In one instance, this term refers to the binding strength or lack thereof of the peptide or its oligomer to the TWINKLE peptide of the present invention. In another instance, this term refers to the binding strength or lack thereof of the peptide or its oligomer to the RECA3 peptide of the present invention.

[0297] Reduced single-stranded DNA binding activity can be readily determined using standard assays in the art. For example, single-stranded DNA binding can be measured using electrophoretic mobility shift assays (also known as gel mobility shift assays), as described in Farr et al., (2004) and Ciesielski et al., (2016), or preferably as described in Examples 1 and 9 herein. In such assays, a single-stranded DNA substrate and a polypeptide are added to a reaction mixture, and gel electrophoresis is used to determine whether they assemble into a protein-DNA complex.

[0298] As used herein, the terms “mitochondrial single-stranded DNA binding polypeptide-1a,” “mtSSB-1a,” or “TA1,” and their variants, refer to the mtSSB subfamily whose wild-type proteins comprise, for example, the amino acid sequence provided in any one of SEQ ID NO:3 or 15 to 23, or along the full length of a reference sequence, an amino acid sequence that is at least 75% identical to any one or more of SEQ ID NO:3 or 15 or 23. Variants thereof comprise the mtSSB-1a polypeptide, which exhibits reduced or absent ssDNA binding activity due to mutations in the endogenous gene encoding the polypeptide. In one embodiment, the wild-type OsmtSSB-1a polypeptide has one or more of the following motifs: FRGVHRAI(I / L)CGKVGQ(V / A)P(V / L)QKILRNG(R / H)T(V / I)T(V / I)FT(V / I)GTGGMFDQR (motif I, SEQ ID NO:45) corresponding to amino acids 73-114 of SEQ ID NO:3; P(K / M)PAQWHRI(A / S)(V / I)H(N / S)(D / E) (motif II, SEQ ID NO:46) corresponding to amino acids 122-135 of SEQ ID NO:3; AVQ(K / Q)L(V / T)KNS(A / S)VY(V / I)EG(D / E)IE(T / I)R(V / I)YND (motif III, SEQ ID NO:46) corresponding to amino acids 141-164 of SEQ ID NO:3. NO:47); and IC(L / V / I)R(R / G)DGKI(motif IV, SEQ ID NO:48) corresponding to amino acids 176-184 of SEQ ID NO:3. Examples of peptides with reduced OsmtSSB-1a peptide activity include peptides having amino acid sequences as shown below or truncated versions thereof: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, or peptides having at least 75% identical amino acid sequences along the full length of the reference sequence to one or more of the amino acid sequences shown below: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[0299] As used herein, the terms “mitochondrial single-stranded DNA-binding polypeptide-1b” or “mtSSB-1b” and its variants refer to the mtSSB subfamily whose wild-type proteins comprise, for example, the amino acid sequence provided in any one of SEQ ID NO:24 to 29, or along the full length of a reference sequence, an amino acid sequence that is at least 75% identical to any one or more of SEQ ID NO:24 to 29. The mtSSB-1a polypeptide is not included in the group containing the mtSSB-1b polypeptide.

[0300] As used herein, the terms “mitochondrial single-stranded DNA-binding polypeptide-2” or “mtSSB-2” and its variants refer to the mtSSB subfamily whose wild-type proteins comprise, for example, the amino acid sequences provided in any one of SEQ ID NO:30 to 39, or along the full length of a reference sequence, an amino acid sequence that is at least 75% identical to any one or more of SEQ ID NO:30 to 39. The mtSSB-1a polypeptide is not included in the group containing the mtSSB-2 polypeptide.

[0301] As used herein, the term "TWINKLE" refers to a family of proteins and their mutant variants that can be found in the mitochondria of wild-type cereal grains and possess helicase activity. Wild-type TWINKLE proteins play a role in mitochondrial DNA replication. Helicases utilize energy from the hydrolysis of nucleotide triphosphates (NTPs) to catalyze the unwinding of double-stranded DNA. The inventors have discovered that reducing (but not eliminating) the activity of wild-type TWINKLE in cereal grains, preferably rice grains, results in an increase in aleurone thickness (see Example 15). TWINKLE polypeptides include such polypeptides found in wild-type cereal plants and their variants, either artificially produced or found in nature, and may or may not possess helicase activity, including TWINKLE polypeptides with some helicase activity but at a level lower than that of the corresponding wild-type TWINKLE polypeptide. In this context, comparisons are made with the wild-type TWINKLE polypeptide that is most sequence-closest to the present invention, as determined by amino acid alignment, or with the wild-type TWINKLE polypeptide from which the present invention is derived by mutation. In one embodiment, the TWINKLE polypeptide binds to the mtSSB polypeptide. In one embodiment, the TWINKLE polypeptide has helicase activity. In one embodiment, the TWINKLE polypeptide is capable of forming multimers of the TWINKLE polypeptide. TWINKLE typically has five conserved helicase motifs: (1) H1 / Walker A motif, which stabilizes NTP phosphate; (2) H1a, which participates in NTP binding / hydrolysis; (3) H2 / Walker B motif, which contains an arginine finger and a base stack residue, which are required for the localization and stabilization of bound NTPs and the stabilization of bound Mg2+ ions; (4) H3, which, together with H1a, participates in NTP binding / hydrolysis; and (5) H4, which facilitates DNA binding. Furthermore, the C-terminal regions of many Twinkle helicases are essential for interaction with other factors in the replicaseed. In one embodiment, the Twinkle polypeptide comprises an amino acid sequence provided in any one of SEQ ID NO: 64, 80, 82, 84, 86, 88, 90, 92, 94, or 96, or an amino acid sequence that is at least 75% identical along the full length of a reference sequence to any one or more of SEQ ID NO: 64, 80, 82, 84, 86, 88, 90, 92, 94, or 96.

[0302] Decreased helicase activity can be readily determined using standard assays in the art. For example, helicase activity can be determined by measuring the amount of helicase reaction products, such as ADP, inorganic phosphonates, and / or single-stranded DNA. In these assays, fluorescently labeled proteins detect target molecules, such as ADP, inorganic phosphonates, or single-stranded DNA (Tosland et al., 2010). In one example, double-stranded DNA unwinding can be measured to determine helicase activity. This measurement uses a pair of fluorophores (e.g., Cy3) and quenchers (e.g., Dabcyl) located at the ends of the duplex, one pair per DNA strand. During helicase-induced DNA unwinding, the fluorophore and quencher separate from each other, resulting in increased fluorescence (Tosland et al., 2010). In another example, a helicase substrate is generated, consisting of a partially double-stranded DNA substrate with short 5' single-stranded DNA overhangs (Korhonen et al., 2003). The helicase reaction is carried out in a reaction buffer containing the helicase substrate and a polypeptide. Then, the fractions of base-pairing substrates and single-stranded DNA products can be separated and analyzed by gel electrophoresis.

[0303] As used herein, the term "RECA3" refers to a subfamily of plant recombination-associated proteins and their mutant variants, which can be present in the mitochondria of wild-type cereal grains and contribute to reducing inappropriate recombination events in mitochondrial DNA. Not wishing to be theoretically limited, current evidence suggests that RECA3 is involved in directing transition events between short repetitive sequences while allowing the initiation of supervisory mechanisms for recombination-dependent replication at long repetitive sequences (Shedge et al., 2007). The inventors have found that reducing (but not eliminating) the activity of wild-type RECA3 in cereal grains, preferably rice grains, results in increased aleurone thickness. RECA3 peptides comprise such peptides present in wild-type cereal plants and their variants, artificially produced or found in nature, having or lacking recombinase activity, including RECA3 peptides with some recombinase activity but at a reduced level compared to the recombinase activity level of the corresponding wild-type RECA3 peptide. In one embodiment, the RECA3 peptide binds to an mtSSB peptide. In one embodiment, the RECA3 peptide has recombinase activity. RECA3 polypeptides typically have a RecA / RAD51 domain comprising two highly conserved shared motifs, Walker A and Walker B, which are present in ATPases and confer ATP binding and hydrolytic activity. In one embodiment, the RECA3 polypeptide comprises an amino acid sequence as provided in any one of SEQ ID NO: 61, 67, 69, 71, 73, 75, 77, or 79, or an amino acid sequence along the full length of a reference sequence that is at least 75% identical to one or more of SEQ ID NO: 61, 67, 69, 71, 73, 75, 77, or 79.

[0304] The reduction in recombinase activity can be readily determined using standard assays in the art. In one example, a fluorophore-labeled single-stranded DNA substrate and a polypeptide are incubated in a reaction mixture (Silva et al., 2017). A fluorescence quenching effect occurs upon recombinase binding. Fluorescence analysis can be performed using fluorescence spectroscopy. In another example, recombinase activity can be measured using a strand assimilation (or “D-loop”) assay (Jayathilaka et al., 2008). In this assay, the polypeptide is first allowed to assemble on a radiolabeled single-stranded DNA oligonucleotide. A supercoiled target plasmid containing homologous peptides is then added, and the two form a homology-dependent conjugation molecule called a “D-loop”. D-loop proteins can be separated and analyzed by gel electrophoresis and phosphorescence imaging.

[0305] As used herein, the term "substantially purified polypeptide" or "purified polypeptide" means a polypeptide that is at least partially separated from lipids, nucleic acids, other peptides, and other contaminating molecules associated with its native state. Preferably, a substantially purified polypeptide is at least 90% free of other components associated with its native state. In one embodiment, the polypeptide of the present invention has an amino acid sequence different from that of naturally occurring cereal mtSSB, TWINKLE, or RECA3 polypeptides, i.e., amino acid sequence variants as defined above.

[0306] The grains, plants, and host cells of the present invention may include a mutated endogenous gene encoding a variant polypeptide of the present invention or an exogenous polynucleotide encoding a polypeptide of the present invention. In these cases, the grains, plants, and cells produce mutants or recombinant polypeptides. In this context, the term "mutant" means a polypeptide that differs in amino acid sequence from a wild-type polypeptide most closely related to or derived from the polypeptide by mutation. The mutant polypeptide may be expressed at different levels or in different cells or at different time points compared to the wild-type polypeptide most closely related to and / or derived from the polypeptide. In the context of polypeptide, the term "recombinant" refers to a polypeptide encoded by an exogenous polynucleotide produced by a cell, which has been introduced into a cell or progenitor cell by recombinant DNA or RNA technology, such as transformation. In one embodiment, the recombinant polypeptide is identical in amino acid sequence to the wild-type polypeptide, although the recombinant polypeptide may be expressed at different levels or in different cells or at different time points compared to the wild-type polypeptide. In alternative embodiments, the recombinant polypeptide differs in amino acid sequence from a wild-type polypeptide most closely related to or derived from the polypeptide by mutation. Similarly, this recombinant polypeptide can be expressed at different levels or in different cells or at different time points compared to the wild-type polypeptide. Typically, cells contain non-endogenous genes that lead to the production of the altered amount of polypeptide. In one embodiment, the "recombinant polypeptide" is a polypeptide prepared by expressing exogenous (recombinant) polynucleotides in plant cells.

[0307] The peptide identity percentage was determined by GAP (Needleman and Wunsch, 1970) analysis (GCG procedure), where a vacancy generation penalty of 5 and a vacancy extension penalty of 0.3 were used. In one embodiment, the query sequence was at least 150 amino acids long, and the GAP analysis compared the two sequences within a region of at least 150 amino acids. In one embodiment, the query sequence was at least 175 amino acids long, and the GAP analysis compared the two sequences within a region of at least 175 amino acids. In one embodiment, the query sequence was at least 200 amino acids long, and the GAP analysis compared the two sequences within a region of at least 200 amino acids. In one embodiment, the query sequence was at least 300 amino acids long, and the GAP analysis compared the two sequences within a region of at least 300 amino acids. In one embodiment, the query sequence was at least 400 amino acids long, and the GAP analysis compared the two sequences within a region of at least 400 amino acids. In one embodiment, the query sequence is at least 500 amino acids long, and the GAP analysis compares the two sequences within a region of at least 500 amino acids. In one embodiment, the query sequence is at least 600 amino acids long, and the GAP analysis compares the two sequences within a region of at least 600 amino acids. In one embodiment, the query sequence is at least 700 amino acids long, and the GAP analysis compares the two sequences within a region of at least 700 amino acids. Even more preferably, the GAP analysis compares the two sequences over their entire length.

[0308] Regarding the definition of polypeptides, it should be understood that higher percentages of identity than those provided above will cover preferred embodiments. Therefore, where applicable, based on the minimum percentage of identity figures, it is preferred that the polypeptide comprises an amino acid sequence that is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the associated specified SEQ ID NO.

[0309] As used herein, the phrase "at a location corresponding to the number of amino acids" or variations thereof refers to the relative location of an amino acid relative to its surrounding amino acids within the context of one or more specific amino acid sequences. In some embodiments, the polypeptides of the present invention may have deletion or substitution mutations that alter the relative location of amino acids when compared, for example, with SEQ ID NO:3. Determining the corresponding amino acid locations between two closely related proteins is entirely within the capabilities of those skilled in the art.

[0310] Conserved amino acids of mtSSB, TWINKLE, and RECA3 peptides can be readily identified by comparing the amino acid sequences of wild-type peptides, as described herein. For example, the amino acid sequence of rice OsmtSSB-1a (TA1) (SEQ ID NO:3) can be compared with mtSSB-1a peptides from other species, or even with mtSSB from rice or other plant species, specifically plant species such as Arabidopsis thaliana (SEQ ID NO:15), sorghum (SEQ ID NO:17), barley (SEQ ID NO:18), common wheat (SEQ ID NO:19 and 22), Brachypodium distichum (SEQ ID NO:20), and Populus tomentosa (SEQ ID NO:21) (see example). Figure 9 ).

[0311] Amino acid sequence mutants of the polypeptides of the present invention can be prepared by mutagenesis of cereal progenitor cells, for example by mutagenesis of cereal seeds, by random mutagenesis with a mutagen followed by screening for a mutagenic population of mutants in the endogenous gene encoding the polypeptide, or by targeted mutagenesis, for example, using gene editing tools. Amino acid sequence mutants can also be prepared by introducing appropriate nucleotide changes into the nucleic acids of the present invention. Such mutants comprise, for example, deletions, insertions, or substitutions of residues within the amino acid sequence, which can occur anywhere along the length of the wild-type polypeptide. Combinations of deletions, insertions, and substitutions can be made to achieve the final construct, provided that the final peptide product has the desired properties. Preferably, the amino acid sequence mutants have only one, two, three, four, or fewer than 10 amino acid changes relative to a reference wild-type polypeptide. The mutant peptides of the present invention exhibit "reduced activity" compared to the corresponding wild-type naturally occurring peptides, such as peptides whose amino acid sequences are shown, for example, in the following or truncated versions thereof: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, or peptides having, along the full length of the reference sequence, at least 75%, at least 80%, at least 85%, preferably at least 90%, or more preferably at least 95% of the amino acid sequences shown below: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[0312] Mutant (altered) peptides can be prepared using any technique known in the art, such as directed evolution or rational design strategies. Products derived from mutated / altered DNA can be readily screened using the techniques described herein to determine whether their activity is reduced, for example by screening by tilling (see Example 1). For example, the method may include generating transgenic plants expressing mutated / altered DNA and determining i) the effect of the mutated / altered DNA on aleurone thickness and ii) whether the mtSSB, TWINKLE, or RECA3 genes have been mutated / altered (e.g., using the method described in Example 13). Therefore, the peptides and polynucleotides of the present invention can be used for screening assays to determine their biological effects.

[0313] When designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the property to be modified. The mutation site can be modified individually or sequentially, for example by (1) substitution with non-conservative amino acid selection, (2) deletion of the target residue, or (3) insertion of other residues adjacent to the location site.

[0314] The range of amino acid sequence deletion is typically about 1 to 15 residues, more preferably about 1 to 10 residues, and usually about 1 to 5 consecutive residues.

[0315] A substitution mutant removes at least one amino acid residue from a polypeptide molecule and inserts a different residue at its position. When it is not desired to maintain or reduce a certain activity, non-conservative substitution is preferred, specifically at highly conserved amino acid locations within the relevant protein family. Examples of conserved substitutions are shown in Table 1, and therefore non-conservative substitutions will be those not shown in Table 1.

[0316] Table 1: Conservative Substitution.

[0317]

[0318] In one embodiment, the mutant / variant peptide has only one, two, three, or four amino acid changes compared to a naturally occurring peptide. In a preferred embodiment, the change occurs in one or more motifs that are highly conserved, specifically in known conserved domains, among the different mtSSB, TWINKLE, or RECA3 peptides presented herein. As those skilled in the art will appreciate, it is reasonable to predict that such changes would reduce the peptide's activity when expressed in cells or cereal grains.

[0319] The primary amino acid sequence of the polypeptide of the present invention can be used to design its variants / mutants based on comparisons with closely related enzymes. As those skilled in the art will understand, changes to highly conserved residues in closely related proteins are more likely to reduce activity than changes to less conserved residues. In the context of this invention, alignment of amino acid sequences from mtSSB, TWINKLE, or RECA3 proteins from a range of sources is used to identify those more highly conserved and those less conserved amino acid residues.

[0320] Polynucleotides and genes

[0321] This invention refers to various polynucleotides. As used herein, "polynucleotide," "nucleic acid," or "nucleic acid molecule" means a polymer of nucleotides that can be DNA or RNA and includes genomic DNA, mRNA, cRNA, dsRNA, and cDNA. It can be cellular, genomic, or synthetically derived DNA or RNA, for example, prepared on an automated synthesizer, and can be combined with carbohydrates, lipids, proteins, or other substances, labeled with fluorescent or other groups, or linked to a solid support to perform specific activities as defined herein, or include one or more modified nucleotides not found in nature, as is well known to those skilled in the art. The polymer can be single-stranded, substantially double-stranded, or partially double-stranded. Base pairing as used herein refers to standard base pairing between nucleotides, comprising G:U base pairs. "Complementary" means that two polynucleotides are capable of base pairing (hybridization) along a portion of their length or along the full length of one or both. "Hybridized polynucleotide" means that the polynucleotide actually pairs with its complement base. The term "polynucleotide" is used interchangeably with the term "nucleic acid" herein. Preferred polynucleotides of this invention encode the polypeptides of this invention.

[0322] "Separated polynucleotide" means a polynucleotide that, if present in nature, is at least partially separated from a polynucleotide sequence associated with or linked to the natural state of the polynucleotide. Preferably, if present in nature, the separated polynucleotide is at least 90% free of other components naturally associated with it. Preferably, the polynucleotide is not naturally occurring, for example, by covalently linking two shorter polynucleotide sequences in a manner not present in nature (chimeric polynucleotide).

[0323] This invention relates to the reduction of gene activity and the construction and use of chimeric genes. As used herein, the term "gene" includes any deoxyribonucleotide sequence containing a protein-coding region or a region transcribed but not translated in the cell, as well as associated non-coding and regulatory regions. Such associated regions are typically located near both the 5' and 3' ends of the coding or transcribed region, approximately 2 kb from either end. In this respect, a gene may contain control signals naturally associated with a given gene, such as promoters, enhancers, termination and / or polyadenylation signals, or heterologous control signals; in this case, the gene is referred to as a "chimeric gene." A sequence located at the 5' end of a coding region and present on mRNA is called a 5' untranslated sequence. A sequence located at the 3' end or downstream of a coding region and present on mRNA is called a 3' untranslated sequence. The term "gene" encompasses both cDNA and genomic genes.

[0324] "Allele" refers to a specific form of a genetic sequence (such as a gene) within a cell, individual plant, or population that differs from other forms of the same gene at at least one, and usually more than one, variation site in the sequence of that gene. The sequences at these variation sites that differ between different alleles are referred to as "variations" or "polymorphisms." As used herein, "polymorphism" refers to variations in the nucleotide sequence between alleles of the genetic loci of this invention in different species, varieties, strains, or individuals of plants. "Polymorphic localization" is the preselected nucleotide localization in a gene sequence where sequence differences occur. In some cases, genetic polymorphism results in variations in the amino acid sequence within a polypeptide encoded by a gene, and therefore polymorphic localization may result in the polymorphism in the amino acid sequence being located at a predetermined location in the polypeptide sequence. In other cases, the polymorphic region may be located in a non-polypeptide-coding region of a gene, such as in a promoter region, and may thereby affect the gene's expression level. Typical polymorphisms are deletions, insertions, or substitutions. These can involve a single nucleotide (single nucleotide polymorphism or SNP) or two or more nucleotides.

[0325] As used herein, a “mutation” is a polymorphism that produces a phenotypic change in a plant or a part thereof. In this context, the primary phenotypic change is the thickening of the aleurone in cereal grains relative to the wild-type (non-mutant) form. As is known in the art, some polymorphisms are silent, such as single nucleotide changes in protein-coding regions that do not alter the amino acid sequence of the encoded polypeptide due to redundancy of the genetic code. Diploid plants will typically have one or two distinct alleles for a single gene, but if two copies of the gene are identical, i.e., the plant is homozygous for the alleles, it has only one allele. Polyploid plants typically have more than one partial homolog for any particular gene. For example, hexaploid wheat has three subgenomes (often referred to as the “genome”) designated as genomes A, B, and D, and therefore it has most of its genes with three partial homologs, each of genomes A, B, and D having one homology.

[0326] The term "gene" refers to a nucleotide sequence encoding a polypeptide as defined herein. A gene can be an endogenous, naturally occurring gene or include genetic variations, preferably introduced genetic variations, as defined herein. Genes encoding polypeptides in the grains of the present invention may or may not have introns. In one example, the grains of the present invention are derived from rice, and at least one allele of the OsmtSSB-1a gene encodes an OsmtSSB-1a polypeptide (such as one comprising the amino acid sequence provided in SEQ ID NO:3) whose activity is reduced compared to that of the OsmtSSB-1a polypeptide from the corresponding wild-type rice plant. Examples of OsmtSSB-1a peptides with reduced activity include one or more of these peptides having an amino acid sequence consisting of an amino acid sequence provided as shown below or in truncated versions thereof: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10, or a peptide having an amino acid sequence that is at least 75%, at least 90%, or preferably at least 95% identical to one or more of the amino acid sequences shown below but no longer of the same length: SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.

[0327] In one embodiment, a genetic variation reduces the expression of an endogenous gene encoding a wild-type mitochondrial polypeptide as described herein. As used herein, the phrase “reduced expression of an endogenous gene” or variations thereof refers to any genetic variation that (partially) reduces or completely prevents the expression of a gene encoding a functional polypeptide as defined herein. Such genetic variations include mutations in the promoter region of a gene that reduce gene transcription, such as by using gene editing to delete or substitute nucleotides in the promoter of a gene, or by altering the amount or location of splicing to form intron splicing mutations in mRNA.

[0328] The genomic form or clone of a gene containing a transcribed region can be interrupted by a non-coding sequence referred to as an "intron," "intercalation region," or "intercalation sequence," which may be homologous or heterologous to the "exon" of the gene. As used herein, an "intron" is a segment of a gene that is transcribed as part of a primary RNA transcript but is not present in a mature mRNA molecule. Introns are removed or "spliced ​​out" from nuclear transcripts or primary transcripts; therefore, introns are not present in messenger RNA (mRNA). As used herein, an "exon" is a region of DNA that corresponds to an RNA sequence present in a mature mRNA or mature RNA molecule when the RNA molecule is not translated. mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term "gene" includes synthetic or fusion molecules encoding all or part of the proteins of the invention described herein, as well as nucleotide sequences complementary to any of the foregoing. Genes can be introduced into suitable vectors for extrachromosomal maintenance in cells or preferably for integration into the host genome.

[0329] As used herein, a "chimeric gene" means any gene that includes covalently linked sequences that are not connected in nature. Typically, chimeric genes include regulatory and transcriptional or protein-coding sequences that are not present together in nature. Therefore, chimeric genes can include regulatory and coding sequences derived from different sources or regulatory and coding sequences derived from the same source but arranged in a manner different from their natural counterparts. In one embodiment, the protein-coding region of a gene is operatively linked to a promoter or polyadenylation / terminator region heterologous to the gene, thereby forming a chimeric gene. In an alternative embodiment, when present in cereal grains, a gene encoding a polynucleotide that downregulates the production and / or activity of a polypeptide in the grain is operatively linked to a promoter or polyadenylation / terminator region heterologous to the polynucleotide, thereby forming a chimeric gene.

[0330] The term "endogenous" in this paper refers to substances that are normally present or produced in unmodified cereal plants at the same developmental stage as the plant under study. "Endogenous gene" refers to a naturally occurring gene that is located in its natural position within the genome of an organism. As used herein, "recombinant nucleic acid molecule," "recombinant polynucleotide," or variants thereof refers to a nucleic acid molecule that has been constructed or modified using recombinant DNA technology, including nucleic acid molecules that have been mutated as modified endogenous genes using gene editing technologies, such as TALENS or CRISPR. The terms "exogenous polynucleotide," "foreign polynucleotide," or "heterologous polynucleotide," etc., refer to any nucleic acid that has been experimentally manipulated, including those introduced into the genome of a cell using gene editing technology.

[0331] Foreign or exogenous genes can be genes inserted into a non-natural organism, natural genes introduced into a new location within a natural host, chimeric genes, or endogenous genes that have been modified using gene editing techniques. A "transgenic" gene is a gene introduced into the genome through a transformation procedure. The term "genetically modified" is broader and includes not only the introduction of genes into cells through transformation or transduction, but also the mutation of genes within cells, such as the introduction of insertions, deletions, or substitutions into endogenous genes using gene editing techniques, as well as altering or regulating the regulation of genes in cells or organisms, or progenitor cells or organisms, that exert these effects.

