Dexras1 inhibitors and uses thereof

Abstract

The application discloses a DEXRAS1 inhibitor and application thereof, and belongs to the field of biomedicine. The application provides application of the DEXRAS1 inhibitor in preparation of a drug for preventing or treating nervous system diseases such as depression, stroke and epilepsy. Specifically, the Dexras1 inhibitor can be a small molecule compound capable of inhibiting Dexras1 expression or activity, RNA or a precursor thereof interfering with Dexras1 expression, Dexras1 protein or a coding sequence thereof reducing Dexras1 and CAPON coupling, or a specific antibody of Dexras1.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to DEXRAS1 inhibitors, their preparation methods, and applications. Background Technology

[0002] Neurological disorders, due to their high rates of disability and mortality, have become a global public health challenge. However, limited by the complexity of the nervous system, our understanding of the pathogenesis of various neurological diseases remains incomplete, and safe and rapidly effective drugs for treating these diseases are still scarce. The essence of the pathological process of neurological diseases lies in the stress-induced changes in the nervous system under pathological conditions, namely, changes in neural plasticity. Chronic stress, such as prolonged adverse environments or negative life events, is a significant contributing factor to many neurological diseases. It affects neural plasticity processes (such as neuronal proliferation and survival, synaptic structural and functional plasticity), leading to neurological disorders such as anxiety, depression, stroke, and epilepsy. Furthermore, chronic stress, as an important research model for psychosomatic disorders, is also a significant contributing factor to diseases such as cancer, cardiovascular disease, and obesity.

[0003] Currently, medications used to treat depression, such as imipramine, amitriptyline, citalopram, and venlafaxine, generally have a significant problem with slow onset of action, often requiring a month or even longer to exert their therapeutic effect, and some patients also experience non-responsiveness. These medications also come with adverse reactions such as nausea, drowsiness, and sexual dysfunction. Therefore, finding new medications with fewer side effects and faster onset of action is an urgent clinical problem to be solved.

[0004] Dexras1, also known as RASD1, is a member of the small G-protein Ras family. It possesses GTPase activity and is named for its production induced by the stress hormone dexamethasone. It is closely related to chronic stress and neural plasticity. Current technologies do not reveal the application of Dexras1 in neurological disorders such as depression, stroke, and epilepsy, or other diseases related to chronic stress; in other words, these diseases lack relatively effective therapeutic targets. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention proposes a DEXRAS1 inhibitor and its application.

[0006] The objective of this invention can be achieved through the following technical solutions: A first aspect of the invention relates to the use of DEXRAS1 inhibitors in the preparation of medicaments for the prevention or treatment of neurological diseases.

[0007] Optionally, the inhibitor is: One or more of the following: small molecule compounds that can inhibit Dexras1 expression and / or activity, RNA or precursors that interfere with Dexras1 expression, Dexras1 protein or its coding sequence that reduces Dexras1 and CAPON coupling, or Dexras1-specific antibodies.

[0008] Optionally, the RNA is Dexras1-RNAi, and its sequence is: 5'- GCTCAAACAGCAGATCCTAGA -3' (SEQ ID No.1); 5'-GCTGGTCATTTGCGGTAACAA -3' (SEQ ID No. 2); 5'- GCGTTGTGCCTACTTCGAGAT -3' (SEQ ID No.3); 5'-GCAAGGTATCTGTGCAGTACT-3' (SEQ ID No. 4).

[0009] Optionally, the Dexras1 protein sequence that reduces the coupling between Dexras1 and CAPON is the full length or part of amino acids 235-280 selected from the amino acid sequence of SEQ ID NO.5; the coding sequence is SEQ ID NO.6.

[0010] Optionally, the small molecule compound is: , , , , One or more of them.

[0011] Optionally, the specific antibody for Dexras1 is a polyclonal antibody or a monoclonal antibody.

[0012] Optionally, the neurological disorders include depression, stroke, and epilepsy.

[0013] A second aspect of the invention relates to a medicament for the prevention or treatment of neurological disorders, including a DEXRAS1 inhibitor. Attached Figure Description

[0014] The invention will now be further described with reference to the accompanying drawings.