[0332] Furthermore, in the context of polynucleotides (nucleic acids), the term "exogenous" refers to a polynucleotide present in cells that do not naturally include polynucleotides. Cells can be those containing non-endogenous polynucleotides that alter the production of the encoded polypeptide, such as exogenous polynucleotides that increase the expression of endogenous polypeptides, or cells that do not produce polypeptides in their natural state. The increased yield of the polypeptides of the present invention is also referred to herein as "overexpression." The exogenous polynucleotides of the present invention comprise polynucleotides that have not yet been isolated from other components of the transgenic (recombinant) cells or cell-free expression systems in which they are present, as well as polynucleotides subsequently purified from at least some of these other components in such cells or cell-free systems. Exogenous polynucleotides (nucleic acids) can be continuous segments of nucleotides present in nature, or can comprise two or more continuous segments from different sources (naturally occurring and / or synthetic) linked to form a single polynucleotide. Typically, such chimeric polynucleotides comprise at least an open reading frame encoding the polypeptide of the present invention, said open reading frame being operatively linked to a promoter adapted to drive open reading frame transcription in the cells of interest.

[0333] The polynucleotide identity percentage was determined by GAP (Needleman and Wunsch, 1970) analysis (GCG procedure), where a vacancy production penalty of 5 and a vacancy extension penalty of 0.3. In one embodiment, the query sequence is at least 450 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 450 nucleotides. In one embodiment, the query sequence is at least 525 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 525 nucleotides. In one embodiment, the query sequence is at least 600 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 600 nucleotides. In one embodiment, the query sequence is at least 900 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 900 nucleotides. In one embodiment, the query sequence is at least 1,200 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 1,200 nucleotides. In one embodiment, the query sequence is at least 1,500 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 1,500 nucleotides. In one embodiment, the query sequence is at least 1,800 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 1,800 nucleotides. In one embodiment, the query sequence is at least 2,100 nucleotides long, and the GAP analysis compares the two sequences within a region of at least 2,100 nucleotides. Even more preferably, the GAP analysis compares the two sequences over their entire length.

[0334] Regarding the definition of polynucleotides, it should be understood that higher identity % figures than those provided above will cover preferred embodiments. Therefore, where applicable, according to the minimum identity % figures, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 75%, more preferably at least 80%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant specified SEQ ID NO.

[0335] This invention also relates to the use of oligonucleotides, for example, in methods for screening polynucleotides or polynucleotides encoding polypeptides of the present invention. As used herein, an "oligonucleotide" is a polynucleotide with a length of up to 50 nucleotides. The minimum size of such oligonucleotides is the size required to form a stable hybrid between the oligonucleotide and a complementary sequence on the nucleic acid molecule of the present invention. It can be RNA, DNA, or a combination or derivative thereof. Oligonucleotides are typically relatively short single-stranded molecules of 10 to 30 nucleotides, typically 15-25 nucleotides in length. When used as probes or primers in amplification reactions, the minimum size of such oligonucleotides is the size required to form a stable hybrid between the oligonucleotide and a complementary sequence on the target nucleic acid molecule. Preferably, the oligonucleotide is at least 15 nucleotides in length, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, and even more preferably at least 25 nucleotides. Oligonucleotides used as probes in the present invention are typically conjugated with labels such as radioisotopes, enzymes, biotin, fluorescent molecules, or chemiluminescent molecules.

[0336] This invention comprises oligonucleotides that can be used, for example, as probes for identifying nucleic acid molecules, or as primers for generating nucleic acid molecules, or as guide sequences for gene editing. The probes and / or primers can be used to clone homologs of the polynucleotides of this invention from other species. Furthermore, hybridization techniques known in the art can be used to screen genomic or cDNA libraries of such homologs.

[0337] The polynucleotides and oligonucleotides of the present invention comprise those that hybridize under stringent conditions to one or more of the sequences provided such as SEQ ID NO: 1, 2, 4 to 7, 11 to 14, 49 to 60, 62, 63, 65, 66, 68, 70, 72, 74, 76, 78, 81, 83, 85, 87, 89, 91, 93, 95 or 97. As used herein, the stringent conditions are as follows: (1) low ionic strength and high temperature are used for washing, for example at 50°C with 0.015M NaCl / 0.0015M sodium citrate / 0.1% NaDodSO4; (2) denaturing agents such as formamide are used during hybridization at 42°C, for example, 50% (v / v) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate; or (3) at 42°C with 50% formamide, 5x SSC (0.75M NaCl, 0.075M sodium citrate), 50 mM sodium phosphate (pH 6.5) in 0.2x SSC and 0.1% SDS. 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50g / ml), 0.1% SDS and 10% dextran sulfate.

[0338] When compared to naturally occurring molecules, the polynucleotides of the present invention may have one or more mutations, said mutations being the deletion, insertion, or substitution of nucleotide residues. Mutants may be naturally occurring (i.e., isolated from natural sources) or synthetic (e.g., through site-directed mutagenesis of nucleic acids). Variations of the polynucleotides or oligonucleotides of the present invention comprise molecules of different sizes of the genome of a reference polynucleotide or oligonucleotide molecule as defined herein, preferably a cereal genome close to an endogenous gene, and / or molecules capable of hybridizing with said cereal genome. For example, variants may include additional nucleotides (e.g., 1, 2, 3, 4, or more) or fewer nucleotides, as long as they still hybridize with the target region. Furthermore, several nucleotides may be substituted without affecting the ability of the oligonucleotide to hybridize with the target region. Additionally, variants can be readily designed whose hybridization is close to, for example, within 50 nucleotides, the plant genome region for specific oligonucleotide hybridization as defined herein. Specifically, this includes polynucleotides encoding the same polypeptide or amino acid sequence but with nucleotide sequences varying due to redundancy in the genetic code. The terms "polynucleotide variant" and "variant" also include naturally occurring allelic variants.

[0339] Genetic variation

[0340] As used herein, the term "genetic variation" refers to one or more cells in a grain, preferably cells in at least one or all of the developing endosperm, seed coat, aleurone, and embryo of a developing grain, more preferably cells in one or all of the seed coat, aleurone, and embryo of a developing grain or a part thereof, having genetic modifications that may be introduced by humans or that may be naturally present in cereal plants (e.g., hybridization to produce the plant of the invention). A grain may include two, three, four, or more genetic variations in the same or different genes. In one example, the mtSSB gene includes two genetic variations that reduce the level and / or activity of the mtSSB polypeptide in cereal grains. In another example, a cereal grain includes a genetic variation in the mtSSB gene that reduces the level and / or activity of the mtSSB polypeptide in cereal grains, and / or a genetic variation in the TWINKLE gene that reduces the level and / or activity of the TWINKLE polypeptide in cereal grains, and / or a genetic variation in the RECA3 gene that reduces the level and / or activity of the RECA3 polypeptide in cereal grains. In a preferred embodiment, each cell in the cereal grain or plant or a portion thereof includes the introduced genetic variation. In one embodiment, the cell, grain, or plant of the present invention is homozygous for one or more genetic variations. In an alternative embodiment, the cell, grain, or plant of the present invention is heterozygous for one or more genetic variations, or heterozygous for one genetic variation and homozygous for another. As those skilled in the art will understand, many different types of genetic modifications can be made, such as, but not limited to, mutations in endogenous genes encoding polypeptides, said mutations may be in the protein-coding region of the gene or expression elements such as promoters, for example, mutations introduced by gene editing that reduces the activity of endogenous genes, or mutations introduced using tilling to select plants that produce grains with reduced polypeptide activity. Alternatively, genetic modification includes the introduction of a nucleic acid construct encoding an exogenous polynucleotide that reduces gene expression, such as a dsRNA molecule or microRNA, or a nucleic acid construct encoding an exogenous polynucleotide that encodes a polypeptide with an amino acid sequence different from that of the corresponding wild-type polypeptide and with reduced activity compared to the corresponding wild-type polypeptide.

[0341] Mutagenesis

[0342] The plants of this invention can be produced and identified after mutagenesis. This can provide non-GMO plants, which is desirable in some markets.

[0343] Mutants can be naturally occurring (i.e., isolated from a natural source), synthetic (e.g., through mutagenesis of nucleic acids), or induced. Typically, mutagenesis can be induced in cereal progenitor cells, tissues, seeds, or plants to produce single or multiple mutations, such as nucleotide substitutions, deletions, additions, and / or codon modifications. In the context of this application, an "induced mutation" is an artificially induced genetic variation that can be the result of chemical, radiation, or biologically based mutagenesis, such as transposon or T-DNA insertions. In some embodiments, the mutation is a null mutation that completely inactivates the gene, such as a nonsense mutation, frameshift mutation, insertion mutation, or splice site variant. Nucleotide insertion derivatives comprise 5' and 3' end fusions and intra-sequence insertions of one or more nucleotides. Inserted nucleotide sequence variants refer to those that introduce one or more nucleotides into a nucleotide sequence, which can be obtained by random insertion and appropriate screening of the resulting products. Deletion variants are characterized by the removal of one or more nucleotides from the sequence. Preferably, the mutant gene has only a single insertion or deletion of the nucleotide sequence relative to the wild-type gene. A substituted nucleotide variant is one in which at least one nucleotide in the sequence has been removed and a different nucleotide has been inserted at its position. The preferred number of nucleotides affected by substitutions in the mutant gene relative to the wild-type gene is a maximum of ten nucleotides, more preferably a maximum of nine, eight, seven, six, five, four, three, or two nucleotides, or even just one nucleotide. Such substitutions may be “silent” because they do not change the amino acid defined by the codon. Alternatively, conserved substitutions are designed to change one amino acid to another similarly functioning amino acid. Typical conserved substitutions are those performed according to Table 1.

[0344] As used herein, the term “mutation” does not include silent nucleotide substitutions that do not affect gene activity, and therefore includes changes in the gene sequence that affect only gene activity. The term “polymorphism” refers to any variation in the nucleotide sequence that includes such silent nucleotide substitutions.

[0345] In some embodiments, cereal grains include at least a portion of the nonconserved substitution deletion of the mtSSB gene, the TWINKLE gene, or the RECA3 gene, or frameshift or splice site variations in such genes.

[0346] In some embodiments, one or more mutants are located within a conserved region of a gene encoding an mtSSB polypeptide that encodes a conserved motif, such as an amino acid sequence as listed in SEQ ID NO:45 to 48. In some embodiments, one or more mutations are located within the OsmtSSB-1a region encoding the DNA-binding domain of OsmtSSB-1a.

[0347] Mutagenesis can be achieved chemically or irradiated, such as by EMS or sodium azide (Zwar and Chandler, 1995). Chemical mutagenesis tends to favor nucleotide substitutions rather than deletions. Heavy ion beam (HIB) irradiation is known as an effective mutation breeding technique to produce new plant varieties; see, for example, Hayashi et al. (2004) and Kazama et al. (2008). Ion beam irradiation has two physical factors, namely the dose (gy) and LET (linear energy transfer, keV / µm), which determine the biological effects of the amount of DNA damage and the size of DNA deletion, and these can be adjusted according to the desired degree of mutagenesis. HIB produces a range of mutants, many of which include deletions, which can be screened for mutations in the mtSSB gene. The identified useful mutants can be backcrossed with non-mutant plants as recurrent parents to remove and thus reduce the effects of unlinked mutations in the mutated genome.

[0348] Biopharmaceuticals used to generate site-specific mutants contain enzymes that stimulate double-strand breaks in DNA to induce endogenous repair mechanisms. These include endonucleases, zinc finger nucleases, transposases, and site-specific recombinases. Zinc finger nuclease technology is reviewed in Le Provost et al. (2009), Durai et al. (2005), and Liu et al. (2010).

[0349] Mutants can be isolated by screening mutagenized plants or seeds. For example, a decrease in the expression of aleurone or a gene in a mutagenized population of cereals can be screened by RT-PCR, or a mutation in a gene in the mutagenized population can be screened directly by PCR or heteroduplex-based assays, or a reduction in protein in the mutagenized population can be screened by ELISA or Western blotting analysis. Alternatively, mutations can be identified using techniques such as tilling in mutagenized populations mutated with agents such as EMS (Slade and Knauf, 2005) or by deep sequencing of mutagenized pools. Such mutations can then be introduced into the desired genetic background by crossing the mutant with plants of the desired genetic background and performing an appropriate number of backcrosses to eliminate initially undesirable parental background.

[0350] Mutations can be introduced directly into plants through mutagenesis or indirectly through hybridization of two parent plants, one of which includes the introduced mutation. The modified plants can be transgenic or non-transgenic. Using mutagenesis, non-transgenic plants with reduced or substantially absent mtSSB-1a levels or activity can be produced. The invention also extends to grains or other plant parts produced from plants and any propagating material that can be used to produce plants with desired characteristics, such as cultured tissues or cells. The invention clearly extends to methods for producing or identifying such plants or grains produced from such plants.

[0351] TILLING

[0352] The plants of this invention can be produced using a method known as TILLING (targeted induced local damage in the genome), as described, for example, in Example 13 herein. The first step involves inducing introduced mutations, such as novel single-base-pair changes, in a plant population by treating seeds (or pollen) with a chemical mutagen, and then advancing the plants to a generation in which the mutation is stably inherited. This is typically the M2 generation. DNA is extracted from individual plants or small pools of plants, and seeds are stored by all members of the population to create a resource that can be repeatedly accessed over time.

[0353] For TILLING assays, PCR primers are designed to specifically amplify a single gene target of interest, such as genes encoding mtSSB-1a, TWINKLE, or RECA3. Specificity is especially important if the target is a member of a gene family or a part of a polyploid genome, as in hexaploid or tetraploid wheat. Next, dye-labeled primers can be used to amplify the PCR products from pooled DNA from multiple individuals. These PCR products are denatured and re-annealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from a population may carry the same polymorphism) and induced SNPs (i.e., only rare individual plants may show the mutation). After heteroduplex formation, the use of endonucleases that recognize and cleave the mismatched DNA, such as CelI, is key to discovering novel SNPs in the TILLING population.

[0354] Using this method, thousands of plants can be screened to identify any individual with a single base change and small insertions or deletions (1-30 bp) in any gene or specific region of the genome. The size of the genomic fragments being determined can range from 0.3 kb to 1.6 kb. With 8-fold pooling, 1.4 kb fragments (ignoring SNP detection of fragment ends problematic due to noise), and 96 lanes per determination, this combination allows screening up to one million base pairs of genomic DNA per single determination, making TILLING a high-throughput technique.

[0355] TILLING is further described in Slade and Knauf (2005) and Henikoff et al. (2004).

[0356] Besides its efficient mutation detection capabilities, high-throughput tilling is an ideal technique for detecting natural polymorphisms. Therefore, interrogating unknown homologous DNA by transecting heteroduplexes into known sequences reveals the number and location of polymorphic sites. Both nucleotide variations and small insertions and deletions are identified, encompassing at least some number of repeat polymorphisms. This is known as ecotilling (Comai et al., 2004).

[0357] Each SNP is recorded by its approximate location within a few nucleotides. Therefore, each haplotype can be archived based on its mobility. Using aliquots of the same amplified DNA used for mismatch cut assays, sequence data can be obtained with relatively small incremental efforts. The left or right sequencing primers for a single reaction are selected based on their proximity to the polymorphism. The sequencer software performs multiple alignments and detects base changes, which in each case confirm the gel bands.

[0358] Ecotilling is more cost-effective than the full sequencing methods currently used for most SNP discovery. Plates containing aligned ecotype DNA can be screened, rather than pools of DNA from mutagenized plants. Because detection is performed on gels with near-base-pair resolution and a uniform background pattern across lanes, bands of the same size can be matched, allowing SNP discovery and genotyping in a single step. In this way, final sequencing of SNPs is simple and efficient, and more importantly, aliquots of the same PCR products used for screening can be sequenced.

[0359] Genome editing using site-specific nucleases

[0360] Genome editing can be used to modify genes encoding peptides as defined herein. Genome editing utilizes engineered nucleases consisting of sequence-specific DNA-binding domains fused to a nonspecific DNA cleavage module. These chimeric nucleases achieve efficient and precise genetic modification by inducing targeted DNA double-strand breaks, which stimulate the cell's endogenous cellular DNA repair mechanisms to repair the induced breaks. Such mechanisms include, for example, error-prone non-homologous end joining (NHEJ) and homology-directed repair (HDR).

[0361] In the presence of a donor plasmid with extended homologous arms, HDR can lead to the introduction of single or multiple transgenes to correct or replace existing genes. In the absence of a donor plasmid, NHEJ-mediated repair produces small insertion or deletion mutations on the target gene that cause damage.

[0362] Engineered nucleases that can be used in the methods of the present invention include zinc finger nucleases (ZFNs), transcription activator-like (TAL) effector nucleases (TALENs), and CRISPR-Cas9 or Cas12 type site-specific nucleases.

[0363] Typically, nuclease-encoded genes are delivered to cells via plasmid DNA, viral vectors, or in vitro transcribed mRNA. The use of fluorescent alternative reporter vectors also allows for the enrichment of ZFN-modified, TALEN-modified, or CRISPR-modified cells.

[0364] Complex genomes often contain multiple copies of sequences that are identical to or highly homologous to the intended DNA target, potentially leading to off-target activity and cytotoxicity. To address this issue, structural approaches (Miller et al., 2007; Szczepek et al., 2007) and selection-based approaches (Doyon et al., 2011; Guo et al., 2010) can be used to generate improved ZFN and TALEN heterodimers with optimized cleavage specificity and reduced toxicity.

[0365] According to a preferred embodiment of the invention, in order to target genetic recombination or mutation via ZFN, two 9 bp zinc finger DNA recognition sequences must be identified in the host DNA. These recognition sites will be in reverse orientation relative to each other and separated by approximately 6 bp of DNA. ZFNs are then generated by designing and producing combinations of zinc fingers that specifically bind to DNA at the target loci, and then attaching the zinc fingers to DNA cleavage domains.

[0366] Transcription activator-like (TAL) effector nucleases (TALENs) include the TAL effector DNA-binding domain and the endonuclease domain.

[0367] TAL effectors are proteins of plant pathogens injected into plant cells by pathogens. Within these cells, they travel to the nucleus and act as transcription factors to initiate specific plant genes. The primary amino acid sequence of a TAL effector determines the nucleotide sequence it binds to. Therefore, the target sites of TAL effectors can be predicted, and TAL effectors can be designed and generated for binding to specific nucleotide sequences.

[0368] Fused with the nucleic acid sequence encoding the TAL effector is a sequence encoding a nuclease or a portion of a nuclease, typically derived from a type II restriction endonuclease, such as the nonspecific cleavage domain of FokI (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. The fact that some endonucleases (e.g., FokI) act only as dimers can be used to enhance the target specificity of the TAL effector. For example, in some cases, each FokI monomer can fuse with a TAL effector sequence that recognizes a different DNA target sequence, and the inactive monomers can only bind together to produce a functional enzyme when the two recognition sites are very close. By requiring DNA binding to activate the nuclease, highly site-specific restriction enzymes can be produced.

[0369] Sequence-specific TALENs can recognize specific sequences within a pre-selected target nucleotide sequence in a cell. Therefore, in some embodiments, nuclease recognition sites within the target nucleotide sequence can be scanned, and specific nucleases can be selected based on the target sequence. In other cases, TALENs can be programmed to target specific cellular sequences.

[0370] Genome editing using CRISPR (gene editing)

[0371] Nucleases can be used to generate single-strand or double-strand breaks in genomic DNA in a sequence-specific manner, i.e., by targeting specific nucleotide sequences. Genomic DNA breaks in eukaryotic cells are repaired using non-homologous end joining (NHEJ) or homologous directed repair (HDR) pathways. NHEJ may produce imperfect repairs, resulting in mutations, typically short deletions, e.g., 1–30 base pairs. In contrast, HDR can enable precise gene insertion by using exogenously supplied repair DNA templates. CRISPR-associated (Cas) proteins have received considerable attention, and although transcription activator-like effector nucleases (TALENs) and zinc finger nucleases remain useful, the CRISPR-Cas system provides a simpler, more versatile, and cheaper tool for genome modification (Doudna and Charpentier, 2014).

[0372] CRISPR-Cas systems are classified into two main groups using various nucleases or combinations of nucleases. In class 1 CRISPR-Cas systems (types I, III, and IV), the effector module consists of a multi-protein complex, while class 2 systems (types II, V, and VI) use only one effector protein (Makarova et al., 2015). Cas contains genes coupled to, near, or located close to CRISPR loci. Haft et al. (2005) provided a review of the Cas protein family.

[0373] Nucleases are guided by synthetic small guide RNAs (sgRNAs or gRNAs), which may or may not contain tracRNA, thus simplifying the CRISPR-Cas system to two genes: the endonuclease and the sgRNA (Jinek et al., 2012). sgRNAs are typically regulated by PolIII promoters, such as U3 or U6 small nuclear RNA promoters. sgRNAs usually consist of a CRISPRRNA (crRNA) spacer and repeat sequences, along with Cas effector proteins, forming a complex to recognize protospacer adjacent motifs (PAMs) present in the target nucleotide sequence. sgRNAs recognize specific genes and the target portion of the gene through sequence homology. The protospacer adjacent motif (PAM) is adjacent to the target site, thus limiting the number of potential CRISPR-Cas targets in the genome, although amplification of the nuclease also increases the number of available PAMs. Cas nucleases are activated by base pairing between the crRNA space and the complementary target nucleotide sequence. There are many online tools available for designing gRNAs, including CHOPCHOP (http: / / chopchop.cbu.uib.no), CRISPR design (https: / / omictools.com / crispr-design-tool), E-CRISP (http: / / www.e-crisp.org / E-CRISP / ), and Geneious or Benchling (https: / / benchling.com / crispr).

[0374] In one instance, a guide RNA (gRNA) target sequence of about 17, 18, 19, or 20 nucleotides is identified from the cDNA sequence of a gene encoding one or more of the following polypeptides as defined herein, preferably mtSSB-1 or mtSSB-1a polypeptide, TWINKLE polypeptide, or RECA3 polypeptide, followed by a 3-nucleotide PAM (protospacer adjacent motif) sequence.

[0375] The CRISPR-Cas system is the most commonly used system for gene editing in plant genetic modification, typically employing Cas9 effector proteins such as RNA-guided Streptococcus pyogenes Cas9 or optimized sequence variants from various plant species (Luo et al., 2016). Luo et al. (2016) summarized numerous studies in which genes have been successfully targeted across various plant species, resulting in indels and loss-of-function mutant phenotypes in endogenous gene open reading frames and / or promoters. Modified Cas9, such as xCas9, can be used in cases requiring variant PAM sequences (Hu et al., 2018). Due to the cell wall on plant cells, delivery of CRISPR-Cas mechanisms into cells and successful transgene regeneration often utilizes Agrobacterium tumefaciens infection (Luo et al., 2016) or plasmid DNA particle bombardment or bioballistic delivery. Vectors suitable for cereal conversion include pCXUNcas9 (Sun et al., 2016) or pYLCRISPR / Cas9Pubi-H (Ma et al., 2015, accession number KR029109.1), which are available from Addgene.

[0376] Alternative CRISPR-Cas systems are diverse and include effector enzymes containing the RuvC domain of a nuclease but lacking the HNH domain. These effector enzymes include Cas12 enzymes, including Cas12a, Cas12b, Cas12f, Cpf1, C2c1, C2c3, and engineered derivatives. In plants, Cpf1 from *Prevotella* and *Francisella* has been successfully used as a substitute for Cas9. Cpf1 generates double-strand breaks in a staggered manner at the distal PAM location and, as a smaller endonuclease, can provide an advantage in some species (Begemann et al., 2017). Other CRISPR-Cas systems contain RNA-guided RNases, including Cas13, Cas13a (C2c2), Cas13b, and Cas13c. Alternative CRISPR-Cas systems include complex nucleases and effector subsystems designed and applied in the context of mutations in endogenous plant genes, such as the CRISPR-TiD system (Osakabe et al., 2020); or complex nucleases and repair enzymes, such as primer editing systems described by Anzalone et al., (2019) that can tightly control cell repair and sequence insertion that occur after DNA cleavage.

[0377] Sequence insertion or integration

[0378] The CRISPR-Cas system can be combined with the provision of nucleic acid sequences to guide homology repair for sequence insertion into the genome. Targeted genome integration of plant transgenes allows for the sequential addition of transgenes at the same locus. This “cis-gene stacking” greatly simplifies subsequent breeding efforts, where all transgenes are inherited as a single locus. When coupled to a CRISPR / Cas9 cleavage at the target site, the transgene can integrate into this locus via homology-directed repair facilitated by side-linked sequence homology. This approach can be used to rapidly introduce new alleles without linkage redundancy, or to introduce alleles that are not naturally occurring.

[0379] Cutting enzyme

[0380] The CRISPR-Cas II system uses a Cas9 nuclease with two enzymatic cleavage domains: the RuvC domain and the HNH domain. Mutations have been shown to alter double-strand cleavage to single-strand cleavage, producing technical variants of Cas9 known as nickases or nuclease-inactivated cas9. The RuvC subdomain cleaves the non-complementary DNA strand, and the HNH subdomain cleaves the DNA strand complementary to the gRNA. Nickase-inactivated or nuclease-inactivated Cas9 retains its gRNA-guided DNA-binding ability. Mutations in the subdomains are known in the art, such as those found in Streptococcus pyogenes Cas9 nucleases with the D10A or H840A mutations.

[0381] Genome base editing or modification

[0382] A base editor has been created by fusing cytosine deaminase with a Cas9 domain (WO 2018 / 086623). By fusing the deaminase, the base editor uses a sequence guided by gRNA to target and replace the targeted cytidine (C) with uracil (U) via deamination of cytidine in DNA. The cell's mismatch repair mechanism then replaces U with T. Suitable cytidine deaminases include APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, and CDA1. Furthermore, Cas9 deaminase fusions can contain mutated Cas9 with nicking enzyme activity to generate single-strand breaks. It has been shown that nicking enzyme proteins may be more efficient in promoting homology-directed repair (Luo et al., 2016).