[0015] Figure 1This study describes the expression of Dexras1 in the hippocampus of mice exposed to chronic stress and the coupling between Dexras1 and CAPON in Example 2 of this application. (A) Western blot analysis showed that Dexras1 expression in the hippocampus of depressed and anxious mice induced by chronic mild stress (CMS) was significantly higher than that in the control group; (B) qPCR analysis showed that the level of Dexras1 mRNA in the hippocampus of depressed and anxious mice induced by CMS was increased. All data are expressed as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 compared with the control group.

[0016] Figure 2 In Example 2 of this application, the CO-IP experiment showed that the coupling between Dexras1 and CAPON in the hippocampus of CMS-induced depressed and anxious mice was significantly higher than that in the control group.

[0017] Figure 3 This study provides in vitro validation of the knockout efficiency of different Dexras1 shRNA sequences in Example 4 of this application. Western blotting was used to detect the knockout efficiency of Dexras1 in hippocampal tissue by different shRNA sequences. The knockout efficiency was: Dexras1-shRNA-2 > Dexras1-shRNA-3 > Dexras1-shRNA-4 > Dexras1-shRNA-1.

[0018] Figure 4 To verify the decoupling efficiency of the Dexras1-CAPON decoupling agent in Example 5 of this application, immunoprecipitation combined with Western blotting was used to detect that the decoupling agent AAV-Dexras1-46C-GFP significantly reduced the interaction between Dexras1 and CAPON in hippocampal tissue.

[0019] Figure 5 In Example 4 of this application, downregulating Dexras1 expression in hippocampal neurons effectively alleviated anxiety and depressive symptoms. (AC) Interference with Dexras1 expression in hippocampal neurons reversed the anxiety phenotype induced by chronic mild stress (CMS) in mice during the elevated cross maze test. (D) Interference with Dexras1 expression in hippocampal neurons reversed the depressive phenotype induced by CMS in mice during the forced swimming test.

[0020] Figure 6To demonstrate the effectiveness of blocking hippocampal Dexras1-CAPON coupling in alleviating anxiety and depressive symptoms in Example 6, the following steps were taken: (AB) AAV-Dexras1-46C was introduced into the hippocampus of mice to block the coupling between hippocampal Dexras1 and CAPON. (CE) Blocking hippocampal Dexras1-CAPON coupling reversed the anxiety phenotype induced by chronic mild stress (CMS) in mice during the elevated cross maze test. (F) Blocking hippocampal Dexras1-CAPON coupling reversed the depressive phenotype induced by CMS in mice during the forced swimming test.

[0021] Figure 7 Example 7 of this application demonstrates that the small molecule compound effectively alleviates symptoms of depression and anxiety by inhibiting Dexras1 activity. (A) Effect of the small molecule compound on Dexras1 activity. (BD) Inhibition of Dexras1 activity induces anxiolytic-like phenotypes in mice during the elevated cross maze test. (E) Inhibition of Dexras1 activity induces anxiolytic-like phenotypes in mice during the forced swimming test.

[0022] Figure 8 Example 7 of this application shows that the small molecule compound inhibiting Dexras1 exerts its antidepressant effect more quickly than fluoxetine. (A) ZW-005 exerts its antidepressant effect after 7 days of administration; (B) Fluoxetine reverses CMS-induced depressive behavior after 28 days of administration.

[0023] Figure 9 Example 7 of this application demonstrates that the small molecule compound ZW-005 effectively inhibits Dexras1 activity and alleviates neurological dysfunction caused by stroke. (A) Improvement of cerebral ischemia symptoms in model mice by the small molecule compound ZW-005; (B) Significant reduction of foot defects in model mice by the small molecule compound ZW-005; (C) Significant improvement of learning and memory impairment caused by cerebral ischemia by the small molecule compound ZW-005.

[0024] Figure 10 Example 7 of this application shows that the small molecule compound inhibits Dexras1 activity and effectively alleviates PTZ-induced epilepsy. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Chronic Mild Stress Model and Behavioral Testing In one example of this disclosure, a non-human animal experimental model and its experimental method are disclosed, specifically, for example, a mouse experimental model, and the experimental steps are as follows.