[0383] Vector-free genome editing or genome modification

[0384] Recently, vector-free methods using Cas9 / sgRNA ribonucleoproteins have been described as successfully reducing off-target events. These methods require in vitro expression of the Cas9 ribonucleoprotein (RNP) converted into cells, such as protoplasts. This is independent of the Cas9 coding sequence integrated into the host genome, thereby reducing unwanted non-specific cleavage that can occur when the Cas9 gene is randomly integrated into the site. Only short side-joint sequences are required to form stable Cas9 and sgRNA-stable ribonucleoproteins in vitro. Woo et al. (2015) generated pre-assembled Cas9 / sgRNA protein / RNA complexes and introduced them into protoplasts of Arabidopsis, rice, lettuce, and tobacco, observing up to 45% targeted mutagenesis frequencies in the regenerated plants. In vitro introduction of RNPs has been confirmed in several species, including dicotyledons (Woo et al., 2015) and monocotyledons such as maize (Svitashev et al., 2016) and wheat (Liang et al., 2017). Genome editing of plants using CRISPR-Cas9 in vitro transcripts or ribonucleoproteins is described in Liang et al. (2018) and Larroude et al. (2019).

[0385] Methods for gene insertion

[0386] Plant embryos can be bombarded with Cas9 and sgRNA genes targeting the integration site, along with a DNA repair template. The DNA repair template can be a synthetic DNA fragment, a 127-mer polynucleotide, or a longer polynucleotide, each encoding the gene of interest to be inserted. For example, the bombarded cells are grown on tissue culture media. DNA is extracted from callus or leaf tissue of the regenerated plant using the CTAB DNA extraction method and analyzed by PCR to confirm gene integration. T1 progeny plants can be selected from plants confirmed to contain the inserted gene of interest.

[0387] The method involves introducing a DNA sequence of interest, referred to as donor DNA and a nuclease, into a plant cell. The nuclease creates a break at a target site, allowing first and second homologous regions of the donor DNA to undergo homologous recombination with their corresponding homologous genomic regions. The cleaved genomic DNA acts as a recipient of the DNA sequence. The resulting DNA exchange between the donor and the genome leads to the integration of the polynucleotide of interest from the donor DNA into a strand break at the target site in the plant genome, thereby altering the original target site and producing a modified genomic sequence.

[0388] Donor DNA can be introduced by any means known in the art. For example, a plant with a target site can be provided. Donor DNA can be provided to the plant by known transformation methods, including Agrobacterium-mediated transformation or bioballistic particle bombardment. An RNA-guided Cas or Cpf1 endonuclease cleaves the DNA at the target site, and the donor DNA is inserted into the plant genome.

[0389] Although homologous recombination occurs at a low frequency in plant somatic cells, the introduction of double-strand breaks (DSBs) at selected endonuclease target sites appears to increase / stimulate this process.

[0390] RNA interference

[0391] RNA interference (RNAi) is particularly useful for specifically reducing gene expression, and if the gene encodes a protein, it reduces the production of that specific protein. While not wishing to be limited by theory, Waterhouse et al. (1998) have provided a model of the mechanism by which dsRNA (double-stranded RNA) can be used to reduce protein production. This technique relies on the presence of dsRNA molecules containing a sequence substantially identical to the mRNA of the gene of interest or a portion thereof. Conveniently, dsRNA can be generated by a single promoter in a recombinant vector or host cell, where sense and antisense sequences are side-mounted with unrelated sequences that allow the sense and antisense sequences to hybridize to form a dsRNA molecule, where the unrelated sequences form a loop structure. The design and generation of suitable dsRNA molecules are entirely within the capabilities of those skilled in the art, especially considering Waterhouse et al., (1998); Smith et al., (2000); WO 99 / 32619; WO 99 / 53050; WO 99 / 49029; WO 01 / 34815; WO19 / 051563 and WO20 / 024019.

[0392] In one instance, DNA is introduced that directs the synthesis of at least a portion of a double-stranded RNA product homologous to one or more of the following polypeptides as defined herein: preferably mtSSB-1 or mtSSB-1a polypeptide, TWINKLE polypeptide, or RECA3 polypeptide. Thus, the DNA includes both sense and antisense sequences that can hybridize to form a double-stranded RNA region when transcribed into RNA. In one embodiment of the invention, the sense and antisense sequences are separated by a spacer region comprising introns that are spliced ​​out when transcribed into RNA. This arrangement has been shown to result in higher gene silencing efficiency (Smith et al., 2000). The double-stranded region may comprise one or two RNA molecules transcribed from one or two DNA regions. The presence of double-stranded molecules is thought to trigger a response from an endogenous system that disrupts both the double-stranded RNA and the homologous RNA transcript from the target gene, thereby efficiently reducing or eliminating the activity of the target gene.

[0393] The lengths of the sense and antisense sequences in the hybridization should each be at least 19 consecutive nucleotides, preferably at least 30, 32, 40, or 50 consecutive nucleotides, more preferably at least 100 or 200 consecutive nucleotides. Typically, sequences of 100-1000 nucleotides corresponding to a region of the target gene mRNA are used. Full-length sequences corresponding to the entire gene transcript can be used. The degree of identity between the sense sequence and the target transcript (and therefore the antisense sequence and the complement of the target transcript) should be at least 85%, at least 90%, or 95-100%, preferably identical to the target sequence. RNA molecules may, of course, include unrelated sequences that can act as stabilizing molecules. RNA molecules can be expressed under the control of RNA polymerase II or RNA polymerase III promoters. Examples of the latter include tRNA or snRNA promoters.

[0394] Preferred small interfering RNA (“siRNA”) molecules comprise the same nucleotide sequence as the target mRNA of about 19-25 consecutive nucleotides. Preferably, the siRNA sequence begins with a dinucleotide AA, comprises about 30-70% (preferably 30-60%, more preferably 40-60%, and even more preferably about 45%-55%) of GC content, and, for example as determined by a standard BLAST search, does not have a high percentage of identity with any nucleotide sequence other than the target in the genome of the organism to which it is to be introduced.

[0395] In one embodiment, the dsRNA includes a “ledRNA” structure as described in WO2019 / 051563 and / or includes a G:U base pair as described in WO2020 / 024019.

[0396] The DsRNA useful in this invention can be easily generated using conventional procedures.

[0397] microRNA

[0398] MicroRNAs (miRNAs) are non-coding RNA molecules, typically 19–25 nucleotides long (usually about 20–24 nucleotides in plants), derived from larger precursors that form imperfect stem-loop structures. miRNAs are usually perfectly complementary to the regions of the target mRNA whose expression is to be reduced, but perfect complementarity is not required.

[0399] miRNAs bind to complementary sequences in target messenger RNA transcripts (mRNAs), which typically leads to translational repression or target degradation and gene silencing. It is well known in the art that artificial miRNAs (amiRNAs) can be designed based on natural miRNAs to reduce the expression of any gene of interest.

[0400] In plant cells, miRNA precursor molecules are thought to be processed primarily in the nucleus. pri-miRNA (containing one or more partially double-stranded or "hairpin" regions, along with the usual 5' "cap" and polyadenylated tail of mRNA) is processed into shorter miRNA precursor molecules that also contain stem loops or folded structures, and these are called "premiRNAs." In plants, premiRNAs are cleaved by various DICER-like (DCL) enzymes, yielding miRNA:miRNA. * Double strands. These double strands are methylated before being transported out of the cell nucleus.

[0401] In the cytoplasm, miRNA strands from the miRNA:miRNA duplex selectively incorporate into the active RNA-induced silencing complex (RISC) for target recognition. The RISC complex contains specific subsets of Argonaute proteins that exert sequence-specific gene repression (see, for example, Millar and Waterhouse, 2005; Pasquinelli et al., 2005; Almeida and Allshire, 2005).

[0402] The microRNAs useful in this invention can be readily generated using conventional procedures. For example, the design of OsmtSSB-1a amiRNA (artificial microRNA) constructs can be based on the general method described by Fahim et al., (2012). The WMD3 software (www.wmd3.weigelworld.org / ) can be used to identify suitable amiRNA targets in the OsmtSSB-1a gene. amiRNA targets were selected according to four criteria: 1) relative 5' instability using sequences rich in AT at the 5' end and rich in GC at the 3' end; 2) U at location 1 and A at the cleavage site (between locations 10 and 11); 3) a maximum of 1 and 4 mismatches at locations 1 to 9 and 13 to 21, respectively; and 4) a predicted free energy (ΔG) less than -30 kcal / mol when the amiRNA hybridizes with the target RNA. -1 (Ossowski et al., 2008). For gene-specific expression reduction, candidate amiRNA sequences are selected from regions showing the lowest homology when aligning all OsOsmtSSB-1a homologs, thus reducing the likelihood of off-target expression reduction in OsmtSSB-1a homologs and some homologs. Rice miR395 precursors (Guddeti et al., 2005; Jones Rhoades and Bartel, 2004; Kawashima et al., 2009) can be selected as the amiRNA backbone for insertion into amiRNA sequences. For example, five endogenous miRNA targets in miR395 were used to replace five amiRNA targets knocked out by mtSSB, TWINKLE, or RECA3 for construct design and fabrication.

[0403] Co-inhibition

[0404] Genes can suppress the expression of related endogenous genes and / or transgenes that already exist in the genome; this phenomenon is called homology dependence.

[0405] Gene silencing. Most cases of homology-dependent gene silencing fall into two categories—one operates at the transgene transcriptional level, and the other operates post-transcriptionally.

[0406] Posttranscriptional homology-dependent gene silencing (i.e., co-suppression) describes the loss of expression of transgenic and associated endogenous or viral genes in transgenic plants. Co-suppression typically, but not always, occurs in conditions of abundant transgenic transcripts and is generally thought to be triggered at the level of mRNA treatment, localization, and / or degradation. Several models exist to explain how co-suppression works (see Taylor, 1997).

[0407] Co-repression involves introducing an additional copy of a gene or a fragment thereof into a plant in a meaningful orientation relative to its expression promoter. The size of the meaningful fragment, its correspondence to the target gene region, and its degree of sequence identity with the target gene can be determined by those skilled in the art. In some cases, the additional copy of the gene sequence interferes with the expression of the target plant gene. For methods used to implement co-repression, refer to WO 97 / 20936 and EP 0465572.

[0408] antisense polynucleotides

[0409] The term "antisense polynucleotide" should be understood as complementary to at least a portion of a specific mRNA molecule encoding an endogenous polypeptide and capable of interfering with post-transcriptional events, such as the translation of mRNA into DNA or RNA molecules. The use of antisense methods is well-known in the art (see, for example, G. Hartmann and S. Endres, *Manual of Antisense Methodology*, Kluwer (1999)). Bourque (1995) and Senior (1998) reviewed the use of antisense techniques in plants. Bourque (1995) listed numerous examples of how antisense sequences are used as gene inactivation methods in plant systems. Bourque also noted that achieving 100% inhibition of any enzyme activity may not be necessary, as partial inhibition is likely to result in measurable changes in the system. Senior (1998) stated that antisense methods are now recognized as a technique for manipulating gene expression.

[0410] In one embodiment, the antisense polynucleotide hybridizes under physiological conditions, i.e., the antisense polynucleotide (which is a complete or partial single strand) is at least able to form a double-stranded polynucleotide with mRNA encoding endogenous mtSSB, TWINKLE, or RECA3 polypeptides in cells under normal conditions.

[0411] Antisense molecules can contain sequences corresponding to structural genes or sequences that control gene expression or splicing events. For example, an antisense sequence can correspond to a target coding region of an endogenous gene, or a 5'-untranslated region (UTR), or a 3'-UTR, or a combination thereof. It can be partially complementary to an intron sequence that can be spliced ​​during or after transcription, preferably only to the exon sequence of the target gene. Given that UTRs are typically more variable, targeting these regions provides greater gene repression specificity.

[0412] The antisense sequence should be at least 19 consecutive nucleotides in length, preferably at least 30 or at least 50 nucleotides, and more preferably at least 100, 200, 500, or 1000 nucleotides. A full-length sequence complementary to the entire gene transcript can be used. The length is most preferably 100-2000 nucleotides. The antisense sequence should have at least 90% identity with the target transcript, more preferably 95-100%, and typically 100%. Antisense RNA molecules may, of course, include unrelated sequences that can act as stabilizing agents.

[0413] Nucleic acid constructs

[0414] The present invention comprises nucleic acid constructs including the polynucleotides of the present invention or polynucleotides useful to the present invention, as well as vectors and host cells containing such polynucleotides, methods of their production and use, and their applications.

[0415] This invention relates to operably connected or linked elements. "Operably connected" or "operably linked" refers to the connection of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are contiguous, and in cases where two protein-coding regions need to be linked, they are contiguous and located within the reading frame. When RNA polymerase transcribes two coding sequences into a single RNA, the coding sequence is "operably connected" to another coding sequence, and if said single RNA is translated, it is translated into a single polypeptide having amino acids derived from the two coding sequences. The coding sequences do not need to be contiguous, as long as the expressed sequence is ultimately processed to produce the desired protein.

[0416] As used herein, the terms “cis-acting sequence,” “cis-acting element,” “cis-regulatory region,” or “regulatory region,” or similar terms, should be understood as any nucleotide sequence that, when properly positioned and connected relative to an expressible genetic sequence, is capable of at least partially regulating the expression of that genetic sequence. Those skilled in the art will recognize that cis-regulatory regions can be activated, silenced, enhanced, repressed, or otherwise altered at the transcriptional or post-transcriptional levels to determine the expression level of a gene sequence and / or cell type specificity and / or developmental specificity. In a preferred embodiment of the invention, the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.

[0417] "Operationally linking" a promoter or enhancer element to a transcribed polynucleotide means placing the transcribed polynucleotide (e.g., a protein-coding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription of the polynucleotide. In the construction of heterologous promoter / structural gene combinations, it is generally preferred to position the promoter or a variant thereof at a distance from the transcription start site of the transcribed polynucleotide, a distance approximately equal to the distance between the promoter and the protein-coding region it controls in its natural environment; i.e., the gene that derives the promoter. As is known in the art, some variations of this distance can be adapted without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, enhancer, etc.) relative to the transcribed polynucleotide to which it is to be placed is defined by the element's positioning in its natural environment; i.e., the gene that derives the element.

[0418] As used herein, a “promoter” or “promoter sequence” refers to a region of a gene, typically located upstream (5') of the RNA coding region, that controls the initiation and level of transcription in the cell of interest. A “promoter” contains transcriptional regulatory sequences of classic genomic genes, such as TATA-box and CCAAT-box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers, and silencers) that can alter gene expression in response to developmental and / or environmental stimuli or in a tissue-specific or cell-type-specific manner. Promoters are typically, but not necessarily (e.g., some PolIII promoters) located upstream of structural genes that regulate the expression of said structural genes. Furthermore, regulatory elements including promoters are typically located within 2 kb of the transcription start site. Promoters may contain additional, more distal, specific regulatory elements located at the start site to further enhance expression in the cell and / or alter the timing or inducibility of expression of structural genes operatively linked to them.

[0419] A “constitutive promoter” is a promoter that directs the expression of an operablely linked transcriptional sequence in many or all tissues of an organism, such as a plant. As used herein, the term constitutive does not necessarily indicate that a gene is expressed at the same level in all cell types, but rather that the gene is expressed in multiple cell types, although some variations in level are often detectable. As used herein, “selective expression” refers to expression almost entirely in a specific organ of a plant, such as the endosperm, embryo, leaf, fruit, tuber, or root. In a preferred embodiment, the promoter is selectively or preferentially expressed in the grains of cereal plants, such as rice. Thus, selective expression can be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all of the conditions experienced by the plant.

[0420] Selective expression can also lead to compartmentalization of gene expression products in specific plant tissues, organs, or developmental stages. Compartmentation in specific subcellular locations, such as plastids, cytosols, vacuoles, or apoplasts, can be achieved by including appropriate signals, such as signal peptides, in the structure of the gene product to transport it to the desired cellular compartment, or, in the case of semi-autonomous organelles (plastids and mitochondria), by directly integrating transgenes with appropriate regulatory sequences into the organelle genome.

[0421] A "tissue-specific promoter" or "organ-specific promoter" is a promoter that is preferentially expressed in one tissue or organ, preferably in most (if not all) other tissues or organs, such as in plants. Typically, the expression level of the promoter in a particular tissue or organ is 10 times that in other tissues or organs.

[0422] Seed-specific promoters used in this invention are suitable and comprise promoters that result in seed-specific expression in cereals well known in the art. Suitable promoters of note are barley LPT2 or LPT1 gene promoters (WO 95 / 15389 and WO 95 / 23230) or promoters described in WO 99 / 16890 (promoters from the barley gliadin gene). Other promoters include those described in Broun et al., (1998); Potenza et al., (2004); US20070192902 and US20030159173. In one embodiment, the seed-specific promoter is preferentially expressed in a defined portion of the seed, such as the endosperm, preferably in the developing aleurone. In another embodiment, the seed-specific promoter is not expressed after seed germination, or is expressed only at low levels.

[0423] In one embodiment, the promoter is active at least between the flowering time and 30 days after flowering, or is fully active during this period. Examples of such promoters are the OsmtSSB-1a gene promoter, the TWINKLE promoter, the RECA3 promoter, or the TA2 promoter (WO 2017 / 083920).

[0424] The promoters contemplated in this invention may be natural for the host plant to be transformed or may be derived from alternative sources, wherein the region is functional in the host plant. Many promoters that are functional in monocotyledonous plants are well known in the art. Non-limiting methods for evaluating promoter activity are disclosed in Medberry et al., (1992 and 1993); Sambrook et al., (1989, ibid.); and US 5,164,316.

[0425] Alternatively or additionally, the promoter may be an inducible promoter or a developmentally regulatory promoter capable of driving the expression of the introduced polynucleotide at the appropriate developmental stage in cereal plants. Other cis-acting sequences that may be employed include transcriptional and / or translational enhancers. Enhancer regions are well known to those skilled in the art and may contain an ATG translation start codon and adjacent sequences. When included, the start codon should be in phase with the reading frame of the coding sequence associated with the foreign or exogenous polynucleotide to ensure translation of the entire sequence (if to be translated). The translation initiation region may be provided by the source of the transcription start region or by the foreign or exogenous polynucleotide. The sequence may also be derived from the source of the promoter selected to drive transcription and may be specifically modified to enhance mRNA translation.

[0426] The nucleic acid constructs of the present invention may include a 3' untranslated sequence of about 50 to 1,000 nucleotide base pairs, which may contain a transcription termination sequence. The 3' untranslated sequence may contain a transcription termination signal, which may or may not contain a polyadenylation signal and any other regulatory signals capable of influencing mRNA processing. The role of the polyadenylation signal is to add a polyadenylate bundle to the 3' end of the mRNA precursor. Although variations are not uncommon, the polyadenylation signal is generally identified by the presence of homology with the typical form 5'AATAAA-3'. Examples of suitable 3' untranslated sequences are 3' transcriptional untranslated regions containing polyadenylation signals from the octopine synthase (ocs) or nopaline synthase (nos) genes of *Agrobacterium tumefaciens* (Bevan et al., 1983). Suitable 3' untranslated sequences can also be derived from plant genes, such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those skilled in the art can also be used.

[0427] Because the DNA sequence inserted between the transcription start site and the coding sequence start point—the untranslated 5' leader sequence (5'UTR)—can affect gene expression if translated and transcribed, specific leader sequences can also be used. Suitable leader sequences include those that include sequences selected to guide optimal expression of exogenous or endogenous DNA sequences. For example, such leader sequences contain preferred concordant sequences that can increase or maintain mRNA stability and prevent inappropriate translation initiation, as described, for example, by Joshi (1987).

[0428] carrier

[0429] This invention includes the use of vectors for manipulating or transferring genetic constructs. "Chimeric vector" refers to a nucleic acid molecule, preferably derived from a DNA molecule such as a plasmid or plant virus, into which a nucleic acid sequence can be inserted or cloned. The vector is preferably double-stranded DNA and contains one or more unique restriction sites, and is capable of autonomous replication in a defined host cell containing a target cell or tissue or its progenitor cell or tissue, or of integrating into the genome of a defined host such that the cloned sequence is reproducible. Thus, the vector can be a self-replicating vector, i.e., a vector existing as an extrachromosomal entity whose replication is independent of chromosome replication, such as linear or closed circular plasmids, extrachromosomal elements, microchromosomes, or artificial chromosomes. The vector can contain any means to ensure self-replication. Alternatively, the vector can be a vector that, when introduced into a cell, is integrated into the genome of the recipient cell and replicates along with the chromosome integrated therein. A vector system can include a single vector or plasmid or two or more vectors or plasmids containing total DNA from the genome or transposons to be introduced into the host cell. The choice of vector will generally depend on the compatibility of the vector with the cell to which it will be introduced. The vector may also contain selection markers, such as antibiotic resistance genes, herbicide resistance genes, or other genes that can be used to select suitable transformants. Examples of such genes are well known to those skilled in the art.

[0430] The nucleic acid constructs of this invention can be introduced into vectors, such as plasmids. Plasmid vectors typically contain additional nucleic acid sequences that provide an expression cassette for easy selection, amplification, and transformation in prokaryotic and eukaryotic cells, such as pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. The additional nucleic acid sequences include a replication origin for providing autonomous vector replication, preferably an optional marker gene encoding antibiotic or herbicide resistance, a unique multiple cloning site providing multiple sites for insertion into the nucleic acid construct encoding a nucleic acid sequence or gene, and sequences that enhance prokaryotic and eukaryotic (especially plant) cell transformation.

[0431] A "marker gene" is a gene that confers a different phenotype to cells expressing a marker gene and thus allows such transformed cells to be distinguished from unmarked cells. A selectable marker gene confers a trait that can be "selected" based on resistance to a selector (e.g., herbicides, antibiotics, radiation, heat, or other treatments that damage untransformed cells). A selectable marker gene (or reporter gene) confers a trait that can be identified by observation or testing, i.e., by "screening" (e.g., β-glucuronidase, luciferase, GFP, or other enzyme activities not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not necessarily need to be linked.

[0432] To facilitate the identification of transformants, nucleic acid constructs preferably include selectable or screenable marker genes as foreign or exogenous polynucleotides, or in addition to these. The actual choice of marker is not critical, as long as the marker is functional (i.e., selective) when combined with the selected plant cells. The marker gene and the foreign or exogenous polynucleotide of interest need not be linked, as co-transformation of unlinked genes, as described, for example, in US 4,399,216, is also an efficient process in plant transformation.

[0433] Examples of bacterial selectable markers are markers that confer resistance to antibiotics such as ampicillin, erythromycin, chloramphenicol, or tetracycline, preferably kanamycin resistance. Exemplary selectable markers for selecting plant transformants include, but are not limited to, hyg genes encoding hygromycin B resistance; neomycin phosphotransferase (nptII) genes conferring resistance to kanamycin, paromomycin, or G418; glutathione-S-transferase genes from rat liver conferring resistance to glutathione-derived herbicides, as described, for example, in EP 256223; glutamine synthase genes that, when overexpressed, confer resistance to glutamine synthase inhibitors such as glufosinate, as described, for example, in WO 87 / 05327; and acetyltransferase genes from *Streptomyces viridochromogenes* conferring resistance to the selective agent glufosinate, as described, for example in EP 256223. The gene encodes 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) that confers resistance to N-phosphonomethylglycine, as described, for example, by Hinchee et al. (1988); bar genes that confer resistance to bisammonium phosphate, as described, for example, by WO91 / 02071; nitrile hydrolase genes that confer resistance to bromosulfanilamide, such as bxn from Klebsiella ozaenae (Stalker et al., 1988); dihydrofolate reductase (DHFR) genes that confer resistance to methotrexate (Thillet et al., 1988); and mutant acetolactate synthase (ALS) genes that confer resistance to imidazolinones, sulfonylureas, or other ALS-inhibiting chemicals (EP). 154,204); mutated anthranilic acid synthase genes conferring resistance to 5-methyltryptophan; or dalapon dehalogenase genes conferring resistance to herbicides.

[0434] Preferred screenable markers include, but are not limited to, the uidA gene encoding a variety of chromogenic substrates known to be β-glucuronidase (GUS); a β-galactosidase gene encoding an enzyme known to be chromogenic substrates; the pine pine protein gene (Prasher et al., 1985), which can be used for calcium-sensitive bioluminescent detection; green fluorescent protein (Niedz et al., 1995) or derivatives thereof; luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescent detection; and other genes known in the art. As used herein, a “reporter molecule” means a molecule that provides an analytically identifiable signal by its chemical properties, which helps to determine promoter activity by reference to a protein product.

[0435] Preferably, the nucleic acid construct is stably incorporated into the genome of, for example, the plant or cell of the present invention. Thus, the nucleic acid includes suitable elements that allow the molecule to be incorporated into the genome, or the construct is placed in a suitable vector that can be incorporated into the chromosome of a plant cell.

[0436] One embodiment of the invention includes a recombinant vector comprising at least one polynucleotide molecule of the invention, inserted into any vector capable of delivering nucleic acid molecules into host cells. Such a vector contains a heterologous nucleic acid sequence, i.e., a non-naturally occurring nucleic acid sequence adjacent to the nucleic acid molecule of the invention, and preferably derived from a species different from the species from which the nucleic acid molecule is derived. The vector can be RNA or DNA, prokaryotic or eukaryotic, and is typically a virus or plasmid.

[0437] Many vectors suitable for stable transfection of plant cells or for establishing transgenic plants have been described in, for example, Pouwels et al., *Cloning Vectors: A Laboratory Manual*, 1985, Supplement 1987; Weissbach and Weissbach, *Methods for Plant Molecular Biology*, Academic Publishers, 1989; and Gelvin et al., *Plant Molecular Biology Manual*, Kluwer Academic Publishers, 1990. Typically, plant expression vectors contain one or more cloned plant genes and dominant selectable markers, for example, under transcriptional control via 5' and 3' regulatory sequences. Such plant expression vectors may also contain promoter regulatory regions (e.g., regulatory regions controlling inducible or constitutive, environmental or developmental, or cell or tissue-specific expression), transcription initiation sites, ribosome binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation signals.