[0027] First, adult (6-8 weeks old) ICR mice were used for behavioral testing: 5 mice per cage, with a 12-hour light-dark cycle (7 am to 7 pm with light). All mice had free access to a stable supply of water and food, and all animal experiments were approved by the Southeast University Animal Protection and Use Committee.

[0028] A chronic mild stress model was constructed, which can be established by a 4-week stress treatment including water deprivation, fasting, activity restriction, wet cage, inclined cage, day-night reversal, and forced swimming. 24 hours after the last modeling, the elevated cross maze (EPM) and forced swimming test (FST) were performed. 24 hours after the test, hippocampal tissue was harvested for expression level analysis.

[0029] The behavioral experiments used in this invention to assess depressive behavior include, but are not limited to, the forced swimming test.

[0030] In this example, the diameter of the forced swimming cylindrical apparatus for mice was 12 cm and the height was 25 cm. The test water depth was 14 cm, and the water temperature was 23-24℃. A camera recorded the mice's swimming over 6 minutes from the side. A double-blind method was used to count the immobility time of the mice in the last 5 minutes after swimming for 6 minutes, i.e., the time when the animals were in a floating posture or when their limbs were completely inactive.

[0031] All data in this example are expressed as mean ± SEM. For all behavioral data, two-tailed student's t-tests or one-way ANOVA followed by Tukey's post hoc test were used.

[0032] Example 2: CO-IP, Western Blotting, and qPCR Analysis Mice were anesthetized with isoflurane, and their brains were harvested by decapitation. Hippocampal tissue was rapidly separated on ice and frozen at -80°C. Samples were placed in RIPA lysis buffer, the composition of which included, for example, 20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% NP-40, 1% sodium deoxycholate, 1 mM PMSF, 10 μg / ml aprotinin, 1 μg / ml pepstatin A, and 1 μg / ml leupeptin. After tissue lysis, the supernatant was collected by centrifugation at 12000 rpm for 15 min. Protein concentration was determined using the BCA method, and 15-20 μg of protein was loaded per well. Separation was performed by electrophoresis on a 10% SDS-PAGE gel, and Western blotting was performed on a PVDF membrane. The primary antibodies used were anti-Dexras1 (1:4000, Millipore) and anti-Tubulin (1:40000, Abcam). Statistical analysis of the immunoblotting results was performed using ImageJ software.

[0033] Next, nNOS (BD) antibody was added to the supernatant of hippocampal tissue protein extracted using the above method, and the mixture was incubated overnight at 4°C with shaking. The following day, Protein G-agarose beads were added to the protein supernatant and incubated at 4°C for 10 h. After centrifugation at 5000 rpm, the protein supernatant was aspirated, and the agarose bead-protein-antibody complex was resuspended in 1×PBS and washed 5-6 times. Finally, the mixture was centrifuged at 5000 rpm, the supernatant was discarded, and the complex was resuspended in 50 μl of 1×PBS, added with 5× loading buffer, and denatured in a 100°C water bath for 10 min for Western blotting analysis.

[0034] Mice were anesthetized and decapitated. The hippocampus was quickly removed on ice and placed in an EP tube. 400 μL of RNA-easy (Novizan) was added, and the mixture was homogenized in a tissue homogenizer. Then, 300 μL of RNA-easy was added, the tube was inverted, and 300 μL of DEPC water was added. The mixture was incubated on ice for 5 min. After centrifugation at 12000 rcf, 2 ml of the supernatant was transferred to an EP tube, and isopropanol was added at a 1:1 ratio. The mixture was gently mixed and incubated at -20°C for 30 min before centrifugation. The supernatant was removed, and the precipitate was resuspended in 1 ml of 75% ethanol (prepared with DEPC water). After centrifugation at 8000 rcf, the supernatant was discarded, and the mixture was washed once more. The powder was then discarded and dried. 20 μL of DEPC water was added to dissolve the powder, and the RNA concentration was determined. Genomic DNA was then removed using a Novizan reverse transcription kit, followed by reverse transcription. The resulting cDNA was amplified by PCR according to the following reaction system: The primers used are: Dexras1-Forward: TGTCGCGCTTCCTCACG Dexras1-Reverse: CACCAGAATGAAAACGTCTCCTGTG Example 3: Stereotactic Injection of the Brain Mice were anesthetized with isoflurane and fixed in a stereotaxic apparatus (RWD). 1 μL of Tat-Dexras1-46C or Dexras1-shRNA was injected into each mouse's hippocampus. The hippocampal stereotaxic coordinates were (Bregma: -2.3 mm (AP), ±1.4 mm (ML), -2.1 mm (DV)). The injection was administered slowly using a Reward microsyringe (100 nL / min), with the needle left in place for 5 minutes after injection, followed by slow removal of the needle over another 5 minutes. After the drug administration time was reached, behavioral experiments and subsequent histochemical analyses were performed.