[0438] The levels of mtSSB, TWINKLE, or RECA3 peptides can be modulated by reducing the expression levels of genes encoding proteins in cereals, leading to increased aleurone thickness. Gene expression levels can be modulated by altering the copy number per cell, for example, by introducing a synthetic genetic construct comprising the coding sequence and a transcriptional control element operatively linked to it and functional in the cell. Multiple transformants can be selected and screened for those exhibiting favorable levels and / or specificities of transgene expression induced by the influence of endogenous sequences near the transgene integration site. Favorable levels and patterns of transgene expression result in increased aleurone thickness. Alternatively, mutagenized seed or plant populations from a breeding program can be used to screen for individual lines exhibiting increased aleurone thickness.

[0439] Recombinant cells

[0440] Another embodiment of the invention comprises recombinant cells containing mutated endogenous genes, such as genes modified by gene editing, or host cells, or their progeny cells, transformed with one or more recombinant molecules of the present invention. Various types of mutagenesis involving gene editing are described above and can be used to generate recombinant cells. Transformation of nucleic acid molecules into cells can be accomplished by any method of inserting nucleic acid molecules into cells. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipid transfection, adsorption, and protoplast fusion. Recombinant cells can remain single cells or can grow into tissues, organs, or multicellular organisms, such as transgenic plants. The transformed nucleic acid molecules of the present invention can remain extrachromosomally or can be integrated into one or more sites within the chromosome of the transformed cell in a manner that preserves their expressive ability. Preferred host cells are plant cells, more preferably cereal grain cells.

[0441] Plants with genetic variation

[0442] As used herein, the term “plant” as a noun refers to the whole plant and any member of the plant kingdom, but as an adjective refers to any substance present in, obtained from, derived from, or associated with a plant, such as plant organs (e.g., leaves, stems, roots, flowers), single cells (e.g., pollen), seeds, plant cells, etc. Small plantlets that have taken root and sprouted, and germinating seeds, are also included in the meaning of “plant.” As used herein, the term “plant part” refers to one or more plant tissues or organs obtained from a plant and comprising the plant’s genomic DNA. Plant parts include vegetative structures (e.g., leaves, stems), roots, floral organs / structures, seeds (including embryos, cotyledons, and seed coats), plant tissues (e.g., vascular tissues, terrestrial tissues, etc.), cells, and their progeny. As used herein, the term “plant cell” refers to a cell obtained from or within a plant and includes protoplasts or other cells derived from the plant, gamete-producing cells, and cells that regenerate the whole plant. Plant cells can be cells in culture, i.e., cells in vitro. "Plant tissue" means differentiated tissue in or derived from a plant ("explant"), or aggregates of plant cells in various forms, including immature or mature embryos, seeds, roots, buds, fruits, tubers, pollen, and in culture, such as undifferentiated tissue derived from callus. Exemplary plant tissues in or derived from seeds are cotyledons, embryos and hypocotyls, or scutellaria, endosperm, or aleurone. Therefore, the present invention includes plants and plant parts, as well as products comprising these.

[0443] The terms “grain” and “seed” are used interchangeably herein. “Grain” can refer to a mature grain in a plant, a developing seed in a plant, a harvested grain, or a processed grain, such as milled or refined, wherein most of the grain remains intact, or, depending on the context, after absorption or germination. Mature grains typically have a moisture content of less than about 18% to 20% by weight, and usually about 8% to 12% by weight. In one embodiment, the developing grain of the present invention is at least about 10 days after direct pollination (DAP). In one embodiment, the developing seed of the present invention is a seed between the time of pollination and 30 days after pollination, which may be included in the plant or removed.

[0444] As used herein, a “transgenic plant” means a plant having one or more genetic variations as defined herein, containing one or more exogenous polynucleotides not present in wild-type plants of the same species, variety, or cultivar. That is, a transgenic plant (a transformed plant) contains genetic material (transgenic material) that it did not possess prior to transformation. Transgenic material can contain genetic sequences or synthetic sequences obtained or derived from plant cells, other plant cells, or non-plant sources. Typically, transgenic material is introduced into plants through human manipulation, such as by transformation, but those skilled in the art recognize that any method can be used. Transgenic material is preferably stably integrated into the plant’s nuclear genome. Transgenic material can include sequences naturally present in the same species but arranged in rearranged order or with different elements, such as antisense sequences. Plants containing such sequences are included herein in the term “transgenic plant.”

[0445] "Non-GMO plants" refer to plants that have not yet undergone gene modification by introducing genetic material through recombinant DNA technology.

[0446] As used herein, “wild type” means a cell, polypeptide, gene, tissue, grain, or plant that has not been modified according to the present invention. Wild type cells, tissues, or plants can be used as controls to compare the expression levels of endogenous genes, the amount of the polypeptides of the present invention or other polypeptides, the degree and nature of exogenous nucleic acids or trait modifications, specifically the phenotype of aleurone thickness, with modified cells, tissues, grains, or plants as described herein.

[0447] As used herein, the term "corresponding wild-type" cereal plant or grain, or similar phrase, refers to a cereal plant or grain that comprises at least 75%, more preferably at least 95%, more preferably at least 97%, more preferably at least 99%, and even more preferably 99.5% of the genotype of the cereal plant or grain of the present invention, but excludes genetic variations (such as introduced mutations) and / or thickened aleurone that reduce the activity of polypeptides in the plant or grain. In a preferred embodiment, the cereal grain or plant of the present invention is isogenetic relative to the wild-type cereal grain or plant, except for the aforementioned one or more genetic variations (such as introduced mutations). Preferably, the corresponding wild-type plant or grain belongs to / originates from the same variety or variant as the progenitor cell of the plant / grain of the present invention, or is a sibling plant line lacking one or more genetic modifications and / or without thickened aleurone, commonly referred to as an "isosome". In one embodiment, the genotype of the rice plant or grain of the present invention is less than 50% identical to the genotype of the wild-type rice variety Zhonghua 11 (ZH11). ZH11 has been commercially available since 1986.

[0448] As defined in the context of this invention, a transgenic plant comprises offspring of a cereal plant that has been genetically modified according to the invention, wherein the offspring include genetic variations, such as mutations or the transgene of interest. Such offspring can be obtained by self-fertilization of a primary transgenic plant or by crossing such a plant with another cereal plant. This is typically to regulate the production of at least one protein, as defined herein, in the desired plant or its grains. A transgenic plant portion comprises all parts and cells of the plant, including the transgene, such as cultured tissues, callus tissues, and protoplasts, preferably grains.

[0449] As used herein, “cereals” refers to any plant of the Poaceae family, commonly known as grasses, cultivated because of the edible components of their cereal grains. Thus, cereals are a family of monocotyledonous flowering plants. Examples of cereal plants / grains of the present invention include, but are not limited to, rice, wheat, barley, rye, corn, sorghum, oats, and triticale.

[0450] As used herein, the term "rice" refers to any plant or part thereof of the genus *Oryza* cultivated for the edible components of its grains, including strains, varieties, or cultivars of the plant. Preferably, the rice plant belongs to the species *Oryza*.

[0451] As used in this article, "brown rice" refers to the whole grain of rice, including the bran and germ, but excluding the husk that is usually removed during harvesting. That is, brown rice has not been refined to remove the aleurone and germ. "Rough" refers to the presence of brown or yellowish-brown pigment in the bran. Brown rice is considered a whole grain. As used in this article, "white rice" (milled rice) refers to rice grains with the bran and germ removed, essentially the remaining starch endosperm of the whole rice grain. Both types of rice grains can be short, medium, or long grains. Compared to white rice, brown rice has higher protein, mineral, and vitamin content, and its protein content is higher in lysine.

[0452] As used herein, the term "wheat" refers to any plant or part of the genus *Wheat* cultivated for the edible components of its grains, including strains, varieties, or cultivars of the plant, including its ancestors, and its offspring produced through hybridization with other species. Wheat includes the genome organization AABBDD, containing 42 chromosomes, known as "hexaploid wheat," and the genome organization AABB, containing 28 chromosomes, known as "tetraploid wheat." Hexaploid wheat includes common wheat (*T. aestivum*), *T. spelta*, *T. macha*, *T. compactum*, *T. sphaerococcum*, *T. vavilovii*, and their interspecific hybrids. The preferred species of hexaploid wheat is common wheat (also known as "bread wheat"). Tetraploid wheat includes durum wheat (T. durum) (also referred to herein as durum wheat or durum wheat subspecies (Triticum turgidum ssp. durum), wild emmer wheat (T. dicoccoides), emmer wheat (T. dicoccum), Polish wheat (T. polonicum), and their interspecific hybrids. Additionally, the term "wheat" includes potential ancestors of hexaploid or tetraploid wheat, such as *T. uartu*, *T. monoococcum*, or wild emmer wheat (T. boeoticum) of genome A; *Aegilops speltoides* of genome B; and *T. tauschii* (also referred to herein as rough goatgrass (Aegilops squarrosa) or jointed goatgrass (Aegilops tauschii) of genome D. The particularly preferred ancestor is the ancestor of genome A, and even more preferably, the ancestor of genome A is a grain of wheat. The wheat variety used in this invention may belong to, but is not limited to, any of the species listed above. It also covers plants produced by sexual hybridization of wheat as a parent with non-wheat species (such as rye [secalecereale]) using conventional techniques, including but not limited to triticale.

[0453] As used herein, the term "barley" refers to any plant or part of the genus *Haloxylon* cultivated for the edible components of its grains, including strains, varieties, or cultivars of the plant, including its ancestors, and its offspring produced through hybridization with other species. Preferably, the plant belongs to the genus *Haloxylon*.

[0454] As used herein, “pigment” refers to grains that include atypical colors. Examples include black rice, red rice, red wheat, purple rice, purple barley, and purple corn. Black rice and red rice, each of which contains pigments in their aleurone layer, specifically anthocyanins and anthocyanin glycosides. Pigmented rice has a higher riboflavin content than non-pigmented rice, but a similar thiamine content. Due to the concentration of anthocyanins, the bran layer of “black rice” is black or almost black and may turn dark purple when cooked. “Purple rice” (also known as “forbidden rice”) is a short-grain variant of black rice and is included in black rice as defined herein. It is purple in its uncooked state and turns dark purple when cooked. “Red rice” contains various anthocyanins that give the bran a red / brownish-red color, including anthocyanin-3-glucoside (chrysanthemin) and peonidin-3-glucoside.

[0455] Each of these types of cereal grains can be treated to prevent germination, for example by cooking (boiling) or dry heating (baking). For example, brown rice and colored rice are typically cooked for 10–40 minutes, depending on the desired texture, while white rice is typically cooked for 12–18 minutes. Cooking or heating reduces the levels of antinutritional factors in the grain, such as trypsin inhibitors, oryzacystatin, and hemagglutinins, by denaturing these proteins rather than the phytate content. As is known in the art, cereal grains can also be soaked in water before cooking or slow-cooked for a longer period. Cereal grains can also be broken, partially cooked, or heat-stable. Each of these forms of cereal grains falls under the category of processed grains that cannot germinate and cannot be used to produce viable plants. Bran can be steam-treated to stabilize it, for example, at 100°C for about 6 minutes.

[0456] In one embodiment, the grains of the present invention have delayed grain maturation compared to corresponding wild-type cereal grains. The seed set rate (%) of the plants of the present invention can be reduced relative to wild-type plants, which requires calculating the percentage of florets filled with seeds in the mature grain stage of the plant.

[0457] In one embodiment, the germination ability of the grains of the present invention is reduced compared to corresponding wild-type cereal grains. For example, when cultured in a growth chamber at 28°C under a 12-hour light / 12-hour dark cycle without humidity control, the germination ability of the cereal grains is approximately 50% of that of the corresponding wild-type cereal grains. As used herein, the term "germination" refers to the point at which the radicle clearly emerges through the seed coat.

[0458] In one embodiment, the plant of the present invention, relative to a wild-type parental variety, has one or more of the following: normal plant height, reproductive capacity (male and female), seed length, seed width, and seed thickness, such as an isogenetic plant including the OsmtSSB-1a polypeptide having the amino acid sequence provided in SEQ ID NO:3. In one embodiment, the grain of the present invention, relative to a wild-type parental variety, is capable of producing cereal plants having one or more of the following: normal plant height, reproductive capacity (male and female), seed length, seed width, and seed thickness. As used herein, the term "normal" can be determined by measuring the same trait in a wild-type parental variety grown under the same conditions as the plant of the present invention. In one embodiment, for a plant to be considered normal, the plant of the present invention has a level / quantity of the defined characteristics, such as + / - 20%, more preferably + / - 10%, more preferably + / - 5%, or even more preferably + / - 2.5%, compared to a wild-type parental variety.

[0459] As defined in the context of this invention, a transgenic plant comprises a plant (and parts and cells of said plant) and its progeny that has been genetically modified using recombinant technology to produce at least one polypeptide of the present invention in a desired plant or plant organ. Transgenic plants can be produced using techniques known in the art, such as those commonly described in A. Slater et al., *Plant Biotechnology - The Genetic Manipulation of Plants*, Oxford University Press (2003) and P. Christou and H. Klee, *Handbook of Plant Biotechnology*, John Wiley and Sons (2004).

[0460] In a preferred embodiment, the plants of the present invention are homozygous for each and every introduced genetic variation, gene, or nucleic acid construct (transgenic) or mutation, such that their offspring do not segregate for the desired phenotype. Transgenic plants may also be heterozygous for the introduced genetic variation, gene, or nucleic acid construct, for example, in the F1 offspring grown from hybrid seeds. Such plants can provide advantages well-known in the art, such as hybrid viability.

[0461] In one embodiment, the method for selecting plants according to the invention further includes analyzing at least one “other genetic marker” in a DNA sample from the plant. As used herein, “other genetic marker” can be any molecule linked to a desired trait of the plant. Such markers are well known to those skilled in the art and comprise molecular markers linked to genes that define traits such as disease resistance, yield, plant morphology, grain weight, dormancy, grain color, gibberellic acid content in seeds, plant height, and powder color. An example of such genes is the Rht gene, which determines semi-dwarfing growth habits and thus lodging resistance.

[0462] Four common methods for delivering genes directly into cells have been described: (1) chemical methods (Graham et al., 1973); (2) physical methods, such as microinjection (Capecchi, 1980); electroporation (see, for example, WO 87 / 06614; US 5,472,869, 5,384,253; WO 92 / 09696 and WO 93 / 21335); and gene guns (see, for example, US 4,945,050 and US 5,141,131); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988); and (4) receptor-mediated mechanisms (Curiel et al., 1992; Wagner et al., 1992).

[0463] Acceleration methods that can be used include, for example, micro-bombardment. One example of a method for delivering transformed nucleic acid molecules into plant cells is micro-bombardment. This method has been reviewed in Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microparticles) can be coated with nucleic acids and delivered into cells by propulsion. Exemplary particles include those containing tungsten, gold, platinum, etc. In addition to being an efficient method for reproducibly transforming monocotyledonous plants, a particular advantage of micro-bombardment is that it eliminates the need for protoplast isolation and susceptibility to Agrobacterium infection. A suitable particle delivery system for this invention is the helium-accelerated PDS-1000 / He gun, available from Bio-Rad Laboratories. For bombardment, immature embryos or derived target cells, such as shield leaves or callus tissue from immature embryos, can be arranged on a solid culture medium.

[0464] In another alternative embodiment, plastids can be stably transformed. The disclosed methods for plastid transformation in higher plants comprise particle gun delivery of DNA containing selectively labeled DNA and targeting the DNA to the plastid genome via homologous recombination (US 5,451,513; US 5,545,818; US 5,877,402; US 5,932479 and WO 99 / 05265).

[0465] Agrobacterium-mediated transfer is a widely used system for introducing genes into plant cells because DNA can be introduced throughout the plant tissue, thereby bypassing the need for regeneration of a complete plant from protoplasts. The use of Agrobacterium-mediated plant integration vectors to introduce DNA into plant cells is well-known in the art (see, for example, US 5,177,010; US 5,104,310; US 5,004,863; US 5,159,135). Furthermore, T-DNA integration is a relatively precise process resulting in minimal rearrangements. The DNA region to be transferred is defined by a boundary sequence, and the intercalated DNA is typically inserted into the plant genome.

[0466] Transgenic plants created using Agrobacterium-mediated transformation typically contain a single genetic locus on a chromosome. Such transgenic plants targeting the added gene can be termed hemizygous. More preferably, transgenic plants are homozygous for the added structural gene; that is, transgenic plants containing two added genes, one gene located at the same locus on each chromosome of a chromosome pair. Homozygous transgenic plants can be obtained by sexually mating (self-pollinating) independent isolates of transgenic plants containing a single added gene, germinating some of the resulting seeds, and analyzing the gene of interest in the resulting plants.

[0467] Other cell transformation methods can also be used, including, but not limited to, introducing DNA into plants by: directly transferring DNA into pollen, injecting DNA into the reproductive organs of plants, or directly injecting DNA into the cells of immature embryos, followed by rehydration of the dried embryos.

[0468] The regeneration, development, and culture of plants from single plant protoplasts or from various transformed explants is well-known in the field (Weissbach et al., Methods for Plant Molecular Biology, San Diego Academic Press, (1988)). This regeneration and growth process typically involves selecting transformed cells and culturing these individualized cells through the typical stages of embryonic development to the rooted plantlet stage. Transgenic embryos and seeds are regenerated similarly. The resulting transgenic rooted shoots are then planted in a suitable plant growth medium, such as soil.

[0469] The development or regeneration of plants containing foreign or exogenous genes is well known in the art. Preferably, the regenerated plant is self-pollinated to provide a homozygous transgenic plant. Otherwise, pollen obtained from the regenerated plant is hybridized into seed plants of agronomically important lines. Conversely, pollen from these important lines is used to pollinate the regenerated plant. The transgenic plants containing the desired exogenous nucleic acids of the present invention are cultured using methods well known to those skilled in the art.

[0470] To confirm the presence of transgenic cells and plants, polymerase chain reaction (PCR) amplification or Southern blotting analysis can be performed using methods known to those skilled in the art. The expression products of the transgenic organism can be detected in any of a variety of ways depending on the nature of the product, including Western blotting and enzyme assays. A particularly useful method for quantifying protein expression and detecting replication in different plant tissues is the use of reporter genes, such as GUS. Once transgenic plants have been obtained, they can be grown to produce plant tissues or parts with the desired phenotype. Plant tissues or parts can be collected and / or seeds can be harvested. Seeds can be used as a source of additional plants for growing tissues or parts with the desired characteristics.

[0471] Marker-assisted selection

[0472] Marker-assisted selection is a recognized method for selecting heterozygous plants, which are needed in classical breeding programs when backcrossing with recurrent parents. The plant population in each backcross generation will be heterozygous for the gene of interest, which typically exists in a 1:1 ratio within the backcross population, and molecular markers can be used to distinguish the two alleles of the gene. Plants can be selected in advance for further backcrosses by, for example, extracting DNA from seedlings and testing it with specific markers for the desired introgression trait, while concentrating energy and resources on fewer plants. To further accelerate the backcrossing process, embryos from immature seeds (25 days after flowering) can be excised and grown on a nutrient medium under sterile conditions instead of allowing the seeds to fully mature. This process, known as “embryo rescue,” is combined with DNA extraction at the three-leaf stage and analysis of at least one genetic variation altering the activity of mtSSB, TWINKLE, or RECA3 and conferring increased aleurone thickness in the plant. This allows for the rapid selection of plants carrying the desired trait, which can be cultured to maturity in a greenhouse or field for subsequent backcrossing with recurrent parents.

[0473] Any molecular biology technique known in the art can be used in the methods of this invention. Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with appropriately labeled probes, single-strand conformation analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage, or combinations thereof (see, for example, Lemieux, 2000; Langridge et al., 2001). This invention also includes the use of molecular marker techniques to detect polymorphisms linked to alleles of, for example, mtSSB, TWINKLE, or RECA3 genes, which respectively alter the activity of mtSSB, TWINKLE, or RECA3 and confer increased aleurone thickness in plants. Such methods include the detection or analysis of restriction fragment length polymorphism (RFLP), RAPD, amplified fragment length polymorphism (AFLP), and microsatellite (simple sequence repeat, SSR) polymorphisms. Tightly connected markers can be readily obtained using methods well-known in the art, such as bulked segregant analysis, as described in Langridge et al., (2001).

[0474] In one embodiment, the linker locus used to mark the auxiliary selection is at least 1 cM, or 0.5 cM, or 0.1 cM or 0.01 cM away from the gene encoding the polypeptide of the present invention.

[0475] Polymerase chain reaction (“PCR”) is a reaction in which a pair of primers, or a set of primers consisting of “upstream” and “downstream” primers, and a polymerization catalyst, such as DNA polymerase, and typically a thermostable polymerase, is used to prepare a replica of a target polynucleotide. Methods for PCR are known in the art and are taught, for example, in “PCR” (MJ McPherson and SG Moller (eds.), BIOS Scientific Publishers Ltd, Oxford, (2000)). PCR can be performed on cDNA obtained from reverse-transcribed mRNA isolated from plant cells expressing the mtSSB, TWINKLE, or RECA3 genes or alleles that increase the aleurone thickness of plants. However, it is generally easier to perform PCR on genomic DNA isolated from plants.

[0476] A primer is an oligonucleotide sequence that hybridizes to a target sequence in a sequence-specific manner and extends during PCR. An amplicon, PCR product, PCR fragment, or amplification product is an extension product consisting of primers and a copy of the newly synthesized target sequence. Multiplex PCR systems contain multiple sets of primers that simultaneously produce more than one amplicon. Primers may be perfectly matched to the target sequence or may contain bases that could lead to the introduction of restriction enzymes or catalytic nucleic acid recognition / cleavage sites in the specific target sequence. Primers may also contain additional sequences and / or modified or labeled nucleotides to facilitate amplicon capture or detection. Repeated cycles of DNA denaturation, primer annealing to its complementary sequence, and primer extension with polymerase result in exponential amplification of the target sequence. The terms target or target sequence or template refer to the nucleic acid sequence being amplified.

[0477] Methods for direct sequencing of nucleotide sequences are well known to those skilled in the art and can be found, for example, in Ausubel et al. (ibid.) and Sambrook et al. (ibid.). Sequencing can be performed by any suitable method, such as dideoxy sequencing, chemical sequencing, or variations thereof. The advantage of direct sequencing is that it identifies variations in any base pairs of a specific sequence.

[0478] Grain processing

[0479] Due to the thickened aleurone, the cereal grains of the present invention, as well as the flour and bran produced therefrom, have improved nutritional content. The separated aleurone structure should contain low levels of starch and pericarp, and represent the major portion of the physiologically beneficial substances of the grain for human nutrition. For example, when compared to corresponding wild-type cereal grains and / or flour produced therefrom, the cereal grains and / or flour produced therefrom of the present invention comprise one or more or all of the following, each based on weight:

[0480] i) Higher fat content, such as at least about 10%, at least about 20%, or at least about 30%, or about 30%, up to about 50% higher than wild type;

[0481] i) Higher ash content, such as at least about 5%, at least about 10%, at least about 15%, or at least about 20%, or about 20%, up to a maximum of about 25% higher than that of the wild type;

[0482] iii) Higher fiber content, such as at least about 70%, at least about 80%, or at least about 94%, or about 94%, up to a maximum of about 150% of total fiber content that is higher than that of wild type;

[0483] iv) Lower starch content, such as a reduction of about 1% to about 10% by weight of starch content relative to the starch content of the corresponding wild-type cereal grains;

[0484] v) A higher mineral content, such as at least 10%, at least 15%, at least 20%, or at least about 25% to up to about 40% higher than that of the wild type. Preferably, the mineral content is one or more of the following: zinc (e.g., at least about 10% or at least about 15% to up to about 30% higher than that of the wild type), iron (e.g., at least about 2.5% or at least about 5% to up to about 10% higher than that of the wild type), potassium (e.g., at least about 20% or at least about 25% to up to about 40% higher than that of the wild type), magnesium (e.g., at least about 18% or at least about 23% to up to about 40% higher than that of the wild type), phosphorus (e.g., at least about 17% or at least about 22% to up to about 40% higher than that of the wild type), and sulfur (e.g., at least about 5% or at least about 10% to up to about 20% higher than that of the wild type).

[0485] vi) Higher antioxidant content, such as at least about 20%, at least about 25%, or at least about 30% more total phenolic compounds and / or at least about 35% or at least about 46% more antioxidant capacity up to about 60% higher than wild-type antioxidants.

[0486] vii) Higher phytate content, such as at least about 10% or at least about 15% to up to about 25% higher than that of wild type;

[0487] viii) Higher levels of one or more of the following: vitamin B3 (e.g., at least 5% or at least 9% higher), B6 ​​(e.g., at least 100% or at least 120% to up to about 200% higher than wild type), and B9 (e.g., at least 50% or at least 61% to up to about 100% higher than wild type);

[0488] ix) Higher sucrose content, such as at least 60% or at least 76% to up to about 100% higher than wild type;

[0489] x) Higher content of neutral non-starch polysaccharides, such as at least about 38% or at least about 48% to up to about 80% higher than that of wild type;

[0490] xi) Higher monosaccharide content (e.g., arabinose, xylose, galactose, glucose content), such as at least about 42% or at least about 59% to up to about 100% higher monosaccharide content than wild type; and

[0491] (xii) Similar nitrogen levels.

[0492] Each of these nutritional components of a grain can be determined using conventional techniques, such as those outlined in Examples 1 and 4.

[0493] In one embodiment, the grain comprises an increased proportion of amylose in its total starch content compared to the corresponding wild-type cereal grain. Methods for producing such grains are described, for example, in WO2002 / 037955; WO2003 / 094600; WO2005 / 040381; WO2005 / 001098; WO2011 / 011833 and WO2012 / 103594.

[0494] In one embodiment, compared to corresponding wild-type cereal grains, the grains of the present invention comprise an increased proportion of oleic acid and / or a decreased proportion of palmitic acid in their total fatty acid content. Methods for producing such grains are described, for example, in WO2008 / 006171 and WO2013 / 159149.