[0035] Example 4: Construction of Dexras1-RNAi viral vector In some examples disclosed herein, the expression level of Dexras1 protein in the hippocampus of CMS model mice can be downregulated by using short hairpin RNA (shRNA) of Dexras1 expressed by AAV8 virus. Specifically, the following steps can be taken.

[0036] The four Dexras1 interfering RNAs constructed according to the table below, namely SEQ ID No. 1~4, were cloned into the WX231-L vector: 5'- CACCGCTCAAACAGCAGATCCTAGAACATCGAATCTAGGATCTGCTGTTTGAGC -3' (SEQID No.1) 5'- CACCGCTGGTCATTTGCGGTAACAAACATCGAATTGTTACCGCAAATGACCAGC -3' (SEQID No.2) 5'- CACCGCGTTTGCCTACTTCGAGATACATCGAAATCTCGAAGTAGGCACAACGC -3' (SEQID No.3) 5'- CACCGCAAGGTATCTGTGCAGTACTACATCGAAAGTACTGCACAGATACCTTGC -3' (SEQID No.4) Dexras1-shRNA was packaged into an AAV virus and used in experiments to downregulate Dexras1 function.

[0037] First, the packaged viral AAV-hSyn-Dexras1-shRNA-GFP (Dexras1-shRNA-1-4) and the control viral AAV-hSyn-GFP were injected into the hippocampus of adult male ICR mice. After 3 weeks of expression, hippocampal tissue was taken for Dexras1 expression level analysis to verify the interference efficiency of different Dexras1-shRNAs.

[0038] Subsequently, using stereotaxic techniques, AAV-hSyn-Dexras1-shRNA-GFP (Dexras1-shRNA-2) and AAV-hSyn-GFP control viruses were injected into the hippocampus of adult male ICR mice. After a one-week recovery period, CMS modeling was established. Behavioral tests were performed 24 hours after the final modeling event, and hippocampal tissue was harvested 24 hours after the tests for expression level analysis.

[0039] Example 5: Construction of Dexras1-CAPON decoupling agent In some examples of this disclosure, anxiety and depressive symptoms can be effectively alleviated by blocking the coupling between Dexras1 and CAPON. For example, this can be achieved by designing to identify the key amino acid sequence that couples Dexras1 with CAPON, and then constructing the desired small peptide or its encoding sequence.

[0040] Using stereotaxic techniques, AAV-Dexras1-46C-GFP decoupling agent and control virus were injected into the hippocampus of adult male ICR mice. After 3 weeks of expression, hippocampal tissue was harvested for CO-IP to verify its decoupling efficiency.

[0041] Subsequently, AAV-Dexras1-46C-GFP uncoupling agent and control virus were injected into the hippocampus of adult male ICR mice. After a one-week recovery period, CMS modeling was initiated. Behavioral tests were performed 24 hours after the final modeling step. Hippocampal tissue was then harvested 24 hours after the tests for expression level analysis.