[0495] In another embodiment, when compared with the corresponding wild-type plant, the grain or plant of the present invention further comprises a ROS1a gene encoding a ROS1a polypeptide and one or more genetic variations, each of which reduces the activity of at least one ROS1a gene in the plant. Such grains and plants are described in WO2017 / 083920. Preferably, such grains or plants are rice grains or rice plants.

[0496] The grains / seeds of the present invention or other plant parts of the present invention can be processed using any technique known in the art to produce food ingredients, food or non-food products.

[0497] As used herein, the term "other food or beverage ingredient" means any substance suitable for animal consumption, preferably for human consumption, when provided as part of a food or beverage. Examples include, but are not limited to, grains from other plant species, sugars, etc., but exclude water.

[0498] In one embodiment, the product is whole grain flour, such as ultrafine-milled whole grain flour or flour prepared from about 100% grains. Whole grain flour comprises refined flour components (refined flour or milled flour) and a coarse portion (ultrafine-milled coarse portion).

[0499] Refined flour can be, for example, flour prepared by grinding and sifting clean grains. The particle size of refined flour is described as flour in which not less than 98% of the flour passes through a cloth with an opening no larger than a woven wire cloth designated as "212 microns (US wire 70)". The coarse portion contains at least one of bran and germ. For example, germ is the embryonic plant present in the kernel of the grain. Germ contains lipids, fiber, vitamins, proteins, minerals, and phytonutrients such as flavonoids. Bran contains several cell layers and has a high content of lipids, fiber, vitamins, proteins, minerals, and phytonutrients such as flavonoids. Further, the coarse portion may contain an aleurone layer, which also contains lipids, fiber, vitamins, proteins, minerals, and phytonutrients such as flavonoids. Although technically considered part of the endosperm, the aleurone layer exhibits many of the same properties as bran and is therefore usually removed along with the bran and germ during milling. The aleurone layer contains proteins, vitamins, and phytonutrients such as ferulic acid.

[0500] Furthermore, the coarse portion can be blended with refined flour components. The coarse portion can be blended with refined flour components to form whole grain flour, thus providing whole grain flour with increased nutritional value, fiber content, and antioxidant capacity compared to refined flour. For example, in baked goods, snack products, and food products, the coarse portion or whole grain flour can be used in various amounts to replace refined flour or whole grain flour. The whole grain flour of the present invention (i.e., ultrafine ground whole grain flour) can also be sold directly to consumers for use in their homemade baked goods. In an exemplary embodiment, the granulation profile of the whole grain flour is such that 98% by weight of the particles are less than 212 micrometers.

[0501] In another embodiment, enzymes present in the bran and germ of whole grain flour and / or the coarse portion are deactivated to stabilize the whole grain flour and / or the coarse portion. Stabilization is a process that uses steam, heat, radiation, or other treatments to deactivate enzymes present in the bran and germ. Stabilized flour retains its culinary properties and has a longer shelf life.

[0502] In another embodiment, whole grain flour, the coarse portion, or refined flour can be a component (ingredient) of the food and can be used in the production of the food. For example, the food can be bagels, biscuits, bread, rolls, croissants, dumplings, English muffins, pancakes, pita bread, quick bread, refrigerated / frozen dough products, dough, baked beans, burritos, chili peppers, tacos, tamales, tortillas, tortillas, instant cereals, instant meals, fillings, microwave meals, brownies, cakes, cheesecakes, coffee cakes, cookies, desserts, pastries, burritos, candy bars, pie crusts, fillings, baby food, baking mixtures, batters, breadcrumbs, gravy mixtures, meat increments. Meat substitutes, condiment mixtures, soup mixtures, gravy, pasta sauce, salad dressing, soup, sour cream, noodles, pasta, ramen, fried noodles, lo mein, ice cream buns, ice cream sticks, ice cream cones, ice cream sandwiches, crackers, croutons, donuts, egg rolls, squeezed snacks, fruit and grain bars, microwaveable snack products, nutrition bars, pancakes, semi-baked bread products, crispy biscuits, puddings, granola products, snack chips, snack foods, snack mixtures, waffles, pizza crusts, animal or pet food. Preferred foods are cooked rice, rice porridge, rice noodles, and rice strips containing processed rice grains, and preferred beverages are rice tea. See Example 19 of this document.

[0503] In alternative embodiments, whole grain flour, refined flour, or the coarse portion may be a component of a nutritional supplement. For example, a nutritional supplement may be a product added to a diet containing one or more additional ingredients, typically including: vitamins, minerals, vanilla, amino acids, enzymes, antioxidants, spices, probiotics, extracts, prebiotics, and fiber. The whole grain flour, refined flour, or coarse portion of the present invention contains vitamins, minerals, amino acids, enzymes, and fiber. For example, the coarse portion contains a significant amount of dietary fiber as well as other essential nutrients, such as B vitamins, selenium, chromium, manganese, magnesium, and antioxidants, which are crucial for a healthy diet. For example, 22 grams of the coarse portion of the present invention delivers 33% of an individual's recommended daily fiber intake. Nutritional supplements may contain any known nutrients that contribute to an individual's overall health, examples including, but not limited to, vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and / or other nutrients. The supplement may be delivered in, but is not limited to, the following forms: instant beverage mixtures, ready-to-drink beverages, nutrition bars, wafers, cookies, gel pills, capsules, chewables, chewable tablets, and pills. One embodiment delivers the fiber supplement in the form of a flavored milkshake or a malt-based beverage, which may be particularly attractive as a fiber supplement for children.

[0504] In another embodiment, the milling process can be used to prepare multigrain flour or a multigrain coarse portion. For example, bran and germ from one type of grain can be milled and blended with milled endosperm or whole grain flour from another type of grain. Alternatively, bran and germ from one type of grain can be milled and blended with milled endosperm or whole grain flour from another type of grain. It is conceivable that the present invention covers any combination of one or more of the following: bran, germ, endosperm, and whole grain flour from one or more types of grains. This multigrain method can be used to prepare customized flour and to produce a single flour that utilizes the qualities and nutritional components of multiple types of grains.

[0505] It is conceivable that the whole grain flour, coarse portion, and / or cereal grain products of the present invention can be produced by any milling process known in the art. An exemplary embodiment involves milling the grains in a single feed stream without separating the endosperm, bran, and germ of the grains into separate feed streams. The cleaned and blended grains are fed to a first-pass mill, such as a hammer mill, roller mill, pin mill, impact mill, disc mill, air mill, notched mill, etc. After milling, the grains are discharged and conveyed to a sieve. Furthermore, it is conceivable that the whole grain flour, coarse portion, and / or cereal grain products of the present invention can be modified or enhanced by many other processes, such as fermentation, instant processing, extrusion, encapsulation, baking, roasting, etc.

[0506] Example

[0507] Example 1: General Materials and Methods

[0508] Observation of aleurone powder stained with Sudan Red solution

[0509] The staining solution was prepared by adding 1 g of Sudan IV to 50 ml of polyethylene glycol solution (average molecular weight 400, Sigma, catalog number 202398), incubating at 90°C for 1 hour, and then mixing with an equal volume of 90% glycerol. After removing the pericarp (pastre and lemma) from each grain, mature rice grains were incubated in distilled water for 5 hours and then sectioned transversely or longitudinally using a razor blade. The sections were stained in Sudan IV solution at room temperature for 24 to 72 hours. The sections were then counterstained with Lugol staining solution (Sigma, 32922) at room temperature for 20 minutes and observed under a dissecting microscope (Sreenivasulu, 2010).

[0510] Evans blue staining paste

[0511] Evans blue staining solution was prepared by dissolving 0.1 g of Evans blue (Sigma, E2129) in 100 ml of distilled water. After removing the pericarp from each grain, mature rice grains were transversely sliced ​​using a razor blade. The slices were incubated in distilled water at room temperature for 30 minutes, the staining solution was added, and the slices were left to stand at room temperature for 2 minutes. The staining solution was then discarded, the slices were washed twice with distilled water, and observed under a dissecting microscope.

[0512] Light microscopy observation of rice endosperm

[0513] Rice grains were fixed in a formalin-acetic acid-alcohol (FAA) solution (60% ethanol, 33% H₂O, 5% glacial acetic acid, and 2% formaldehyde; v / v / v / v), degassed for one hour, dehydrated in a series of alcohol solutions containing 70%, 80%, 95%, and then 100% ethanol, infiltrated with LR white resin (Electron Microscopy Sciences, 14380), and polymerized at 60°C for 24 hours. Sections were prepared using a Leica UC7 microtome. Sections were stained for 2 minutes at room temperature in 0.1% toluidine blue solution (Sigma, T3260), washed twice with distilled water, and examined by optical microscopy. Alternatively, sections were stained for 2 minutes at room temperature in 0.01% calcium fluorescent white solution (Sigma, 18909) and examined by optical microscopy with UV excitation (excitation: 365 nm, and emission: approximately 440 nm).

[0514] Staining with periodic acid-Schiff (PAS) reagent and Coomassie blue.

[0515] Fixed sections on slides were incubated at 57°C in preheated 0.4% periodic acid (Sigma, 375810) for 30 minutes, then rinsed three times with distilled water. Schiff's reagent (Sigma, 3952016) was applied, and the slides were incubated at room temperature for 15 minutes, then rinsed three times with distilled water. The sections were then incubated at room temperature in 1% Coomassie blue (R-250, Thermo Scientific, 20278) for 2 minutes, and rinsed three times with distilled water. Dehydration of the sections was achieved using a series of alcohol solutions containing 30%, 50%, 60%, 75%, 85%, 95%, and 100% ethanol, each for 2 minutes, followed by cleaning each slide for 2 minutes in 50% xylene and 100% xylene solutions (Sigma, 534056). Then... Cover slides were mounted on rapidly hardened mounting media (Fluka, 03989), and sections were observed under an optical microscope.

[0516] DNA extraction and PCR conditions

[0517] Two methods were used to extract DNA from plant leaf samples: a rapid DNA extraction method for samples with lower DNA purity, and a more extensive method for extracting purer DNA, improved by Kim et al. (2016). In the first method, four 2 mm diameter glass beads (Sigma, 273627), 1 mg to 2 mg of rice leaf tissue, and 150 μl of extraction buffer (10 mM Tris, pH 9.5, 0.5 mM EDTA, 100 mM KCl) were added to each well of a 96-well PCR plate. The plate was sealed and the mixture was homogenized for 1 minute using a small bead mill 96 mixer (Glen Mills, 1001). After centrifuging the plate at 3000 rpm for 5 minutes, aliquots containing the supernatant of extracted DNA were used for PCR reactions.

[0518] In the second method, 0.2 g leaf samples were cooled in liquid nitrogen in 1.5 ml Eppendorf tubes for 10 minutes, with two 2 mm diameter glass beads per leaf sample. The samples were then homogenized in a small bead mill 96 for 1 minute, and 600 μl of DNA extraction buffer (2% SDS, 0.4 M NaCl, 2 mM EDTA, 10 mM Tris-HCl, pH 8.0) was added to each tube. The mixture was incubated at 65 °C for 1 hour. After cooling the mixture, 450 μl of 6 M NaCl was added to each tube. The tubes were vortexed and centrifuged at 12000 rpm for 20 minutes. Each supernatant was transferred to a new tube, and the DNA was precipitated using an equal volume of 2-propanol at -20 °C for 1 hour. The DNA was recovered by centrifugation at 2400 rpm for 20 minutes at 4 °C, and the clumps were washed twice with 75% ethanol. The pellets were air-dried at room temperature and each pellet was resuspended in 600 μl of distilled water containing 10 ng / μl RNase (Thermo Scientific, EN0201) and used for PCR reactions.

[0519] PCR reactions were performed using 5 μl of 2xPCR buffer containing Taq polymerase (Thermo Scientific, K0171), 5' and 3' oligonucleotide primers, and 1 μl of DNA sample (total volume 10 μl). Amplification was performed using 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. Amplification products were analyzed by gel electrophoresis on a 3% agarose gel. Control PCR reactions used DNA preparations from homozygous ZH11 plants or grains (which are wild-type japonica rice varieties), homozygous NJ6 plants (which are wild-type indica rice varieties), and a mixture of DNA from ZH11 and NJ6.

[0520] For genetic mapping of the ta1 allele, the following primer pairs (5' to 3' sequences) were used for PCR amplification of the genetic markers: Indel 559 (locations 25, 149, 249 on chromosome 5), forward primer TTATCAGCTTCTCGGTTCATCCAA (SEQ ID NO: 50), reverse primer AAACAGGGTTAGCAATTTCGTTTT (SEQ ID NO: 51); Indel 548 (locations 25, 265, 533 on chromosome 5), forward primer TCTGTCCCATATATACAACCG (SEQ ID NO: 52), reverse primer ATTTGTGTTTCAATCCTATATA (SEQ ID NO: 53); Indel 562 (locations 25, 237, 218 on chromosome 5), forward primer GGTCCTTTCAAACACTCCACA (SEQ ID NO: 54), reverse primer CCAACTTTGCCTTAGCATTCA (SEQ ID NO: 55); Indel 583 (located on chromosome 5 at positions 25, 265, 326), forward primer ACTACTCCCTATTTCTGTATTCACT (SEQ ID NO: 56), reverse primer GAGCGTCATGGTTCACCTCTT (SEQ ID NO: 57).

[0521] TILLING Measurement

[0522] The primers used in the TILLING assay had the following nucleotide sequences: TA1-1F: CATTCATAATGACCAGCTAGGTGCT (SEQ ID NO: 98) and TA1-1R: GAGTTGAAACATGCCTGTACTCCTG (SEQ ID NO: 99). PCR amplification using ExTaq was performed under the following reaction conditions: 95°C for 2 minutes; 8 cycles for each 1 kb amplicon length, 94°C for 20 seconds, 68°C for 30 seconds (decreasing by 1°C per cycle), and 72°C for 60 seconds; followed by 35 cycles for each 1 kb amplicon length, 94°C for 20 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, with a final extension at 72°C for 5 minutes. PCR products from wild-type and test samples were mixed and subjected to a complete denaturation slow annealing procedure to form heteroduplexes under the following conditions: for denaturation, 99°C for 10 minutes, followed by 70 decreasing cycles, starting at 70°C and 20 seconds each, with each cycle decreasing by 0.3°C, and then held at 15°C to allow the denatured PCR products to re-anneal to form heteroduplexes. The annealed PCR product was digested with CelI in 15 μL of a reaction mixture containing CelI buffer (10 mM HEPES, pH 7.5, 10 mM KCl, 10 mM MgSO4, 0.002% Triton X-100 and 0.2 μg / mL bovine serum albumin (BSA)), 4 μL of PCR product and 1 unit of CelI (10 units / μL) (if the PCR product is polymerized via Ex-Taq) or 20 units of CelI (if the PCR product is polymerized via KOD) and incubated at 45 °C for 15 min. Then, 2 μL of 0.5 M EDTA (pH 8.0) was added to stop the reaction. Alternatively, the reaction mixture containing 4 μL of PCR product and 2 units of mung bean nuclease (MBN, 10 units / μL, catalog number M0250S; New England Biolabs, USA) was digested for 30 minutes at 60°C in MBN buffer (20 mM Bis-Tris, pH 6.5, 10 mM MgSO4, 0.2 mM ZnSO4, 0.002% Triton X-100 and 0.2 μg / mL BSA), followed by the addition of 2 μL of 0.2% SDS to stop the reaction.

[0523] The total CelI-digested PCR products were electrophoresed on a 2% agarose gel to detect mutations.

[0524] High-resolution DNA melting curve (HRM) analysis

[0525] Young leaf tissue (2mm x 2mm) was homogenized in 150μL of lysis buffer containing 10mM Tris (pH 9.5), 0.5mM EDTA, and 100mM KCl in the wells of a 96-well plate as described above for DNA extraction. PCR was performed using the following mixture: 10μL volume: 5μL 2x master mixture (Roche, catalog number: 04909631001), 10μM forward primer, 10μM reverse primer, 1.0μL 25mM MgCl2, 1.5μL DNA template. The mixture was cycled at 95°C for 10 min, followed by 45 cycles at 95°C for 10 sec, annealed at 53°C for 15 sec, and annealed at 72°C for 15 sec. Then, the denaturation process was performed: 60 seconds at 95°C, 60 seconds at 40°C, 1 second at 65°C, and 1 second at 97°C; the temperature was increased at a rate of 4.4°C / second for 60 seconds, with a target temperature of 95°C.

[0526] Study on the single-stranded DNA binding function of TA1

[0527] As described below, the TA1 gene product was identified as a mitochondrial-targeted single-stranded DNA-binding (mtSSB) protein. To investigate the role of the TA1 peptide in binding single-stranded DNA (ssDNA), purified recombinant TA1 protein fused with a 6xHis tag was analyzed by electrophoretic mobility shift assay (EMSA) to determine its affinity for ssDNA.

[0528] His-tagged TA1 protein expression in Escherichia coli (E. coli)

[0529] The 621 bp protein-coding region (SEQ ID NO:2) of the mature TA1 protein was amplified by PCR and cloned into the pET-30a vector (Novagen, catalog number: 69909-3), and the desired orientation of the gene insert relative to the promoter on pET-30a was confirmed. This construct was designated pET-30a-TA1. It contains a 6xHis tag derived from the pET-30a vector, which is translated and fused at the N-terminus of the expressed TA1 polypeptide to allow binding to a nickel column. Recombinant TA1 was expressed in *E. coli* cells containing the Transetta (DE3) chemical composition (Transgen, catalog number CD801) and grown overnight in LB medium. Cells were lysed by heating at 100°C for 5 min in 1x SDS loading buffer (12 mM Tris pH 6.8, 5% glycerol, 0.4% SDS, 1% β-mercaptoethanol, 0.02% bromophenol blue). Soluble proteins were fractionated by electrophoresis on an SDS-PAGE gel (Bio-Rad Laboratories) and transferred to a PVDF membrane (Bio-Rad Laboratories). The recombinant proteins were then visualized by protein analysis using a monoclonal antibody targeting the 6xHis tag (Marine Biological Laboratory).

[0530] Analytical methods

[0531] Standard methods are used to identify adjacent substances and other key components in grains, food ingredients, and food samples, such as those described below.

[0532] The moisture content of the grains was measured according to Method 925.10 of the Association of Official Analytical Chemists (AOAC). In short, approximately 2 g of grain sample was dried to constant weight in an oven at 130°C for about 1 hour.

[0533] Ash content was measured according to AOAC method 923.03. Samples used for moisture determination were ashed in a muffle furnace at 520°C for 15 hours.

[0534] Protein content of grains, food components, and food samples

[0535] Protein content was measured according to AOAC method 992.23. In summary, total nitrogen was analyzed using the Dumas combustion method with an automated nitrogen analyzer (Elementar Analysensysteme GmbH, Hanau, Germany). Protein content (g / 100g) of the grain or food sample was estimated by multiplying the nitrogen content by 6.25.

[0536] Sugars, starches and other polysaccharides

[0537] Total starch content was measured according to AOAC method 996.11, which uses the enzymatic method of McCleary et al. (1997).

[0538] The amount of sugar was measured according to AOAC method 982.14. In short, the monosaccharides were extracted with an aqueous ethanol solution (80% ethanol) and then quantified by HPLC using acetonitrile:water (75:25 v / v) as the mobile phase and evaporative light scattering detector via a polyamine-bonded polymer gel column.

[0539] Total neutral non-starch polysaccharides (NNSP) were measured by gas chromatography using the procedure of Theander et al. (1995), with slight modifications involving hydrolysis with 1M sulfuric acid for 2 hours followed by centrifugation.

[0540] Fructans (oligofructose) were analyzed using the method detailed in AOAC Method 999.03. Briefly, the fructos were extracted into water and then digested with a mixture of sucrase / maltase / invertase. The resulting free sugars were then reduced with sodium borohydride and digested with fructans to fructose / glucose. The released fructose / glucose was measured using hydrazine p-hydroxybenzoate (PAHBAH).

[0541] Fiber content

[0542] Total dietary fiber (TDF) was measured according to AOAC method 985.29, and soluble and insoluble fiber (SIF) were measured according to AOAC method 991.43. In short, TDF was determined by the gravimetric analysis technique of Prosky et al. (1985), as detailed in AOAC method 985.29, and SIF was determined by the gravimetric analysis method described in AOAC 991.43.

[0543] Total lipids

[0544] A 5g flour sample was incubated with 1% Clarase 40000 (Southern Biological, MC23.31) at 45°C for 1 hour. Lipids were extracted from the sample into chloroform / methanol via multiple extractions. After centrifugation, the chloroform / methanol fraction was removed, and the sample was dried at 101°C for 30 minutes to recover the lipids. The mass of the remaining residue represents the total lipids in the sample (AOAC Method 983.23).

[0545] Fatty acid profile of lipids

[0546] Lipids were extracted from milled flour into chloroform according to AOAC method 983.23. A portion of the chloroform fraction containing lipids was evaporated under a nitrogen stream after adding an aliquot of heptadecanoic acid as an internal standard. The residue was suspended in dry methanol containing 1% sulfuric acid, and the mixture was heated at 50°C for 16 hours. The mixture was diluted with water and extracted twice with hexane. The combined hexane solution was loaded onto a Florisil column, and the column was washed with hexane and fatty acid methyl esters, followed by elution with 10% diethyl ether / hexane. The eluent was evaporated to dryness, and the residue was dissolved in isooctane for injection onto a GC. The fatty acid methyl esters were quantified relative to a mixture of standard fatty acids. GC conditions: SGE BPX70 column 30m x 0.32mm x 0.25μm; injection solution 0.5μL; syringe 250℃; 15:1 split; constant flow rate 1.723 mL / min; oven 150℃ for 0.5 min, 10℃ / min to 180℃, 1.5℃ / min to 220℃, 30℃ / min to 260℃, total run time 33 min; detector FID at 280℃.

[0547] Antioxidant activity (ORAC-H)

[0548] The hydrophilic antioxidant activity (ORAC-H) was determined according to the method of Huang (2002a and 2002b), with slight modifications as described by Wolbang et al. (2010). The lipophilic antioxidants of the sample were extracted, followed by the hydrophilic antioxidants: 100 mg of sample was weighed and divided into triplicate into 2 mL microtubes. 1 mL of hexane:dichloromethane (50:50) was added, and the mixture was vigorously mixed for 2 minutes and centrifuged at 13,000 rpm for 2 minutes at 10 °C. The supernatant was transferred to a glass vial, and the flocs were re-extracted with another 2 mL of the hexane:dichloromethane mixture. The mixing and centrifugation steps were repeated, and the supernatant was transferred to the same glass vial. The residual solvent from the flocs was evaporated under a gentle nitrogen stream. 1 mL of an acetone:water:acetic acid mixture (70:29.5:0.5) was added, and the sample was vigorously mixed for 2 minutes. The mixture was then centrifuged as described above, and the supernatant was used for ORAC-H plate assays. The sample was diluted with phosphate buffer as required. The area under the curve (AUC) was calculated and compared with the AUC value of the Trolox standard. The ORAC value was reported as Trolox equivalent (μM) / sample (g).

[0549] Phenols

[0550] The total phenol content, as well as the free, conjugated, and bound phenols, were determined after extraction according to the method described by Li et al. (2008), with minor modifications. Briefly, free phenols in 100 mg of sample were determined by extraction with 2 mL of 80% methanol in an 8 mL glass vial by sonication for 10 minutes. The supernatant was transferred to a second glass vial, and the residue was extracted again. The combined supernatant was evaporated to dryness under nitrogen. 2 mL of 2% acetic acid was added to adjust the pH to approximately 2, and then 3 mL of ethyl acetate was added to extract the phenols with shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10 °C. The supernatant was transferred to a clean glass vial, and the extraction was repeated at least twice. The combined supernatant was evaporated under nitrogen at 37 °C. The residue was dissolved in 2 mL of 80% methanol and refrigerated.

[0551] For the initial 80% methanol extraction, the conjugated phenolic sample was treated for the determination of free phenols. At this point, 2.5 mL of 2M sodium hydroxide and a magnetic rod were added to the evaporated supernatant in a glass vial, which was then filled with nitrogen and sealed tightly. The vials were mixed and heated at 110°C for 1 hour with stirring. The sample was cooled on ice and then extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vials were centrifuged at 2000 x g for 5 minutes at 10°C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12M HCl. Phenolics were extracted using 3 x 3 mL aliquots of ethyl acetate as described for free phenols. The supernatants were combined and evaporated to dryness under nitrogen at 37°C, and the residue was dissolved in 2 mL of 80% methanol and refrigerated.

[0552] Bound phenols were measured from the residue following methanol extraction of free phenols. 2.5 mL of 2M sodium hydroxide and a magnetic rod were added to the residue, and the vial was filled with nitrogen and sealed tightly. The vials were mixed and heated at 110 °C for 1 hour with stirring. The sample was cooled on ice and then extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10 °C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12M HCl. Phenols were extracted with 3 x 3 mL aliquots of ethyl acetate as described for free phenols. The supernatants were combined and evaporated to dryness under nitrogen at 37 °C, and the residue was dissolved in 2 mL of 80% methanol and refrigerated.

[0553] Prior to hydrolysis, total phenols were determined using 100 mg of sample by wetting the sample with 200 μL of 80% methanol. 2.5 mL of 2M sodium hydroxide and a magnetic rod were added, and the vial was then filled and sealed with nitrogen. The vials were mixed and heated at 110 °C for 1 hour with stirring. The sample was cooled on ice and then extracted with 3 mL of ethyl acetate by shaking for 2 minutes. The vial was centrifuged at 2000 x g for 5 minutes at 10 °C. The supernatant was discarded and the pH was adjusted to approximately 2 with 12M HCl. Phenols were extracted with 3 x 3 mL aliquots of ethyl acetate as described for free phenols. The supernatants were combined and evaporated to dryness under nitrogen at 37 °C, and the residue was dissolved in 4 mL of 80% methanol and refrigerated.

[0554] The amount of phenols in the treated / extracted samples was measured using the Folin-Ciocalteau assay for phenol determination. Standard curves were prepared using gallic acid standards at concentrations of 0, 1.56, 3.13, 6.25, 12.5, and 25 μg / mL. 1 mL of the standard was added to a 4 mL glass tube. For the test sample, an aliquot of 100 μL of the completely mixed sample was added to 900 μL of water in a 4 mL glass tube. Then, 100 mL of Folin-Ciocalteau reagent was added to each tube immediately vortexed. After 2 minutes, 700 μL of 1 M sodium bicarbonate solution was added, and the mixture was then vortexed. Each solution was incubated in the dark at room temperature for 1 hour, and the absorbance was then read at 765 nm. Results are expressed as gallic acid equivalents (μg) / sample (g).

[0555] Phytates

[0556] The determination of phytate content in flour samples was based on the method of Harland and Oberleas, as described in the AOAC Official Analytical Method (1990). Briefly, 0.5 g of flour sample was weighed and extracted with 2.4% HCl for 1 hour at room temperature using a rotary wheel (30 rpm). The mixture was then centrifuged at 2000 x g for 10 minutes, and the supernatant was extracted and diluted 20-fold with milli-Q water. An anion exchange column (500 mg Agilent Technologies) was placed on a vacuum manifold and conditioned according to the manufacturer's instructions. The diluted supernatant was then loaded onto the column and non-phytate species were removed by washing with 0.05 M HCl. Phytates were then eluted with 2 M HCl. The collected eluent was digested using a heating block. The sample was cooled and the volume was brought to 10 mL with milli-Q water. Phosphorus levels were determined spectrophotometrically using a molybdate-sulfonic acid staining method by reading the absorbance at 640 nm. Calculate phytate using the following formula:

[0557] Phytate (mg / g) = P concentration * V1 * V2 / (1000 * Sample weight * 0.282)

[0558] Where P concentration is the phosphorus concentration (μg / mL) determined by spectrophotometry, V1 is the volume of the final solution, V2 is the volume of the extracted phytate solution, and 0.282 is the phosphorus to phytate conversion factor.

[0559] Total mineral content estimation

[0560] The total mineral content of the samples was determined by ash content determination using AOAC methods 923.03 and 930.22. Approximately 2 g of flour was heated at 540 °C for 15 hours, and the large amount of ash residue was then weighed. A 0.5 g sample of whole wheat flour was digested with 8 M nitric acid at 140 °C for 8 hours using tube block digestion. The contents of zinc, iron, potassium, magnesium, phosphorus, and sulfur were then analyzed using inductively coupled plasma atomic emission spectrometry (ICP-AES) according to Zarcinas (1983a and 1983b).

[0561] The minerals were analyzed at CSIRO (Urrbrae, Adelaide, South Australia), Waite Analytical Services (University of Adelaide, Waite, South Australia), and Dairy Technical Services (DTS, North Melbourne, Victoria). Elements were determined at CSIRO by inductively coupled plasma optical emission spectrometry (ICP-OES) after digestion with nitric acid solution, at DTS after digestion with dilute nitric acid and hydrogen peroxide, or by ICP-AES after digestion with nitric acid / perchloric acid solution.

[0562] Vitamins

[0563] Vitamin B3 (niacin), B6 ​​(pyridoxine), and total folic acid were analyzed by DTS and the National Measurement Institute (NMI). Niacin was measured by AOAC Method 13 (1980) 43.045, according to Lahey et al. (1999). Pyridoxine was measured according to Mann et al. (2001). The method incorporates a pre-column conversion of phosphorylated and free vitamin B6 to pyridoxine / pyridoxol. Acid phosphatase hydrolysis was used for dephosphorylation, followed by deamination with glyoxylic acid in the presence of Fe2+ to convert pyridoxamine to pyridoxal. Pyridoxal was then reduced to pyridoxine with sodium borohydride.

[0564] Folic acid was measured according to the manufacturer's instructions using the VitaFast Folic Acid Kit, or according to AOAC Method 2004.05.

[0565] Example 2: Isolation and identification of thick aleurone (ta) mutants

[0566] Establishment and cultivation of mutagenic rice populations

[0567] Approximately 8,000 grains (designated M0 grains) from the wild-type rice variety ZH11 were mutagenized using standard conditions with 60 mM ethyl methanesulfonate (EMS). The mutagenized grains were sown in fields, and the resulting plants were cultured to produce M1 grains. The M1 grains were collected and then sown in fields to produce M1 plants. 8,925 panicles were collected from 1,327 individual M1 plants. From these plants, 36,420 M2 grains, containing at least four grains from each panicle, were selected.

[0568] Mutant screening via half-grain staining

[0569] The pericarps (pastre and lemma) of M2 rice grains were removed. Each of the 36,420 grains was transversely bisected. The half containing the embryo was preserved in 96-well plates for subsequent germination, while each half without the embryo was stained with Evans blue and observed under a dissecting microscope to detect mutant grains with thickened aleurone compared to the wild type. The staining was based on the principle that Evans blue can only penetrate and stain inactive cells, such as those of the starch endosperm, and no color change was observed in the living aleurone layer. Based on the initial Evans blue staining and histological analysis, individual grains were observed to exhibit significantly increased aleurone thickness, and grains showed significantly thickened aleurone on the ventral side of the seed. Other grains showed increased aleurone thickness, but to a lesser extent. The thickness of the aleurone layer in the unstained area on the ventral side of each seed was examined in particular. Variations with increased aleurone layer thickness on the dorsal side of the grain were also observed. Only variants with a significant increase in the thickness of the aleurone layer across the entire cross-section were selected for further analysis.

[0570] Half-grains with thicker Evans blue unstained regions were selected compared to wild-type half-grains. Of the 36,420 grains examined, 219 (0.60%) grains with differences in aleurone thickness were identified and selected. These were obtained from 162 panicles of 140 individual M1 plants and are therefore the most representative independent mutants. Specifically, as described below, a mutant grain with a mutation in the gene designated as thick aleurone 1 (ta1) was identified and further characterized. The corresponding wild-type gene is designated TA1; this name is used herein. As the first mutation identified in the TA1 gene, the mutant allele is designated ta1-1.

[0571] To maintain the proposed mutant line, each corresponding embryogenic hemigrain was germinated on a medium containing half-strength MS salt medium (Murashige and Skoog, 1962) fixed with 1% Bacto agar (Bacto Corporation, 214030) and cultured at 25°C under a 16-hour light / 8-hour dark cycle at a light intensity of 1500–2000 Lux. Plants were transferred to soil at the two- to three-leaf stage, and the resulting plants matured. After germination and culture of the corresponding embryogenic hemigrain, 115 seeds (52.5% survival rate) were produced to generate mature and propagating plants.

[0572] Candidate mutant plants exhibiting few or no defects in general agronomic traits were identified, selected, and further analyzed. These included mutants with normal plant height, reproductive capacity (male and female reproductive capacity), grain size, and a weight of 1,000 grains relative to their wild-type parent varieties, as well as stably inherited mutants exhibiting thickened aleurone. Specifically, M3 generation grains exhibiting three to five cell layers of aleurone in at least a portion of the grain, carrying the ta1-1 mutant allele, were selected and analyzed in detail. As expected, wild-type ZH11 grains exhibited 1-2 cell layers of aleurone around most of the grain.

[0573] Histological analysis of ta1-1 mutant grains

[0574] The developmental grains of wild-type ZH11 and homozygous ta1-1 mutant plants were studied, and morphological changes from day 1 to day 30 post-pollination (DAP) were compared. The maturation period of rice grains can be described as having three stages: the milk grain stage, the wheat grain stage, and the mature grain stage. In the wheat grain stage, the color of grains in wild-type panicles begins to change from green to yellow, subsequently gradually disrupting the vesicle tissue connecting the stem and caryopsis. The color change of grains in ta1-1 panicles is delayed. Microscopic examination of cross-sections of rice grains also revealed increased chalkiness (opaqueness) in ta1-1 mutant grains. The structure of starch granule tissue in the middle portion of the starch endosperm was then studied using scanning electron microscopy (SEM). In wild-type grains, starch granules were tightly packed and exhibited a smooth surface and regular shape, while in ta1-1 grains, loosely packed, irregularly shaped starch granules were observed. In summary, at least three changes were observed in plants and grains with the ta1-1 mutation: delayed grain maturation, increased grain chalkiness, and increased starch granule structure.

[0575] Developing mutant and wild-type grains were stained with Evans blue at 6, 7, 8, 9, 10, 12, 15, 18, 21, 24, 27, and 30 days post-exposure (DAP), and the aleurone layer was examined by optical microscopy. No significant difference in the thickness of the developing aleurone layer was observed between wild-type and ta1-1 mutant grains up to 10 DAP. After 10 DAP, the aleurone layer of the ta1-1 mutant was thicker than that of the wild-type grains, with the difference reaching its maximum at approximately 20 DAP. Figure 1 The staining of seed sections with Lugol's reagent is shown, thus highlighting the starch endosperm ( Figure 1 Figures E and F, and PAS and Coomassie Brilliant Blue (G-250) staining of seed semi-thin sections, to demonstrate aleurone development in wild-type (ZH11) and ta1-1 mutants at three developmental time points.

[0576] The histological differences between wild-type and ta1-1 mutant grains (30DAP) were further examined by sectioning (1 μm), staining, and optical microscopy. After staining with 0.1% toluidine blue stained with nucleic acid blue and polysaccharide purple, a monolayer of large, regularly oriented rectangular cells was observed in the wild-type aleurone. In contrast, sections of ta1-1 mutant grains showed aleurone layers of three to five cell layers, with cells of varying sizes and irregular orientations. These observations suggest that the aleurone thickening in ta1-1 grains is primarily caused by an increase in the number of cell layers, rather than an enlargement of individual aleurone cells.

[0577] Further staining with 0.01% calcium fluorescent white, a fluorescent cell wall staining agent, showed that there was no difference in cell wall thickness between wild-type and ta1-1 mutant grains in the aleurone layer. For both wild-type and ta1-1 grains, the cell walls of the aleurone cells were thicker than those in the starch endosperm.

[0578] As described in Example 1, mature wild-type and ta1-1 grains were cross-sectioned and stained with PAS. The aleurone thickness (calculated as cell layer number) of 15 grains for each genotype in the dorsal, upper, lateral, lower, and ventral locations of the grains was counted and statistically analyzed. Figure 2 The results are shown in the figure. It was observed that the number of cell layers in the wild-type and mutant grains was inconsistent in five different locations of the mature grain, but in each location, the number of cell layers in the mutant grains was significantly greater than that in the wild-type grains (P<0.01).

[0579] Grain filling during plant growth and development was examined by measuring grain dry weight at 3, 6, 9, 12, 18, 26, 34, and 42 DAP and comparing it with the dry weight of wild-type grains. Results ( Figure 3 The results showed that grain filling of ta1-1 grains was reduced.

[0580] Analysis of agronomic characteristics of ta1 mutant plants and grains

[0581] After backcrossing wild-type (ZH11) plants three times in the field to produce the BC3F3 generation, thereby removing any unconnected mutations that might have been induced by mutagenesis, some agronomic traits of the ta1-1 mutant plants were analyzed. Compared to wild-type plants and grains, the ta1-1 mutant plants and grains showed no significant differences in the following aspects: plant height, grain size in terms of length, width, and thickness, and caryopsis morphology (Table 2). In contrast, wild-type plants showed a seed set rate of 98.90%, while homozygous ta1-1 mutant plants showed a reduced seed set rate of 89.32%. Seed set rate was calculated as the percentage of florets filled with seeds in the plant at the mature grain stage. Furthermore, when cultured in a growth chamber at 28°C under a 12-hour light / 12-hour dark cycle without humidity control, the germination rate of ta1-1 mutant grains was 49.8% lower than the 97.3% germination rate of wild-type grains. Germination is defined as when the radicle penetrates the seed coat and becomes clearly visible.

[0582] Table 2: Comparison of agronomic traits between wild-type (ZH11) and ta1-1 mutant plants (mean ± SE).

[0583] Plant height (cm) 103.7(±3.24) 101.5(±5.62) Fruit setting rate (%) 98.9(±3.41) 89.32(±5.15) Weight of 1000 seeds (g) 22.73(±0.17) 19.99(±0.33) Seed length (mm) 7.46(±0.26) 7.38(±0.25) Seed width (mm) 3.27(±0.12) 3.37(±0.13) Seed thickness (mm) 2.35(±0.10) 2.24(±0.11)

[0584] Example 3: Genetic analysis of ta1-1 mutation

[0585] Hybridization was performed to determine the genetic control of the ta1 mutation, specifically whether the mutation was dominant or recessive, and whether it was inherited from one or both parents. Two genetic experiments were conducted to determine whether the thick aleurone phenotype was maternally determined. First, a test hybridization was performed between a maternally homozygous ta1-1 plant and pollen from a wild-type ZH11 plant. F2 offspring grains were obtained. In the F2 grains, 24.1% (n=1093) showed the thick aleurone phenotype, consistent with the Mendelian genetic prediction of a 3:1 (wild-type:mutant) ratio for recessive nuclear-coding mutations in the F2 population. 98.7% of the F1 seeds (n=218) were observed to have the wild-type aleurone phenotype, while the remaining 1.3% of the seeds were difficult to score but were shown to have wild-type aleurone in the F2 generation. Second, intercrosses were performed using pollen from the ta1-1 plant applied to the wild-type plant as the maternal parent. Based on the cross, 99.7% of the F1 seeds (n=325) exhibited the wild-type aleurone phenotype. These data indicate that the thick aleurone phenotype of ta1-1 is controlled by a single nuclear gene in which the mutant allele is recessive relative to the wild-type allele.

[0586] Example 4: Nutrient composition analysis of ta1-1 mutant grains

[0587] To measure the composition of mutant grains, particularly important nutritional components, ZH11 and homozygous ta1-1 plants were grown in the field at the same time and under the same conditions. Whole grain flour samples, also referred to herein as whole wheat or brown rice flour, were prepared from grains collected from the plants using the method described in Example 1, and were used for component analysis. Approximate analytical results of the flour are shown in Table 3, which presents the average values ​​of repeated measurements.

[0588] Approximate analysis showed that the total fat content in ta1-1 mutant flour was increased by approximately 30%. Total nitrogen analysis showed no significant change in protein levels between ta1-1 mutant and wild-type grains. Ash determination, measuring the amount of matter left after burning dehydrated flour samples, indicated that the ash content of ta1-1 grains was increased by 20% relative to wild-type grains. The total fiber level of ta1-1 grains was increased by approximately 94%. The starch content in ta1-1 grains was decreased by 5% relative to wild-type. These data suggest that the increased aleurone layer thickness in the ta1-1 mutant leads to increased levels of aleurone-rich nutrients such as lipids, minerals, and total dietary fiber without altering seed size. For a more detailed understanding of these and other changes, a more extensive analysis was conducted below.

[0589] Table 3: Composition analysis of rice grains (unit: g / 100g grains)

[0590]

[0591] Other component analysis records are in Figure 4 The study confirmed that brown rice flour significantly increases protein, dietary fiber, calcium, iron, zinc, vitamin B2, and vitamin B3.

[0592] minerals

[0593] To measure mineral content, ICP-AES (Example 1), a combination of inductively coupled plasma (ICP) and atomic emission spectrometry (AES), was used. This is a standard method for measuring mineral content, providing sensitive and high-throughput quantification of a large number of elements in a single analysis. Data obtained from the analysis showed that zinc levels in ta1-1 mutant grains increased by approximately 15%, from 13.9 mg / kg to 15.68 mg / kg. In the same field-grown ta1-1 whole grain flour sample, iron increased by 5%, from 12.43 mg / kg to 13.03 mg / kg.

[0594] Increases in potassium, magnesium, phosphorus, and sulfur were also observed, by approximately 26%, 23%, 22%, and 10%, respectively. These results are consistent with the increase in ash content in ta1-1 grains, which is the primary mineral measured.

[0595] antioxidants

[0596] Antioxidants are biomolecules that can counteract the negative effects of oxidation in animal tissues, thus preventing oxidative stress-related diseases such as inflammation, cardiovascular disease, cancer, and age-related conditions (Huang, 2005).

[0597] As described in Example 1, the antioxidant capacity in whole wheat flour obtained from ta1-1 mutant and wild-type rice grains was measured by an oxygen radical scavenging capacity (ORAC) assay. In the ORAC assay, antioxidant capacity is represented by the competitive kinetics between endogenous radical scavenging biomolecules and the oxidizable molecular fluorescent probe luciferin against synthetic radicals generated by AAPH (2,2'-azobis(2-amidinyl-propane) dihydrochloride). Capacity is calculated by comparing the area under the kinetic curve (AUC) with the AUC generated by Trolox standards, which represents the fluorescence degradation kinetics of the molecular probe luciferin in the grain (Prior, 2005). An alternative method for quantifying antioxidant capacity is using the Folin-Ciocalteau reagent (FCR); this represents antioxidant capacity by measuring the reducing power of total phenolic compounds in a food sample. The FCR assay is relatively simple, convenient, and reproducible. However, the more time-consuming ORAC assay yields higher levels of biorelevant activity. Because antioxidants comprise a variety of polyphenols, reducing agents, and nucleophiles, measurements using both FCR and ORAC can provide better coverage and a more comprehensive representation of total antioxidant capacity. As reported by Prior (2005), FCR and ORAC measurements are generally consistent.

[0598] Both FCR and ORAC assays showed that flour from the ta1-1 mutant whole grains had increased antioxidant capacity compared to wild-type ZH11 whole grain flour. ORAC increased the antioxidant capacity of ta1-1 mutant grains by approximately 46% and total phenols by 30%.

[0599] Phytates

[0600] When grown under phosphorus-sufficient conditions, approximately 70% of the total phosphorus content in rice grains exists in the form of phytates or phytic acid (inositol-1,2,3,4,5,6-hexaphosphate). Dietary phytates can also be beneficial to health as powerful antioxidants (Schlemmer, 2009). Total phytate analysis showed that the phytate content in ta1-1 grains increased by approximately 15% compared to wild-type ZH11 grains, from approximately 10.8 mg / g to approximately 12.4 mg / g.

[0601] B vitamins

[0602] Compared to wild-type flour, ta1-1 flour contains approximately 9% higher levels of vitamins B3 (niacin), B6 ​​(pyridoxine), and B9 (folic acid), while levels are 120% higher and 61% higher, respectively. Aleurone is known to be richer in vitamins B3, B6, and B9 than endosperm (Calhoun, 1960), therefore the increased aleurone thickness in ta1-1 mutant grains creates a stronger reservoir for these vitamins and possibly others.

[0603] carbohydrate

[0604] Based on weight, the starch content of ta1-1 grains was reduced by 6%. In contrast, the sucrose level in mutant grains increased by 76%. Neutral non-starch polysaccharides (NNSP) increased by 48% relative to the wild type, and the monosaccharide components (arabinose, xylose, galactose, and glucose) of NNSP all increased from 42% to 59%.

[0605] in conclusion

[0606] Nutritional analysis showed that, compared to wild-type flour, whole-grain flour produced from field-grown ta1-1 grains, and consequently, a significant increase in most aleurone-rich nutrients, was produced from the whole grains. This included macronutrients such as lipids and fiber; micronutrients such as minerals, including at least iron, zinc, potassium, magnesium, phosphorus, and sulfur levels; B vitamins such as B3, B6, and B9; antioxidants; and aleurone-related biomolecules such as phenolic compounds and phytates. Free sucrose was also significantly increased. Along with this increase in these nutrients and micronutrients, the starch content in the ta1-1 mutant decreased slightly on a weight basis as a relative percentage.

[0607] Example 5: Determination of α-amylase activity in ta1-1 mutant grains

[0608] During cereal seed germination, α-amylase, produced by the aleurone layer after absorption, plays a crucial role in hydrolyzing endosperm starch into metabolizable sugars, providing energy for rooting and germination (Akazawa and Hara Mishimura, 1985; Beck and Ziegler, 1989). Due to the increased aleurone cell layer in ta1 mutant grains, α-amylase activity in germinating rice grains was determined over several days. An amylase activity assay kit (Sigma, MAK009) was used for the assay, and the specific method is as follows.

[0609] Sample preparation

[0610] 100 mg of germinated rice grains were individually dissected to remove seedlings. The remaining endosperm and aleurone tissue were homogenized in 0.5 mL of amylase assay buffer, and the mixture was centrifuged at 13,000 g for 10 minutes to remove insoluble matter. 1–50 μL of sample was added to each well of a 96-well plate, and each sample was adjusted to a volume of 50 μL with amylase assay buffer. For the positive control, 5 μL of amylase positive control solution was used, adjusted to 50 μL with amylase assay buffer. Standards were prepared by dispensing 0, 2, 4, 6, 8, and 10 μL of 2 mM nitrophenol standard per well to a volume of 50 μL, resulting in standards of 0, 4, 8, 12, 16, and 20 nanomoles / well.

[0611] Determination of reaction

[0612] 1. The main reaction mixture was prepared by mixing 50 mL of amylase assay buffer and 50 mL of amylase substrate mixture.

[0613] 2. Add 100 μL of the main reaction mixture to each of the sample, standard, and positive control wells, and mix each sample by pipetting.

[0614] 3. After 2-3 minutes (T_initial), measure the absorbance at 405 nm, which is called the (A405) initial value.

[0615] 4. Incubate the plate at 25°C and measure the absorbance (A405) every 5 minutes. Keep the plate away from light during incubation.

[0616] 5. Continue measurements until the value of the most active sample exceeds that of the highest standard (20 nanomoles / well). At this point, the most active sample is near the end of the linear range of the standard curve.

[0617] 6. The final absorbance measurement used to calculate enzyme activity [(A405) final] is the value taken at the time point immediately preceding the end of the linear range of the standard curve for the most active sample. The penultimate reading is designated as T final.

[0618] Background correction is performed by subtracting the final measurement value (A405) obtained for the 0-nitrophenol standard from the final measurement value (A405) of the standard and sample. The absorbance change from initial T to final T is calculated as follows: ΔA405 = (A405)final - (A405)initial.

[0619] The ΔA405 of each sample was compared to the standard curve to determine the amount of nitrophenol (B) produced by amylase between the initial T and the final T. The amylase activity of the samples was determined by the following equation:

[0620] Amylase activity = B x sample dilution factor

[0621] (Reaction time) x V

[0622] B = the amount of nitrophenol produced between the initial T and the final T (in nanomoles)

[0623] Reaction time = Tfinal - Tinitial (minutes)

[0624] V = Sample volume added to the well (mL)

[0625] Amylase activity for each sample is reported in nanomoles per minute per milliliter (mI). One unit of amylase is the amount of amylase that cleaves ethylene-pNP-G7 at 25°C to produce 1.0 μmol of p-nitrophenol per minute.

[0626] Measurement results ( Figure 5 The results showed that, from 3 days onwards, the α-amylase activity of germinated ta1-1 grains was higher than that of ZH11, and the increase was greater over time, reaching a maximum 7 days after absorption began (DAG).

[0627] Example 6: Identification of TA1 gene and ta1-1 mutations through genetic mapping and sequence analysis

[0628] Identification of SSR and Indel markers and their applications in gene mapping

[0629] For gene mapping, an F2 population of plants was generated by genetic hybridization between plants containing the ta1-1 mutation in the genetic background of japonica rice variety ZH11 and plants of indica rice variety NJ6. To identify polymorphic genetic markers between ZH11 and NJ6 that could then be used for gene mapping, a series of PCR experiments were performed on leaf DNA samples from homozygous ZH11 plants, homozygous NJ6 plants, and a 1:1 mixture of DNA. The PCR products were analyzed by gel electrophoresis, allowing comparison of products from ZH11, NJ6, and the mixture to identify polymorphic markers. Primer pairs were selected for gene mapping only when amplification of individual ZH11 and NJ6 DNA showed discrete and distinct amplification products, and when the mixed DNA showed a combination of the two products. A total of 124 primer pairs were thus selected, encompassing 54 insertion-deletion polymorphisms (INDELs) and 70 short sequence repeat (SSR) polymorphisms. These genetic markers are distributed along the rice genome at intervals of approximately 3-4 Mbp, providing good coverage for gene mapping.

[0630] For genetic mapping of the ta1-1 allele, 132 plants from the F2 population were scored using 124 polymorphic markers. Homozygosity or heterozygosity of individual F2 plants for the aleurone phenotype in the mapping population was carefully assessed by phenotyping F3 progeny grains obtained from each F2 plant. Leaf DNA was extracted as described in Example 1. PCR amplification was performed as described in Example 1, and the products were separated by 3% agarose gel electrophoresis. The results showed that the ta1 locus is located between markers Indel 537 and Indel 541 on chromosome 5 (…). Figure 6 (), which comes from the rice genome sequence, corresponding to a physical distance of approximately 400 kb.

[0631] Another 8000 F2 plants were screened using this pair of markers. 1076 individuals exhibiting recombination between the Indel 537 and Indel 541 markers were identified and selected. When these recombinant plants were phenotypically analyzed, the ta1 locus was mapped to a 28kb region located between the Indel 562 and Indel 583 markers. Figure 6 ).

[0632] To obtain the nucleotide sequence of this region in the ta1-1 mutant plant, compare it with the wild-type sequence, and thereby identify the mutation corresponding to the ta1-1 allele, primers for flanking the genomic region were designed, and DNA sequencing was performed. Comparison of the genomic DNA sequences identified the single nucleotide polymorphism (SNP) in the sequencing region of the gene annotated on the rice genome sequence (EnsemblPlants) as Os05g0509700. This gene is located on chromosome 5:25,254,990-25,259,747, where the reverse strand is annotated as a mitochondrial ssDNA binding protein. For the protein linked to the japonica rice gene Os05g0509700, the same gene as LOC_Os05g43440 was annotated in the UniPARC genome sequence. Referring to the EnsemblPlants rice genome sequence of the japonica rice variety, a single nucleotide polymorphism from G (wild-type) to A was identified at the nucleotide location Chr5:25257622. Referring to SEQ ID NO:4, the nucleotide substitution G2126A is the last nucleotide of intron IV, which is located between exon 4 and exon 5 of the gene Os05g0509700 on chromosome 5. Figure 6 (The bottom line). The intron number is taken from the protein-coding region annotation of Os05g0509700, and there are no long introns in the 5'-UTR of the gene. Since the mutation involves the last nucleotide of the intron within the splice site, the inventors suspected that the mutation involved disrupting the splicing of the TA1 gene. The subsequent experiments confirmed that this polymorphism was a ta1-1 mutation.