[0042] Example 6: Construction of small molecule compounds to inhibit Dexras1 activity In some examples disclosed herein, small molecule compounds can be constructed to alleviate anxiety and depression phenotypes in mice, with the following structures: ZW-001 ZW-002 ZW-003 ZW-004 ZW-005 Specifically, the aforementioned small molecule compounds were injected via tail vein into adult male ICR mice for 7 consecutive days. Behavioral tests were conducted 24 hours later. Hippocampal tissue was removed 24 hours after the tests for expression analysis and Dexras1 activity determination. Alternatively, small molecule compounds inhibiting Dexras1 activity were injected 2 hours after the cerebral ischemia model was restored, and the effect on improving cerebral ischemia symptoms was observed 24 hours later. Or, small molecule compounds were injected via tail vein for 7 consecutive days after the 2-hour restoration of perfusion, and the effect on neurological dysfunction caused by cerebral ischemia was observed. Or, small molecule compounds inhibiting Dexras1 activity were injected 24 hours before the PTZ-induced epilepsy model mice, and the effect on improving epilepsy symptoms was observed.

[0043] Example 7: Determination of Dexras1 activity In this embodiment, the biotinylation method was used to determine the nitrosylation level of Dexras1 protein to reflect Dexras1 activity. This method mainly includes the following steps: (1) Sample preparation: Mouse brain tissue was quickly removed and placed in 430 μl of lysis buffer on ice for 30 min, centrifuged at 12000g for 15 min, and 400 μl of supernatant was collected and stored at -80℃. Lysis buffer: 400 μl HEN buffer + 1% NP40 + 1% PMSF (0.1M stock solution).

[0044] (2) Blocking: The purpose of this step is to allow the thiol groups in the cysteine ​​residues of the protein to react with MMTS (methylmethanethiosulfonate) to form disulfide bonds. Transfer 380 μl of supernatant to a 10 ml centrifuge tube, add 1420 μl of HEN buffer to bring the protein concentration to ≤0.8 μg / μl. Add 0.2 ml of 25% SDS and 20 μl of MMTS. Incubate at 50℃ and 250 rpm in the dark for 30 min.

[0045] (3) Precipitation: Add 6 ml of ice-cold acetone, precipitate at -20℃ for 20 min, centrifuge at 8000g for 5 min, and discard the supernatant. Wash 3 times with ice-cold acetone, 5 ml each time.

[0046] (4) Reduction labeling: This step mainly involves reducing -SNO to -SH using sodium ascrobate and biotin-HPDP for biotin labeling. The solution was resuspended in 240 μl HENS buffer and transferred to a 1.5 ml EP tube. 30 μl biotin-HPDP (2.5 mg / ml) and 30 μl 200 mM sodium ascorbate (final concentration 20 mM) were added, and the reaction was carried out at 30 ℃ and 250 rpm in the dark for 1 h.

[0047] (5) Precipitation: Add 0.9 ml of ice-cold acetone, precipitate at -20℃ for 20 min, centrifuge at 5000g for 5 min, and discard the supernatant. Wash 4 times with ice-cold acetone, 1 ml each time, centrifuge at 5000g for 5 min, and discard the supernatant.

[0048] (6) Precipitation of nitrosylated proteins: First, resuspend in 250 μl HENS / 10 buffer, then add 750 μl Neutralization buffer, vortex thoroughly, and then aspirate 30 μl as input. Next, add 30 μl prewashed avidin-affinity resin and incubate overnight at 4°C with inversion. Centrifuge at 5000 g for 3 min, discard the supernatant, add 1 ml 1xPBS, wash at 4°C with inversion for 5 min, centrifuge, discard the supernatant, and repeat the washing process 3 times.

[0049] (7) Elution: Add 35 ml of Elution buffer and vortex at room temperature for 5 min. Centrifuge at 5000 g for 3 min, aspirate 30 μl of supernatant, add 6 μl of 6x loading buffer, and boil in a water bath at 100℃ for 8 min. Then, use Western blot to detect the Dexras1 nitrosylation level.

[0050] In step (1), GSNO was added to the sample to 200 μM and vortexed at room temperature for 40 min as a positive control. In step (4), the sample without sodium ascorbate was used as a negative control.

[0051] Example 8: Comparison of the antidepressant effects of small molecule compound ZW-005 and fluoxetine Adult (6-8 weeks old) ICR mice were used to construct a chronic mild stress model, as described in Example 1. Simultaneously, some of the modeling mice were administered ZW-005 via tail vein injection for 3, 7, 14, 21, and 28 days, or via intraperitoneal administration of fluoxetine for 3, 7, 14, 21, and 28 days. Forced swimming behavior was assessed 24 hours after model establishment.

[0052] The results are as follows Figure 8 As shown, administration of ZW-005 for 7 days began to significantly reverse the depressive behavioral phenotype induced by chronic stress; while administration of fluoxetine only showed a significant antidepressant effect after 28 days of administration.

[0053] Example 9: Construction and Behavioral Evaluation of a Cerebral Ischemia Model Focal cerebral ischemia is caused by intracavitary middle cerebral artery occlusion (MCAO). Briefly, after anesthetizing mice, a surgical nylon monofilament with a rounded tip (4 / 0) is inserted through the external carotid artery stump into the right internal carotid artery, advancing 20-21 mm beyond the carotid bifurcation until slight resistance is felt. It is left in place for 120 minutes, then removed to allow reperfusion. Regional cerebral blood flow is measured using a laser Doppler perfusion monitor, ensuring a reduction of 85%-95%.

[0054] In this embodiment, the Grid Test and Morris water maze are used to evaluate the impact of the cerebral ischemia model on neurological function.

[0055] The grid test is used to assess neuromuscular strength and coordination in rodents. The horizontal grid apparatus used in this behavioral test consists of a 12 x 12 cm grid with openings of 0.5 x 0.5 cm. The grid is 20 cm above the surface to prevent the animal from jumping out. A 3-inch high wall made of a sturdy, opaque material (plexiglass) surrounds the grid in a manner that does not interfere with the subject's performance. The grid is allowed to rotate both ways. The mouse is placed in the center of the grid, and its tail is released when it successfully grasps the mesh with all four paws. The grid is then inverted. The mouse is allowed to walk freely on the grid for 5 minutes. The test is repeated if necessary. The number of foot errors and the total number of steps are analyzed, and the ratio of foot errors to total steps is calculated.

[0056] The Morris water maze experiment uses a circular pool filled with opaque water. Animals, after training, use their spatial memory and visual cues around the maze to locate platforms hidden beneath the water's surface. The animals are then placed individually in different quadrants of the pool, and the time and distance traveled to reach the concealed platforms are recorded. This model has become one of the most commonly used behavioral experimental methods in research on cerebral ischemia.

[0057] All data in this example are expressed as mean ± SEM. For all behavioral data, two-tailed student's t-tests or one-way ANOVA followed by Tukey's post hoc test were used.

[0058] Example 10: Construction and Behavioral Evaluation of an Epilepsy Model The most classic chemical drug is pentylenetetrazol (PTZ), which induces epilepsy by blocking GABA transmission and can be used to establish animal models of acute and chronic epilepsy. Mice were injected intraperitoneally with physiological saline or PTZ (50 mg / kg body weight). Thirty minutes after injection, the development of epilepsy-related motor or behavioral changes was observed. The severity of epilepsy was quantified using the following methods: no abnormal movement or behavior (0 points); immobility (1 point); tail twitching (2 points); generalized tonic-clonic seizures (3 points); single body contraction (4 points); continuous body contractions (5 points); a series of abnormal movements (tail twitching, body shaking, or contractions), sometimes accompanied by loss of balance lasting 5-10 seconds (6 points); tonic-clonic seizures (7 points); death (8 points). Evaluation results are as follows: Figure 10 As shown, compared with the control group, the mice injected with the small molecule compound had significantly lower levels of epilepsy, indicating that the small molecule compound effectively alleviated PTZ-induced epilepsy.

[0059] The experiments described above demonstrate that Dexras1 is a crucial regulator of chronic stress-related diseases such as anxiety, depression, stroke, and epilepsy. Further experiments have verified that inhibiting Dexras1 expression or activity, as well as reducing or blocking the coupling between Dexras1 and CAPON, can alleviate or eliminate anxiety and depression phenotypes or alleviate stroke and epilepsy-related symptoms.