[0633] This experiment also showed that the ta1-1 mutation can be introduced into different genetic backgrounds, such as indica rice varieties, and still confers the thick aleurone phenotype.

[0634] Example 7: The nature of the ta1-1 mutation

[0635] To analyze the expression and splicing of the ta1-1 gene, RNA was extracted from the leaves and developing grains of the ta1-1 plant, as described in Example 1. The RNA was combined, reverse transcribed, and the nucleotide sequences of individual cDNAs were obtained. Three distinct cDNA sequences, designated ta1-1 cDNA I, II, and III, were obtained from the ta1-1 cDNA, each sequence differing from the wild-type cDNA sequence from ZH11. Comparison of the ta1-1 cDNA nucleotide sequences with the wild-type cDNA (SEQ ID NO:2) showed that the G-to-A polymorphism in intron IV at nucleotide location 2126 (G2126A) was associated with three distinct mature mRNAs in the ta1-1 grains. Based on this and further analysis below, the inventors concluded that these variants arise from alternative splicing of the ta1 transcript.

[0636] Three ta1-1 transcripts were further analyzed by RT-PCR using oligonucleotide primers (SEQ ID NO:58 and SEQ ID NO:59) that cross the mutation site and thus the alternative splice region. The PCR products were then recovered and cloned into the Blunt vector, and the individual clones were then sequenced for nucleotides. Figure 7 The aligned sequence of the cDNA region across the mutation site is shown, compared with the wild-type cDNA sequence. cDNAs I, II, and III were observed to have the same nucleotide sequence as the wild-type cDNA up to the end of exon 4, i.e., the beginning of intron IV, but then differentiated with the insertion of the last 31 nucleotides of intron IV into cDNA I, or the deletion of the exon 5 sequence (cDNA II), or the deletion of a single nucleotide at the beginning of exon 5 (cDNA III). Relative to the amino acid sequence of the wild-type TA1 protein (SEQ ID NO:3), the ta1-1 cDNA I (SEQ ID NO:12) has a 31 bp insertion just before exon 5, encoding a polypeptide (SEQ ID NO:8) resulting from a translation frameshift at amino acid location 182, leading to a premature translation stop codon at location 193. Because ta1-1 cDNAII (SEQ ID NO:13) has the deletion of the entire exon 5, the cDNA encodes a polypeptide resulting from a translation frameshift at amino acid location 182, leading to premature translation termination at location 186 (SEQ ID NO:9). In contrast to the wild-type TA1 protein, because ta1-1 cDNA III (SEQ ID NO:14) has the deletion of the first G nucleotide in exon 5, the cDNA encodes a polypeptide resulting from a translation frameshift at location 182, leading to premature translation termination at amino acid location 185 (SEQ ID NO:10). Figure 8The predicted full-length amino acid sequence was compared with the wild-type TA1 sequence.

[0637] The relative abundances of ta1-1 I, II, and III cDNAs were 67%, 29%, and 4% of the total transcripts, respectively. Wild-type transcripts were not detected in the leaves and developing grains of the ta1-1 mutant plants by cDNA analysis; the inventors concluded from the absence of wild-type mRNA in the mutant plants that wild-type splicing was eliminated. Based on these data, it was concluded, through data from the following experiments, that the polymorphism in intron IV of the ta1-1 gene leads to pathogenicity changes in the plants and their grains, namely, the ta1-1 mutation. It was also concluded that, relative to the wild-type TA1 gene, the mutation results in an altered splicing pattern of the ta1-1 gene RNA transcripts, thereby leading to the ta1 mutant phenotype of the ta1-1 allele.

[0638] The gene located at Os05g0509700 on chromosome 5 of the rice genome has been annotated as the rice mtSSB-1a gene (OsmtSSB-1a), which is a homolog of the Arabidopsis mtSSB-1 gene (AtmtSSB-1) that encodes a mitochondrial-targeting single-stranded DNA-binding protein (Edmondson et al., 2005).

[0639] The nucleotide sequence of the wild-type rice mtSSB-1a (TA1) gene is provided as SEQ ID NO:1, comprising a promoter and a 1024-nucleotide 5'-UTR (untranslated region), a protein-coding region containing 5 introns from nucleotides 1025-2369, and a 411-nucleotide 3'-UTR. The nucleotide locations of the 5 introns are provided in the legend of SEQ ID NO:1. The nucleotide sequence of the cDNA corresponding to the wild-type TA1 (OsmtSSB-1a) gene is provided as SEQ ID NO:2, and the amino acid sequence of the encoded wild-type TA1 polypeptide of 206 amino acids is provided as SEQ ID NO:3.

[0640] Description of structural features of TA1 polypeptide in wild-type rice

[0641] After discovering that the rice TA1 gene is identical to OsmtSSB-1a, the amino acid sequence of the OsTA1 (OsmtSSB-1a) polypeptide was examined. A typical single-stranded DNA-binding domain was identified. Figure 9The amino acid sequence corresponds to amino acids 73-184 of SEQ ID NO:3. The amino acid sequence was compared with the most homologous sequences encoded by the genomes of seven other plant species (see Example 12), which broadly represent angiosperms: maize (SEQ ID NO:16); sorghum (SEQ ID NO:17); barley (SEQ ID NO:18); common wheat (SEQ ID NO:19); and *Brachys davidiana* (SEQ ID NO:20), a monocotyledonous model associated with cereals; *Arabidopsis thaliana* (SEQ ID NO:15), a dicotyledonous model; and *Populus alba* (SEQ ID NO:21), a model tree. The genome sequences of these species are well-assembled and annotated. When the mtSSB amino acid sequence was aligned ( Figure 9 It is evident that the SSB domain is more highly conserved compared to the N-terminal and C-terminal side-joint sequences, exhibiting at least 80% identity with the 112 amino acids in the SSB region of OsTA1. The amino acid sequence shows at least 60% overall identity with the full length of SEQ ID NO:3, containing at least 79% of the sequence specific to monocotyledonous TA1. Figure 9 The SSB domains of the nine TA1 peptides shown contain conserved amino acid motifs: FRGVHRAI(I / L)CGKVGQ(V / A)P(V / L)QKILRNG(R / H)T(V / I)T(V / I)FT(V / I)GTGGMF DQR (motif I, SEQ ID NO:45) corresponding to amino acids 73-114 of SEQ ID NO:3; P(K / M)PAQWHRI(A / S)(V / I)H(N / S)(D / E) (motif II, SEQ ID NO:46) corresponding to amino acids 122-135 of SEQ ID NO:3; AVQ(K / Q)L(V / T)KNS(A / S)VY(V / I)EG(D / E)IE(T / I)R(V / I)YND (motif III, SEQ ID NO:47) corresponding to amino acids 141-164 of SEQ ID NO:3; and SEQ ID NO:46. The amino acids 176-184 of NO:3 correspond to IC(L / V / I)R(R / G)DGKI (motif IV, SEQ ID NO:48). These four motifs are completely conserved in all nine aligned TA1 sequences, except for the poplar sequence, as are the spacing between each motif. Figure 9 It was concluded that the four motifs and their spacing may be essential for the full functioning of the TA1 polypeptide in plants.

[0642] When the amino acid sequence of OsmtSSB-1a (SEQ ID NO:3) was analyzed using Mitofuates software in a plant setting, a mitochondrial protease cleavage site was predicted between amino acids 28 and 29 of SEQ ID NO:3. Figure 9 This led to the prediction that a 28-amino acid mitochondrial transport peptide is located at the N-terminus of the polypeptide, which will be removed upon entering the mitochondria of rice cells to produce a mature polypeptide with 178 amino acids. Compared to predictions for the Arabidopsis sequence of AtmtSSB-1, this predicted site is located within a single amino acid residue (Edmondson et al., 2005).

[0643] Notably, the last three amino acids (GKI) of the DNA-binding domain of the wild-type OsTA1 (OsmtSSB-1a) peptide are missing in the predicted translation products of ta1-1 cDNA I, II, and III. Figure 6 Furthermore, it is missing in the C-terminal region following the DNA-binding domain of the TA1 polypeptide.

[0644] Example 8: Expression of the TA1 gene in rice

[0645] Experiments were conducted to analyze the expression of the TA1 gene in different rice tissues, including parts of developing grains, particularly in the embryo, starch endosperm, and aleurone. In the first experiment, TA1 mRNA was detected in rice tissue sections by in situ hybridization, as described by Brewer et al. (2006). Briefly, after vacuum infiltration, various rice tissues were fixed in FAA fixative at 4°C for 8 hours, dehydrated using a series of graded ethanol followed by a series of xylenes, and embedded in Paraplast Plus (Sigma-Aldrich) as described in Example 1. 8 μm thick microtome sections were mounted on Probe-on-Plus microscope slides (Fisher).

[0646] Based on hybridization signals, it was concluded that the TA1 gene is expressed in the seed coat, aleurone tissue, and embryo of developing grains, but not in the vascular bundles. TA1 is also expressed in developing inflorescences, but not in leaves and stems.

[0647] Real-time reverse transcription polymerase chain reaction (RT-PCR) was used to determine the relative expression levels in different plant tissues. Expression levels were normalized relative to the expression of actin genes, which are constitutively expressed genes within the same tissue. Surprisingly, the results indicated that relative expression was highest in pollen, followed by embryo, shoot apical meristem, and aleurone tissue. Figure 10It is believed that the specific expression of TA1 in viable growing tissues may be involved in cell division. As a predicted SSB protein, TA1 is thought to play a role in protecting single-stranded DNA and recruiting other related proteins during DNA replication, recombination, transcription, and DNA repair in these viable growing tissues.

[0648] Example 9: ssDNA binding activity of TA1 protein

[0649] Purification of TA1 fusion protein

[0650] To test the DNA-binding activity of the TA1 peptide in vitro, a recombinant TA1 fusion protein (6xHis-TA1) with a 6xHis tag at its N-terminus was generated from an expression vector in *E. coli*, as described in Example 1. The 6xHis tag was incorporated to allow for rapid and simple purification of the fusion protein via binding to a nickel column. *E. coli* cells expressing the fusion protein were disrupted by freezing in liquid nitrogen, thawing on ice, and sonicating for 30 minutes (with 5-second pulses at 10-second intervals). The 6xHis-TA1 protein was enriched by precipitation of 40% ammonium sulfate in potassium phosphate buffer. The precipitated protein was resuspended and dialyzed overnight with sodium phosphate buffer (50 mM NaPO4, 500 mM NaCl, pH 7.8). The protein was then loaded onto a nickel column (Bio-Rad Laboratories) and washed extensively with sodium phosphate buffer containing 10 mM imidazole to remove unbound proteins. The purified 6xHis-TA1 protein was separated from the column using a linear gradient of imidazole-containing sodium phosphate buffer from 10–500 mM. Protein concentration in each fraction was determined spectrophotometrically, and samples were separated by SDS-PAGE followed by Coomassie blue staining. The purified 6xHis-TA1 protein was transferred to storage buffer (50 mM Tris-HCl pH 7.4, 1 mM EDTA, 1 mM DTT, 0.2 M NaCl, 50% (v / v) glycerol) and stored at -80°C.

[0651] Electrophoretic mobility variation measurement (EMSA)

[0652] The affinity of purified 6xHis-TA1 protein for ssDNA was determined using EMSA (Thermo Scientific, catalog number 20148X), as described in the generic terminology described by Reddy et al., (2001). A single-stranded oligonucleotide (SEQ ID NO: 60) with a 45-nucleotide biotinylated CTP (Thermo Scientific, catalog number 89818) label at the 3' end was used according to the manufacturer's instructions. Recombinant 6xHis-TA1 protein (2 μg) was added to 750 attomoles of the biotinylated oligonucleotide, and the mixture was incubated at room temperature for 10 min. A control sample lacking 6xHis-TA1 protein was applied… Figure 11Lane 1 of the swim grout line. A separate reaction was performed in the presence of 60 bp double-stranded DNA (dsDNA; control fragment from Thermo EMSA kit) to determine whether the migration rate variation was specific to ssDNA. The binding reaction products were separated by electrophoresis in 5% natural polyacrylamide gel in 0.5 x TBE (Bio-Rad Laboratories) and transferred to a nylon membrane (Bio-Rad Laboratories). The DNA bands were visualized using streptavidin-conjugated horseradish peroxidase (Thermo). Figure 11 As shown, the 6xHis-TA1 protein binds to ssDNA, and this binding is reduced by competing with unlabeled ssDNA. dsDNA does not compete with the TA1 protein for binding to single-stranded DNA (ssDNA), indicating that the protein is specific to ssDNA, consistent with its designation as a single-stranded DNA-binding (SSB) protein.

[0653] To examine whether the mutant ta1-1 I peptide retained its ability to bind to ssDNA, a similar genetic construct was prepared that encoded the predicted peptide from ta1-1 cDNA I, with a 6xHis tag at the N-terminus, and expressed in *E. coli*. The cDNA I sequence was chosen because the corresponding mRNA is the major splice transcript of the mutant ta1-1 gene, representing approximately 70% of the total transcription of the ta1-1 gene. The mutant 6xHis-ta1-1 fusion peptide was purified using the same method as for the wild-type 6xHis-TA1 protein. The purified 6xHis-ta1-1 I fusion peptide was used in EMSA experiments as described above to compare the binding of the wild-type and mutant peptides to ssDNA. The binding experiments showed that the mutant (truncated) peptide bound to ssDNA, but with only a 3-4 fold reduction in efficiency compared to the wild-type TA1 protein. Figure 12 Both TA1 and its truncated form (6xHis-ta1-1 I) can bind to ssDNA probes, but the binding activity of 6xHis-TA1 is higher than that of its truncated form (6xHis-ta1-1 I), because the probe strength shifted by 2 μg of 6xHis-TA1 is similar to that shifted by 8 μg of the truncated 6xHis-ta1-1 I peptide. Based on this data, the inventors concluded that at least the ta1-1 I peptide retains some SSB activity, and that the ta1-1 allele is not a null allele. The activity of the ta1-1 gene is considered to be reduced by at least 67% compared to the wild-type TA1 gene.

[0654] Example 10: Complementation analysis of the ta1-1 mutant

[0655] To reinforce the conclusion that mutations in the TA1 gene are responsible for the thickened aleurone and related phenotypes observed in the ta1-1 mutant, two complementary experiments were performed. In the first experiment, a wild-type copy of the TA1 gene containing the natural TA1 promoter was introduced into ta1-1 mutant plants via Agrobacterium-mediated transformation. The DNA sequence to be introduced was amplified from ZH11 genomic DNA using a series of oligonucleotide primers and then assembled into the binary vector pPLV15. The vector also contained a hygromycin resistance gene as a selective marker gene. Using a method described by Nishimura et al. (2006), plasmids for transformation and control plasmids (empty vectors) were each introduced into Agrobacterium tumefaciens strain EHA105 and used to transform ta1-1 rice recipient cells. A total of 53 T0 transgenic plants were regenerated based on the wild-type TA1 gene used for transformation. These plants were transferred to soil and matured in a growth chamber. When PCR was used to test for the presence of the hygromycin resistance gene, 34 transformed lines carrying the hygromycin gene were confirmed and selected. These plants grew to maturity, and grains (T1 seeds) were harvested from each plant. Each of these plants contained T-DNA from a vector carrying the wild-type TA1 gene, as confirmed by PCR assays.

[0656] The aleurone phenotype of grains collected from these plants was examined using Evans blue staining. Eight independent transformed plants were tested, and all of them produced grains with normal aleurone, similar to the wild type, indicating positive expression of the introduced gene and, consequently, complementation of the ta1-1 mutation. This ultimately demonstrates that mutations in the TA1 gene lead to the mutant phenotype.

[0657] In a second complementation experiment, and to observe expression from the TA1 promoter, a second genetic construct was prepared and used for transformation. This construct contained a GUS reporter sequence translated and fused to the TA1 protein-coding sequence isolated from the wild-type rice genome. The genetic construct contained a 4,550-nucleotide DNA fragment (nucleotide sequence provided as SEQ ID NO:49), which sequentially contained a 3208 bp upstream sequence believed to contain the TA1 gene promoter, the entire TA1 protein-coding region containing all introns, followed by a GUS reporter gene coding region translated and fused to the C-terminus of the TA1 sequence, and finally a nos3' polyadenylated / transcriptional termination region. This GUS translational fusion was designed to test whether the TA1-GUS fusion protein was expressed and in which tissues of the transformed plant it was expressed.

[0658] As before, this second construct was introduced into TA1-1 plants via Agrobacterium-mediated transformation. GUS activity staining was performed on various tissues of the transformed plants, including developing seeds. The expression patterns of the TA1-GUS fusion gene in the aleurone and embryo of the transgenic plants are shown below. Figure 13 As shown, GUS activity was observed in the aleurone and embryo of developing rice grains from transgenic plants, specifically during days 5–11 of DAP. Strong GUS expression was still observed in the embryo at 18 and 24 DAP, while expression in the aleurone was weaker at these time points. Only very low levels of expression were observed in the endosperm.

[0659] Genetic constructs encoding the TA1-GUS fusion polypeptide controlled by the natural TA1 promoter also supplemented the ta1-1 mutation, resulting in plants with a normal wild-type aleurone phenotype. This further confirms that the mutation identified in ta1-1 plants is responsible for the thick aleurone phenotype. It is also concluded that the GUS fusion C-terminus of the TA1 polypeptide does not impair TA1 function.

[0660] Example 11: Subcellular localization of TA1 protein

[0661] A genetic construct was prepared by translatorily fusing the coding regions of wild-type rice TA1 polypeptide (SEQ ID NO:3) and green fluorescent protein (GFP) in a vector under the control of the CaMV 35S promoter and the nos 3' polyadenylated region / transcription terminator, and was designed for transient expression in plant cells. This construct was then introduced into tobacco leaves to determine the subcellular localization of the fusion protein by its GFP fluorescence. Several days after allowing expression of the introduced fusion gene, the localization of the GFP signal was compared with the localization of mitochondrial-specific staining MitoTracker. Confocal fluorescence microscopy revealed that the TA1-GFP fusion protein expressed by the construct in leaf epidermal cells co-localized with MitoTracker staining. It was concluded that the TA1 protein possesses an N-terminal mitochondrial transport peptide (MTP) that provides mitochondrial localization, consistent with its alternative name OsmtSSB-1a. These data and conclusions are consistent with the analysis regarding the presence of the MTP sequence described in Example 7.

[0662] Example 12: Mitochondrial function and energy homeostasis in ta1 rice aleurone

[0663] Given the mitochondrial localization of the wild-type TA1 protein and its prominent function as an SSB protein in the mitochondria of cells in developing grains, the inventors examined the mitochondria in the aleurone of developing ta1-1 grains. Examination of aleurone cells at 15 DAP using transmission electron microscopy revealed that the mitochondria in the mutant grains exhibited abnormal shape and morphology. Compared to the more elongated shape of wild-type aleurone, the mitochondria were more rounded and lacked the distinct and well-developed internal structures of the same cristae.

[0664] The number of mitochondria in each slice of aleurone cells from 15 DAP caryopsis of ta1-1 and wild-type grains was counted. ATP content in wild-type and ta1-1 aleurone at 11 DAP was also measured. Results ( Figure 14 The results showed that, compared with the wild type, the number of mitochondria in ta1 aleurone cells increased, but the ATP content was significantly reduced.

[0665] Furthermore, when the transcriptome of ta1-1 grains was compared with that of wild-type grains, many genes involved in glycolysis, oxidative phosphorylation, and the citrate cycle were upregulated in ta1-1 grains.

[0666] Based on these data, the inventors concluded that mutations in the TA1 gene lead to mitochondrial dysfunction, which is associated with an increase in the number of mitochondria and the upregulation of genes related to mitochondrial function. This is because the cells of developing grains attempt to compensate for the reduced function of the mutant TA1 gene and the associated mtSSB protein.

[0667] Example 13: Screening for other mutant alleles in the TA1 gene

[0668] To provide additional mutations, including potential knockout (null) mutations in the TA1 gene, CRISPR-Cas9 gene editing was employed as follows. Four separate CRISPR constructs were prepared by modifying the vector pYLCRISPR / Cas9-MH, provided by Dr. Yaoguang Liu (School of Life Science, South China Agricultural University, China). First, four 20-nucleotide regions were identified from the TA1 cDNA nucleotide sequence, each immediately followed by a 3-nucleotide PAM (protospacer adjacent motif) sequence serving as a potential guide RNA (gRNA) target sequence. gRNA targets were selected and designated as CaSG1, CaSG2, CaSG3, and CaSG4, with the aim of generating mutations in the second (g1 and g2), third (g3), and fourth (g4) exons, respectively. The gRNA target constructs were then synthesized, in which the gRNA targets were integrated into the gRNA backbone and driven by a rice U3 promoter. The synthesized DNA was excised using the restriction enzyme BsaI and inserted into the pYLCRISPR / Cas9-MH vector. The synthesized gene construct was then isolated and transformed into Agrobacterium strain EHA105. Transformation in rice was performed using the method described by Nishimura et al. (2006). Transgenic rice plants regenerated from transformed callus. The aleurone phenotype of the mutant plants' seeds was examined by thin sections of mature caryopsis to analyze the number of aleurone layer cells.

[0669] Table 4 lists TA1 mutations in 28 lines comprising at least 13 independent lines generated using the CRISPR / Cas9 method. All these lines have frameshift mutations within the protein-coding region, producing stop codons that lead to premature translation termination and thus null mutations. Importantly, seeds from all mutant lines exhibit a thick aleurone phenotype. Compared to the wild type, some mutant lines also show other phenotypic changes in their grains, including one or more chalky endosperm, reduced seed setting rate, and reduced thousand-grain weight. It is concluded that null alleles in the TA1 gene (SEQ ID NO:1, encoding SEQ ID NO:3 and the homologous TA1 gene) confer thick aleurone and the associated phenotype. Given the current efficiency of gene editing technologies in rice and other cereal plants, gene editing, such as using CRISPR or TALENS, is the preferred method for obtaining the thick aleurone phenotype.

[0670] Table 4: TA1 knockout mutants generated using the CRISPR / Cas9 method

[0671]

[0672] Example 14: TA1 protein is associated with RECA3 and TWINKLE peptides

[0673] SSB proteins play important roles in DNA replication, homologous recombination between closely related or identical chromosomes, and DNA repair. In bacteria, RecA proteins catalyze homologous strand exchange, and SSB proteins may enhance the reaction by stabilizing DNA strand separation. Mitochondrial SSB proteins are thought to play similar roles in the replication and recombination of multiple mitochondrial genomes in plant cells (Edmondson et al., 2005). Mitochondrial DNA replication requires a variety of nuclear-encoded proteins, including DNA polymerases known as plant organ DNA polymerases or POPs (Moriyama and Sato, 2014), primases for synthesizing RNA primers, DNA topoisomerases also known as gyrases, mtSSBs, and helicases also known as TWINKLEs for unwinding double-stranded DNA. The TWINKLE enzyme in plants is located in mitochondria and possesses both primase and helicase activities, capable of synthesizing RNA primers of at least 15 nucleotides in length, which are then extended into high-molecular-weight DNA by E. coli DNA polymerase I (Diray-Arce et al., 2013).

[0674] Multiple mitochondrial chromosomes in angiosperms frequently rearrange and recombine, specifically involving repetitive sequences to produce a variety of sequence duplications, inversions, deletions, and insertions (Gualberto and Newton, 2017). Several nuclear genes are known to control mitochondrial DNA recombination and genome stability. Typically, these genes encode proteins that affect the fidelity of DNA replication, recombination, or repair, and mutants in these genes often lead to the accumulation of recombinant alternative configurations of mitochondrial DNA. These proteins contain recombinases that catalyze chain exchange, similar to RecA in bacteria. Arabidopsis thaliana possesses three RecA-like proteins (RECA1–RECA3) (Shedge et al., 2007). RECA1 is conserved in all plants and targets the plastid. RECA2 is present in flowering plants and mosses and targets both mitochondria and plastids. In contrast, the RECA3 protein targets only mitochondria. In Arabidopsis thaliana, both recA2 and recA3 mutations trigger increased ectopic recombination in medium-sized repetitive sequences. RecA2 mutations are often fatal in early seedling stages, while recA3 knockout plants are usually phenotypically normal in the first generation, but may show effects in offspring.

[0675] Therefore, the inventors tested whether TWINKLE and RECA3 might be involved in the same process as TA1 in rice. The rice TWINKLE and RECA3 sequences were identified from the rice genome sequence using Arabidopsis sequences as a query. The amino acid sequences of the rice proteins, the nucleotide sequences of the genes encoding these proteins, and the nucleotide sequences of the protein-coding sequences of the cDNA of these genes are provided as SEQ ID NO:61-66.

[0676] In a series of experiments, the interaction between TWINKLE and RECA3 proteins and TA1 was demonstrated. In one experiment, split yellow fluorescent protein (YFP) was measured in tobacco leaves by co-transformation with constructs encoding fusion proteins. In each pair, one encoded the N-terminal half of YFP, and the other encoded the C-terminal half. One construct had the chimeric gene p35S:TA1-nYPF, and the other had either p35S:RECA3-cYFP or p35S:TWINKLE-cYPF. Transformed cells were examined under a confocal microscope. Fluorescent spots were observed in the cytoplasm. From this and mitochondrial-specific staining, it was concluded that the TA1 protein interacts with both RECA3 and TWINKLE, and that all three proteins are localized in the mitochondria.