[0060] In the above examples, inhibiting Dexras1 expression means reducing the mRNA and protein levels of Dexras1. Inhibiting Dexras1 activity means reducing its nitrosylation level. The coupling between Dexras1 and CAPON refers to the ability of a segment of the Dexras1 amino acid sequence to bind to CAPON. Proteins that uncouple Dexras1 from CAPON can compete with normal proteins, thereby reducing the function of endogenous Dexras1. Proteins that uncouple Dexras1-CAPON can be expressed in target tissues or cells by administering a vector capable of expression in the target tissue or cells (the vector carrying the gene for the uncoupled protein and / or its expression factor).

[0061] Based on the association between Dexras1 and anxiety, depression, stroke, and epilepsy, the methods described above can be used to screen or test effective ingredients for the treatment of anxiety, depression, stroke, epilepsy, or other chronic stress-related diseases.

[0062] It should also be noted that, in this disclosure, the active ingredient described in the above examples may be a drug component or combination of drugs that has a positive effect on treatment.

[0063] The methods and drugs disclosed in this disclosure can be methods and drugs that exert local effects in the hippocampus or other tissues. For drugs used on neural tissues, especially neuropathic neural tissues, such as the hippocampus or other specific brain regions, it is beneficial to limit the action of the drug to the target tissue. Methods or drugs used on the hippocampus or specific brain regions need to consider whether the method or drug can exert its effectiveness in the specific brain region, including whether the drug can reach the specific brain region and whether an effective concentration can be achieved in the specific brain region. In some examples of this disclosure, the drug can be a dosage form for local administration to a specific brain region. The drug's action can be limited to the target tissue by local administration, for example, by making the drug into a dosage form that can be implanted into a specific brain region for local administration through a cannula. Another example is making the drug into a dosage form for sustained release after implantation into the tissue. In addition, the above-mentioned drugs can also be made into the form of tissue-specific targeted drug delivery systems. For example, this can be achieved by linking small molecule compounds or bioactive molecules (nucleic acids such as DNA or mRNA encoding corresponding proteins, proteins such as antibodies, etc.) that promote neural plasticity with antibodies that can specifically bind to proteins specifically expressed in a specific brain region to form a complex molecule that can recognize and bind to cells in a specific brain region.

[0064] In examples of this disclosure, the treatment includes: an ongoing process or outcome of improving, alleviating, reducing, or preventing symptoms associated with chronic stress-related diseases; an ongoing process or outcome of improving disease-related symptoms; an ongoing process or outcome of normalizing bodily functions in a disease or condition that causes specific impairment of bodily function; or an ongoing process or outcome of improving one or more clinically measurable parameters that cause a disease.

[0065] In the examples disclosed herein, the purpose of treatment is to prevent or slow down (alleviate) undesirable physical conditions, symptoms, or diseases, or to achieve beneficial or desired results.

[0066] The outcome can be, for example, medical, physiological, clinical, physical therapy, or occupational therapy, addressed to healthcare professionals or patients; or parameters understood in the art as "quality of life" or activities of daily living. Beneficial or desired clinical outcomes in this disclosure include, but are not limited to, alleviating symptoms; reducing / minimizing the severity of the condition, symptom, or disease; and stabilizing (i.e., preventing the condition, symptom, or disease from worsening). In some examples of the disclosure, the treatment may also include evoking a clinically effective response without excessive levels of side effects.

[0067] In the examples disclosed herein, treatment also includes extending survival compared to the expected survival without treatment. Treatment can also refer to administering medication or performing medical procedures on a patient.

[0068] The treatments mentioned in this disclosure may also be prevention, cure of weakness or disease, or improvement of a patient’s clinical condition, including reducing the course or severity of the disease, or subjectively improving the patient’s quality of life or prolonging the patient’s survival.

[0069] The examples above are illustrative of this disclosure and should not be construed as limiting it unless otherwise indicated. Practice of this disclosure will utilize conventional techniques such as organic chemistry, polymer chemistry, and biotechnology, and it will be apparent that this disclosure may be implemented in other ways than those specifically described in the foregoing description and examples. Other aspects and modifications within the scope of this disclosure will be apparent to those skilled in the art. Many changes and variations are possible in accordance with the teachings of this disclosure and are therefore within its scope.

[0070] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0071] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

[0072] <110> Southeast University <120> Dexras1 inhibitors and their applications <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Mus musculus <400> 1 gctcaaacagcagatcctaga 21 <210> 2 <211> twenty one <212> DNA <213> Mus musculus <400> 2 gctggtcatttgcggtaacaa 21 <210> 3 <211> 21 <212> DNA <213> Muscles <400> 3 gcgttgtgcctacttcgagat 21 <210> 4 <211> 21 <212> DNA <213> Muscles <400> 4 gcgttgtgcctacttcgagat 21 <210> 5 <211> 280 <212> PRT <213> Muscles <400> 5 Met Lys Leu Ala Ala Met Ile Lys Lys Met Cys Pro Ser Asp Ser Glu 1 5 10 15 Leu Ser Ile Pro Ala Lys Asn Cys Tyr Arg Met Val Ile Leu Gly Ser 20 25 30 Ser Lys Val Gly Lys Thr Ala Ile Val Ser Arg Phe Leu Thr Gly Arg 35 40 45 Phe Glu Asp Ala Tyr Thr Pro Thr Ile Glu Asp Phe His Arg Lys Phe 50 55 60 Tyr Ser With Arg Gly Glu Val Tyr Gln With Asp And With Asp Thr Ser 65 70 75 80 Gly Asn His Pro Phe Pro Ala Met Arg Arg Leu Ser Ile Leu Thr Gly 85 90 95 Asp Val Phe Ile Leu Val Phe Ser Leu Asp Asn Arg Asp Ser Phe Glu 100 105 110 Glu Val Gln Arg Leu Lys Gln Gln Ile Leu Asp Thr Lys Ser Cys Leu 115 120 125 Lys Asn Lys Thr Lys Glu Asn Val Asp Val Pro Leu Val Ile Cys Gly 130 135 140 Asn Lys Gly Asp Arg Asp Phe Tyr Arg Glu Val Glu Gln Arg Glu Ile 145 150 155 160 Glu Gln Leu Val Gly Asp Asp Pro Gln Arg Cys Ala Tyr Phe Glu Ile 165 170 175 Ser Ala Lys Lys Asn Ser Ser Leu Asp Gln Met Phe Arg Ala Leu Phe 180 185 190 Ala Met Ala Lys Leu Pro Ser Glu Met Ser Pro Asp Leu His Arg Lys 195 200 205 Val Ser Val Gln Tyr Cys Asp Val Leu His Lys Lys Ala Leu Arg Asn 210 215 220 Lys Lys Leu Leu Arg Ala Gly Ser Gly Gly Gly Gly Asp His Gly Asp 225 230 235 240 Ala Phe Gly Ile Leu Ala Pro Phe Ala Arg Arg Pro Ser Val His Ser 245 250 255 Asp Met Tyr With Arg Glu Lys Thr Ser Val Gly Ser Gln Ala Lys 260 265 270 Asp Lys Glu Arg Cys Will Be 275,280 <210> 6 <211> 138 <212> DNA <213> Muscles <400> 6 gggggcgacc acggcgatgc ctttggcatc tggcgcct tgctcgcag acccagcgtg 60 cacagcgacc tcatgtacat tcgtgaaaaa accagtgtcg gcagccaggc taaggacaag 120 gagcgctgtg tcatcagt 138

Claims

1. The use of Dexras1-RNAi in the preparation of medicaments for the prevention or treatment of depression or anxiety, characterized in that, The nucleotide sequence of the Dexras1-RNAi is SEQ ID No.

2.

2. The use of reduced Dexras1 protein coupled with CAPON in the preparation of medicaments for the prevention or treatment of depression or anxiety, characterized in that, The amino acid sequence of the Dexras1 protein that reduces the coupling between Dexras1 and CAPON is positions 235-280 in SEQ ID NO.

5.

3. The use of small molecule compounds capable of inhibiting Dexras1 expression and / or activity in the preparation of medicaments for the prevention or treatment of depression or anxiety, characterized in that, The small molecule compound is any one or more of the following: 、 、 、 、 。 4. The use of small molecule compounds capable of inhibiting Dexras1 expression and / or activity in the preparation of medicaments for the prevention or treatment of epilepsy and / or stroke, characterized in that, The small molecule compound is: 。

Images