[0677] The in vivo interactions of TA1 with RECA3 and TWINKLE were also demonstrated by immunoprecipitation experiments to specifically recover one of the peptides while co-precipitating the others. For this purpose, the construct p35S:TA1-MYC was co-perfused into tobacco leaves with either the p35S:RECA3-HA construct or the p35S:TWINKLE-HA construct for transient expression of the labeled protein. Total protein was extracted from the perfused tissue and subjected to co-immunoprecipitation, and the resulting protein fractions were analyzed using Western blotting. In another experiment, a luciferase assay was performed in the perfused tobacco leaves to demonstrate that TA1 interacts with both RECA3 and TWINKLE.

[0678] Based on each of these experiments, the inventors concluded that the TA1 protein is associated with RECA3 and TWINKLE proteins, and that these proteins are located in mitochondria.

[0679] Example 15: Downregulation of the RECA3 or TWINKLE gene produces thickened aleurone in rice.

[0680] Given the observations showing that the TA1 protein is associated with RECA3 and TWINKLE in mitochondria, the inventors tested whether reduced expression of genes encoding RECA3 and TWINKLE in rice would also lead to aleurone thickening in the grain. This was tested using RNA interference (RNAi) to reduce the expression of the RecA3 and TWINKLE genes. To prepare RNAi constructs, regions of each of the RecA3 and TWINKLE genes were selected and used to create inverted repeat constructs to express hairpin RNA. These constructs were used using standard methods for Agrobacterium-mediated transformation of wild-type rice, and transformants were selected. As shown by qRT-PCR, plants with reduced gene expression in the grain ( Figure 15 Three strains were selected for each construct.

[0681] When the aleurone thickness of caryopsis from selected lines was examined by microscopy through cross-section and PAS staining, all transgenic caryopsis showed thicker aleurone compared to the wild type. Lines with greater reductions in the RecA3 and TWINKLE genes were more significantly affected, exhibiting thicker aleurone with 2–8 layers in at least some regions. The starch endosperm of the transgenic grains also appeared chalky or opaque.

[0682] Based on these experiments, the inventors developed a model that describes the regulation of energy homeostasis in the aleurone cell layer mediated by the TA1-RECA3 / TWINKLE complex, which inhibits illegal recombination of mtDNA during grain development and thus determines the differentiation of sub-aleurone cell fate, in which cells that form the outermost starch endosperm cells in wild-type grains retain aleurone cell identity, leading to aleurone thickening.

[0683] Example 16: Homologs of the rice TA1 gene in other cereals

[0684] Single-stranded DNA-binding (SSB) proteins play crucial roles in DNA replication, homologous recombination, and DNA repair (Moriyama and Sato, 2014). In bacteria, RecA proteins catalyze homologous strand exchange, and SSB proteins may enhance this reaction (McEntee et al., 1980; Steffen and Bryant, 2001). Plant genes encoding mitochondrial-targeting single-stranded DNA-binding proteins (mtSSBs) have been characterized in Arabidopsis thaliana, providing the earliest direct evidence in plants of the presence of mitochondrial-targeting homologs of RecA, SSBs, or other proteins involved in mitochondrial DNA (mtDNA) recombination (Edmondson et al., 2005).

[0685] SEQ ID NO:3 was used as a lookup. The Arabidopsis SSB genes At4g11060 and At3g18580, hereinafter referred to as AtmtSSB-1 and AtmtSSB-2, respectively, were identified by a BLAST search of the Arabidopsis genome in the Arabidopsis Information Resources (TAIR) database (http: / / www.arabidopsis.org). The AtmtSSB-1 polypeptide showed 66% homology in its amino acid sequence to the full-length sequence of SEQ ID NO:3, while the AtmtSSB-2 polypeptide showed significantly lower homology, at 26% (Table 5). Therefore, Arabidopsis possesses two mtSSB genes. At4g11060 encodes a 201-amino acid protein (SEQ ID NO:15) containing a putative mitochondrial targeting peptide (MTP) of 28 residues. At3g18580 encodes a 217-amino acid protein (SEQ ID NO:31) containing a putative MTP of 23 residues. The model tree species, Populus tomentosa (white poplar), also has two mtSSB sequences, namely PtmtSSB-1 (SEQ ID NO:21) and PtmtSSB-2 (SEQ ID NO:39).

[0686] Two other genes associated with Os05g0509700 (encoding OsTA1 = OsmtSSB-1a) were observed in the rice genome (rice, japonica group), namely Os04g0363700 and Os01g0642900, hereinafter referred to as OsmtSSB-1b and OsmtSSB-2, respectively. These genes were identified by a BLAST search of the rice genome and amino acid sequences in the Rice Genome Annotation Project (RGAP) database (http: / / rice.plantbiology.msu.edu / ). OsmtSSB-1b is sequence-closer to OstmtSSB-1a at 72% homology with the full length of SEQ ID NO:3, while OstmtSSB-2 shows lower homology at 32% homology. Ostmt-SSB-1b is also designated as OsTA1-like or OsTA1L in this paper. Therefore, rice has three mtSSB genes. Like the AtmtSSB protein, all three OsmtSSB peptides possess an SSB domain, and for OsmtSSB-1b, it contains motifs I-IV present in all examined plant TA1 peptide sequences.

[0687] Table 5 provides the amino acid sequence identity of the rice TA1 (OsmtSSB-1a; SEQ ID NO:3) polypeptide with a series of homologous plant polypeptides, as well as the amino acid sequence identity of the homologous plant polypeptides with respect to OsTA1L. Figure 7The alignments of some of these plant sequences are shown. The two dicotyledonous species examined each have only two mtSSB sequences, as do some of the monocotyledonous species, while other monocotyledonous species have three mtSSB sequences, including one sequence most closely related to OsTA1 (at least 80% identical) and another sequence more closely related to OsTA1L. In summary, the plant mtSSB-1 sequence has at least 60% identity with SEQ ID NO:3, while the mtSSB-2 sequence has no more than 32% identity with SEQ ID NO:3.

[0688] Figure 16 A phylogenetic tree showing the correlation of homologs of the TA1 (OsmtSSB-1a) polypeptide from other plant species, primarily cereal species, is provided. In each case, the most homologous amino acid sequence along the full length of SEQ ID NO:3 is at least 60% identical to SEQ ID NO:3. The amino acid sequences used for analysis are provided as SEQ ID NO:15-23 for mtSSB-1 or mtSSB-1a sequences most related to OsTA1, SEQ ID NO:24-29 for mtSSB-1b sequences more closely related to OsTA1L than OsTA1, and SEQ ID NO:30-39 for mtSSB-2 sequences.

[0689] The inventors concluded that plant species possess two or three mtSSB sequences, all of which are expected to be functional, thus providing a degree of functional redundancy. This analysis did not address the tissue specificity of different mtSSB genes.

[0690] Table 5: Amino acid sequence identity between plant homologs and rice TA1 (OsmtSSB-1a) and TA1-like (OsmtSSB-1b).

[0691]

[0692]

[0693] Example 17: Homologs of the rice RECA3 and TWINKLE genes in other plants

[0694] SEQ ID NO:61 (rice RECA3 polypeptide) was used as a query to identify homologous amino acid sequences from various cereals and related monocotyledons, as well as several dicotyledons, using a BLAST search of sequence databases. Due to the high sequence conservation of RECA3 polypeptides across different plant species, homologous sequences were readily identified. The length of the polypeptides, including the N-terminal signal sequence for mitochondrial or plastid translocations, ranged from 425 to 435 amino acid residues (Table 6). Corresponding cDNA sequences encoding these RECA3 proteins were also identified (Table 6). Cereal and grass RECA3 polypeptides were at least 80% identical in amino acid sequence to the full length of SEQ ID NO:61, while the RECA3 polypeptides from dicotyledons showed lower homology, ranging from 67 to 72% with SEQ ID NO:61. Each amino acid in the sequence was presumed to contain a mitochondrial targeting peptide (MTP) predicted to be cleaved when the polypeptide translocates to the mitochondria.

[0695] The inventors concluded that the wild-type RECA3 sequence of plant species is functional in mitochondria and can be modified by mutagenesis or by downregulation through silent RNA.

[0696] SEQ ID NO:64 (rice TWINKLE polypeptide) was used as a lookup, and homologous amino acid sequences from various monocotyledonous and dicotyledonous plants were also identified via BLAST searches of sequence databases. Again, due to the high sequence conservation of the TWINKLE polypeptide across different plant species, homologous sequences were readily identified. The length of the polypeptide, including the N-terminal signal sequence of mitochondrial or plastid translocations, ranges from 695 to 761 amino acid residues (Table 7). Corresponding cDNA sequences of the genes encoding these RECA3 proteins were also identified (Table 7). For many of these plant species, multiple cDNA sequences were identified, which may indicate alternative splicing of transcripts from the genes. The cereal and grass RECA3 polypeptides were at least 77% identical in amino acid sequence to the full length of SEQ ID NO:64, while the RECA3 polypeptides from dicotyledonous plants showed lower homology, ranging from 67% to 75% with SEQ ID NO:64. Each amino acid in the sequence is presumed to contain at its N-terminus a mitochondrial-targeting peptide (MTP) that is predicted to be cleaved when the polypeptide is translocated to the mitochondria.

[0697] Figure 17A phylogenetic tree illustrating the correlations of homologs of the rice TWINKLE polypeptide from other plant species, including cereal species, is provided. In each case, the most homologous amino acid sequence along the full length of SEQ ID NO:64 is at least 60% identical to SEQ ID NO:64. The inventors conclude that the plant species possess a wild-type TWINKLE sequence that functions in mitochondria.

[0698] Table 6: Identification of RECA3 homologs in a range of plant species.

[0699]

[0700]

[0701] Table 7: Identification of TWINKLE homologs in a range of plant species.

[0702]

[0703] Example 18: Breeding of black rice with the ta1 mutation

[0704] "Black rice" is the term used to describe rice grains that contain anthocyanins, specifically the outer layer of the bran and husk that colors them. These pigments are actually a deep purple, not black, but high concentrations make the grains appear black or dark gray. These pigments are considered powerful antioxidants with a variety of health benefits (Yao et al., 2013).

[0705] To introduce the ta1 mutant allele into different genetic backgrounds, the black rice variety Zixiangnuo 1306 was initially selected as the recurrent parent. This variety is a japonica rice and is wild-type for the TA1 gene. It is suitable for growing in northern regions of China and exhibits good cold tolerance, salt tolerance, and disease resistance. At maturity, Zixiangnuo 1306 has approximate...

Claims

1. A rice grain processed to prevent germination, the grain comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide with reduced level and / or activity relative to the level and / or activity of a polypeptide in a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, wherein the grain comprises a genetic variation that reduces the level and / or activity of the at least one mitochondrial polypeptide in the grain relative to the level and / or activity of the polypeptide in the corresponding wild-type rice grain, and wherein the grain has a thickened aleurone relative to the corresponding wild-type rice grain.

2. The grain according to claim 1, wherein the genetic variation includes: (i) A mutation in an endogenous gene encoding the mitochondrial polypeptide, thereby reducing the level and / or activity of the mitochondrial polypeptide; or (ii) An exogenous polynucleotide encoding a silent RNA molecule, wherein the silent RNA molecule and / or a processed RNA molecule derived from the silent RNA molecule reduces the expression of the endogenous gene, and wherein the exogenous polynucleotide includes a DNA region encoding the silent RNA molecule, the DNA region being operatively linked to a promoter expressed in a developing grain of rice.

3. The grain according to claim 1, wherein the genetic variation includes: (a) A splicing site mutation that produces a reduced splicing of the RNA transcript encoding the endogenous gene encoding the mitochondrial polypeptide; (b) Deletion or insertion within the endogenous gene encoding the mitochondrial polypeptide; (c) Premature translation stop codons in the protein-coding region of the endogenous gene encoding the mitochondrial polypeptide; (d) A mutation in the endogenous gene encoding the mitochondrial polypeptide, such that it encodes a polypeptide with reduced activity relative to the wild-type polypeptide; or (e) A mutation in the endogenous gene encoding the mitochondrial polypeptide, such that when the gene with the mutation is expressed, the level of the polypeptide produced is reduced relative to the corresponding wild-type gene.

4. The grain according to claim 3, wherein the splice site mutation is a single nucleotide substitution at the splice site.

5. The grain according to claim 4, wherein the single nucleotide substitution at the splice site is an adenine nucleotide at a location corresponding to nucleotide number 2126 of SEQ ID NO:

4.

6. The grain according to claim 1, wherein the genetic variation is an introduced genetic variation.

7. The grain according to claim 1, wherein it is homozygous for the genetic variation.

8. The grain according to claim 1, which has a thickened aleurone layer on the 20th day after pollination.

9. The grain according to claim 1, wherein the thickened aleurone comprises at least two layers of cells.

10. The grain according to claim 1, wherein the thickened aleurone comprises at least three layers of cells.

11. The grain according to claim 1, wherein the thickened aleurone comprises at least four layers of cells.

12. The grain according to claim 1, wherein the thickened aleurone comprises at least five cell layers.

13. The grain according to claim 1, wherein the thickened aleurone comprises 3, 4, 5, or 6 layers of cells.

14. The grain according to claim 1, wherein the thickened aleurone comprises 2-8 layers of cells.

15. The grain according to claim 1, wherein the thickened aleurone comprises 2-7 layers of cells.

16. The grain according to claim 1, wherein the thickened aleurone comprises 2-6 layers of cells.

17. The grain according to claim 1, wherein the thickened aleurone comprises 2-5 layers of cells.

18. The grain according to claim 1, wherein the thickened aleurone comprises 3-5 layers of cells.

19. The grain according to claim 1, wherein the thickened aleurone comprises a plurality of cell layers between 2 and 8 layers.

20. The grain according to claim 1, wherein the thickened aleurone comprises a plurality of cell layers between 2 and 7 layers.

21. The grain according to claim 1, wherein the thickened aleurone comprises a plurality of cell layers between 2 and 6 layers.

22. The grain according to claim 1, further characterized in that: (a) When compared with a corresponding wild-type rice grain, the grain comprises, respectively, by weight: i) Higher fat content, ii) Higher ash content, iii) Higher fiber content, iv) Lower starch content, v) Higher mineral content, vi) Higher antioxidant content, vii) Higher phytate content viii) Higher levels of vitamin B3, B6, or B9, or any combination of vitamins B3, B6, and B9. ix) Higher sucrose content, x) Higher content of neutral non-starch polysaccharides, xi) Higher monosaccharide content, or Any combination of xii)i) to xi); (b) When compared with the corresponding wild-type cereal grains, the grains include a higher degree of chalkiness; (c) When compared with the corresponding wild-type cereal grain, the grain comprises a greater number of aleurone cells; (d) The grains are whole grains or broken grains; (e) When compared with the corresponding wild-type rice grains, the grains have irregularly shaped starch granules that are more loosely packed; (f) When compared with a corresponding wild-type rice grain, the grain has the same length, width, thickness, protein level, or caryopsis morphology, or any combination thereof; or Any combination of (h)(a) to (f).

23. The grain according to claim 1, which has been processed by heat treatment.

24. The grain according to claim 23, which has been cooked.

25. The grain according to claim 1, wherein the polypeptide is expressed in the developing endosperm, seed coat, aleurone, or embryo of the developing grain, or any combination thereof.

26. The grain according to claim 1, wherein the outer layer is colored.

27. The grain according to claim 1, wherein it is brown rice grain.

28. The grain according to claim 1, wherein it is a black rice grain.

29. The grain according to claim 1, wherein the mtSSB polypeptide is the mtSSB-1a polypeptide.

30. The grain according to claim 1, comprising an endogenous gene encoding a truncated mtSSB-1a polypeptide.

31. The grain according to claim 30, wherein the truncated mtSSB-1a polypeptide comprises an amino acid sequence selected from: SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO:

10.

32. The grain according to claim 1, wherein the reduced mtSSB activity is: i) Reduced ability to bind to single-stranded DNA; ii) Reduced ability to bind to RECA3 peptides; iii) Reduced ability to bind to TWINKLE peptides, or Any combination of iv)(i)(iii).

33. The grain according to claim 1, wherein the reduced RECA3 polypeptide activity is one or both of the following: i) Reduced ability to bind to mtSSB peptides; and ii) Reduced recombinase activity.

34. The grain according to claim 1, wherein the reduced TWINKLE peptide activity is one or both of the following: i) Reduced ability to bind to mtSSB peptides; and ii) Decreased helicase activity.

35. The grain according to claim 1, wherein it is a cooked grain.

36. The grain according to claim 1, wherein it is a broken grain.

37. The grain according to claim 1, wherein it is a milled grain.

38. A method for producing rice cells, the method comprising the following steps: Introduce the genetic variation as defined in any one of claims 1 to 6 into rice cells.

39. A method for producing rice plants or grains derived from said rice plants, the method comprising the following steps: i) Introducing a genetic variation as defined in any one of claims 1 to 6 into rice plant cells; ii) Obtaining rice plants containing the genetic variation or polynucleotide from the cells obtained in step i); and iii) Optionally, grains are collected from the plant of step ii), the grains comprising the genetic variation or being transgenic to the polynucleotide, nucleic acid construct, or vector; and iv) Optionally, one or more generations of progeny plants are produced from the grain, said progeny plants comprising the genetic variations or being transgenic to the polynucleotide, nucleic acid construct, or vector. This produces the rice plant or grains.

40. A method for producing rice plants or grains derived from said rice plants, the method comprising the steps of: i) Introducing a mutation into an endogenous gene encoding a mitochondrial single-stranded DNA binding (mtSSB) peptide, a RECA3 peptide, or a TWINKLE peptide into rice plant cells, such that the level and / or activity of the mitochondrial single-stranded DNA binding (mtSSB) peptide, a RECA3 peptide, or a TWINKLE peptide in the cells are reduced relative to the level and / or activity of the peptide in the corresponding wild-type rice plant cells. ii) Obtaining a rice plant from the cells of step i), the rice plant comprising the mutation of the endogenous gene, and producing rice grains with thickened aleurone relative to rice grains containing the corresponding wild-type rice plant cells; and iii) Optionally, grains are collected from the plant of step ii), the grains comprising the mutation; and iv) Optionally, one or more generations of progeny plants are produced from the grain, the progeny plants including the mutation. This produces the rice plant or grains.

41. A method for selecting rice plants, the method comprising the following steps: i) Screening for rice plant populations or rice grain populations, each of which is obtained from mutagenesis of rice plant progenitor cells, grains, or plants for the production of grains that, compared to corresponding wild-type rice grains, contain mutations in genes encoding mitochondrial single-stranded DNA-binding (mtSSB) peptides, RECA3 peptides, or TWINKLE peptides, and thickened aleurone; and ii) Select rice plants from the population of step (i) that produce the grains. Therefore, the rice plant was selected.

42. A method for selecting rice plants, the method comprising the following steps: i) Producing one or more offspring plants from rice grains, wherein the rice grains are derived from a hybrid of two parent rice plants; ii) Screening one or more progeny plants from step i) for producing grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, and wherein the aleurone is thickened relative to the corresponding wild-type rice grain; and iii) Select the progeny plants that produce the grains, Therefore, the rice plant was selected.

43. The method of claim 42, wherein step ii) comprises: i) Analyze the genetic variation of samples including DNA from progeny plants; ii) Analyze the thickness of the aleurone in the grains obtained from the offspring plants; iii) Analyze the nutritional content of the grain or a portion thereof; or Any combination of iv)(i)(iii).

44. The method of claim 42, wherein step iii) comprises: i) Select offspring plants that are homozygous for genetic variation; ii) Select progeny plants whose grain aleurone thickness is increased compared to the corresponding wild-type rice grain; iii) Select progeny plants in which the nutrient content of their grains or a portion thereof has changed compared to the nutrient content of the corresponding wild-type rice grains or a portion thereof, or Any combination of iv)(i)(iii).

45. A method for identifying rice plants that produce grains, said grain comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or with reduced activity relative to a corresponding wild-type rice grain, wherein said mitochondrial polypeptide at a reduced level and / or with reduced activity is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, said method comprising the steps of: i) Obtaining nucleic acid samples from rice plants; as well as ii) Screening the samples for the presence or absence of genetic variations that, when compared to the activity levels of peptides in the corresponding wild-type rice plants, reduce the activity levels of mitochondrial single-stranded DNA-binding (mtSSB) peptides, RECA3 peptides, or TWINKLE peptides in the plants, wherein the presence of the genetic variation indicates that the rice grains of the rice plant have thickened aleurone when compared to the corresponding rice plants lacking the genetic variation.

46. ​​The method of claim 45, wherein the genetic variation is one or both of the following: a) A nucleic acid construct expressing a polynucleotide, or a polynucleotide encoded therefrom, which, when present in rice plants, reduces the expression of genes encoding mitochondrial single-stranded DNA-binding (mtSSB) peptides, RECA3 peptides, or TWINKLE peptides; and b) A mutant mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide whose expression activity is reduced, either of the gene or the mRNA encoded therefrom.

47. The method of claim 46, wherein the mutant is truncated.

48. A method for identifying rice plants that produce grains, said grain comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or with reduced activity relative to a corresponding wild-type rice grain, wherein said mitochondrial polypeptide at a reduced level and / or with reduced activity is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, said method comprising the steps of: i) Obtain grains from rice plants; as well as ii) Screen the grain or a portion thereof for the thickened aleurone and one or both of the following: a) The amount and / or activity of the mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide in the grain; and b) The amount of mRNA encoded by the gene encoding the mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, or TWINKLE polypeptide in the grain.

49. A method for producing processed rice grains or flour, bran, starch, or oil obtained from rice grains, said method comprising: a) Obtaining rice grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, wherein the grain includes genetic variation that, relative to a corresponding wild-type rice grain, reduces the level and / or activity of the at least one mitochondrial polypeptide in the grain, and wherein, relative to a corresponding wild-type rice grain, the grain has a thickened aleurone; and b) Process the grains to produce processed grains, flour, bran, starch, or oil.

50. A product derived from rice grains processed to prevent germination, the grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, wherein the grain includes a genetic variation that reduces the level and / or activity of the at least one mitochondrial polypeptide in the grain relative to a corresponding wild-type rice grain, and wherein the grain has a thickened aleurone relative to the corresponding wild-type rice grain, and wherein the grain is a cooked, refined, cracked, puffed, milled, or flaked grain or bran, wherein the product is a food ingredient or food product.

51. The product according to claim 50, wherein... i) The food or beverage ingredient is selected from the group consisting of: roasted grains, refined grains, broken grains, puffed grains, milled grains, hulled grains, flour, bran, starch, and oil, or ii) The food is selected from the group consisting of: processed grains, porridge, fermented or unfermented bread, noodles, animal feed, breakfast cereals, snack foods, pastries and foods containing flour-based sauces.

52. The product of claim 50, wherein the food is cooked grain.

53. The product of claim 50, wherein the food is cooked grain.

54. The product of claim 50, wherein the food is pasta.

55. The product of claim 50, wherein the food is a cake.

56. A product derived from rice grains, said grains being processed to prevent them from germinating, said grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein said mitochondrial polypeptide at a reduced level and / or activity is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, said grains comprising genetic variations that reduce the level and / or activity of said at least one mitochondrial polypeptide in said grains relative to a corresponding wild-type rice grain, and wherein said grains have a thickened aleurone relative to a corresponding wild-type rice grain, and wherein said grains are cooked, refined, cracked, puffed, milled, or delaminated grains or bran, said product being a beverage ingredient or beverage product.

57. The product of claim 56, wherein the beverage product is a packaged beverage.

58. The product of claim 56, wherein the beverage product comprises ethanol.

59. A method for preparing a food ingredient, the method comprising processing rice grains, or processing bran, flour, starch, or oil from said rice grains, to produce said food ingredient, said grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein said mitochondrial polypeptide at a reduced level and / or activity is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, wherein said grains include genetic variations that reduce the level and / or activity of said at least one mitochondrial polypeptide in said grains relative to a corresponding wild-type rice grain, and wherein said grains have thickened aleurone relative to a corresponding wild-type rice grain.

60. A method for preparing a beverage ingredient, the method comprising processing rice grains, or processing bran, flour, starch, or oil from said rice grains, to produce said beverage ingredient, said grains comprising aleurone, embryo, starch endosperm, and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein said mitochondrial polypeptide at a reduced level and / or activity is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide, and TWINKLE polypeptide, wherein said grains include genetic variations that reduce the level and / or activity of said at least one mitochondrial polypeptide in said grains relative to a corresponding wild-type rice grain, and wherein said grains have thickened aleurone relative to a corresponding wild-type rice grain.

61. A method of preparing a food product, the method comprising processing rice grains, or mixing the rice grains or bran, flour, starch or oil from the rice grains with another food, the grains comprising aleurone, embryo, starch endosperm and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide and TWINKLE polypeptide, wherein the grains include genetic variations that reduce the level and / or activity of the at least one mitochondrial polypeptide in the grains relative to a corresponding wild-type rice grain, and wherein the grains have a thickened aleurone relative to a corresponding wild-type rice grain.

62. A method of preparing a beverage product, the method comprising processing rice grains, or mixing the rice grains or bran, flour, starch or oil from the rice grains with another beverage ingredient, the grains comprising aleurone, embryo, starch endosperm and at least one mitochondrial polypeptide at a reduced level and / or activity relative to a corresponding wild-type rice grain, wherein the reduced level and / or activity of the mitochondrial polypeptide is at least one of mitochondrial single-stranded DNA-binding (mtSSB) polypeptide, RECA3 polypeptide and TWINKLE polypeptide, wherein the grains include genetic variations that reduce the level and / or activity of the at least one mitochondrial polypeptide in the grains relative to a corresponding wild-type rice grain, and wherein the grains have a thickened aleurone relative to a corresponding wild-type rice grain.

Images