Recombinant engineering bacteria for synthesizing flavonoid glycosides commonly found in citrus and construction method and application thereof

CN117305143BActive Publication Date: 2026-09-15HUNAN AGRI PRODS PROCESSING INST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310020061.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-06
Publication Date
2026-09-15
Estimated Expiration
2043-01-06

AI Technical Summary

Technical Problem

大部分黄酮苷进行的第二次糖基化是鼠李糖,而鼠李糖只在植物细胞中存在,作为植物的细胞壁的组成成分,细菌和酵母等微生物并不能合成鼠李糖,因此对于在细菌和酿酒酵母中进行第二次糖基化具有一定的难度

Benefits of technology

[0040]This invention provides a recombinant engineered strain for synthesizing common flavonoid glycosides found in citrus fruits. First, the genes EXG1, EGH1, and SPR1 are knocked out using a CRISPR/Cas9 editing system to obtain chassis cells E033, enabling *Saccharomyces cerevisiae* to effectively accumulate flavonoid glycosides. Then, AtGT from *Arabidopsis thaliana*, OlRHM from *Ornithogalum longebracteatum*, and Cs1,6-RhaT from *Citrus* species or Cm1,2-RhaT from *Citrus maxima* are co-expressed with the endogenous *PGM2* gene from *Saccharomyces cerevisiae* in E033. AtGT catalyzes the glycosylation of flavonoid substrates at the 7-O position to synthesize the corresponding monoglycosides; OlRHM catalyzes the conversion of UDP-glucose to UDP-rhamnose to provide a glycosyl donor for the second glycosylation step; Cs1,6-RhaT and Cm1,2-RhaT catalyze the linkage of flavonoid glucosides and rhamnose through 1,2-glycosidic bonds or 1,6-glycosidic bonds to synthesize the corresponding flavonoid glycosides; PGM2 catalyzes the conversion of 6-phosphate-glucose to 1-phosphate-glucose to increase the supply of UDP-glucose. By using engineered bacteria for fermentation, with the addition of different substrates at 400 mg/L during the fermentation process, 111.5 mg/L of neo-hesperidin, 297.8 mg/L of hesperidin, 192.1 mg/L of neo-hesperidin, 133.3 mg/L of naringin, 133.5 mg/L of speridin, and 23.8 mg/L of diosmin can be produced after 72 hours of fermentation. This method has advantages such as low cost and high yield, and is a green method for obtaining speridin, neo-hesperidin, hesperidin, neo-hesperidin, diosmin, and naringin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117305143B_ABST
    Figure CN117305143B_ABST
Patent Text Reader

Abstract

This invention discloses a recombinant engineered bacterium for synthesizing common flavonoid glycosides in citrus, its construction method, and its applications. The recombinant engineered bacterium is obtained by co-expressing the AtGT gene, OlRHM gene, and Cs1,6-RhaT gene or Cm1,2-RhaT gene with the endogenous PGM2 gene of Saccharomyces cerevisiae in Saccharomyces cerevisiae strain E033. This invention utilizes AtGT to catalyze the glycosylation reaction of flavonoid substrates at the 7-O position to synthesize the corresponding monosaccharides. OlRHM catalyzes the conversion of UDP-glucose to UDP-rhamnose to provide a glycosyl donor for the second glycosylation step. Cs1,6-RhaT and Cm1,2-RhaT respectively catalyze the linkage of flavonoid glucosides and rhamnose through 1,2-glycosidic bonds or 1,6-glycosidic bonds to synthesize the corresponding flavonoid glycosides, obtaining senna-glucosinolate, neo-senna-glucosinolate, hesperidin, neo-hesperidin, diosmin, and naringin, which have advantages such as being green and environmentally friendly.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and relates to a recombinant engineered bacterium that synthesizes common flavonoid glycosides in citrus fruits, its construction method, and its application. Background Technology

[0002] Flavonoids are one of the major types of phenolic compounds and are the most common secondary metabolites found in plants to date. Flavonoids have a basic carbon skeleton structure of 15 carbons, characterized by three carbons (C ring) connecting two benzene rings (A ring and B ring), hence the name C6-C3-C6 polyphenols. Flavonoids mainly include flavanones, flavonols, flavones, anthocyanins, and isoflavones. The main flavonoids found in citrus fruits include naringin, hesperidin, sennain, kaempferol, quercetin, polymethoxyflavones, anthocyanins, and apigenin. In natural citrus plants, flavonoids mainly exist in glycosylated forms, especially flavonoid-O glycosides and flavonoid-C glycosides, which are generally water-soluble and accumulate in the vacuoles of plant cells. Glycoside flavonoids are mainly synthesized through the binding of uridine diphosphate (UDP)-dependent glycosyltransferases to receptors, such as flavonoid 3-O-glycosyltransferases, 5-O-glycosyltransferases, 7-O-glycosyltransferases, 3'-O-glycosyltransferases, and flavonoid glycoside glycosyltransferases (GGTs). In the synthesis of flavonoids, monosaccharides or disaccharides, such as glucose and rhamnose, are added to different positions on the flavonoid backbone by GGTs.

[0003] For plant-based natural drugs with pharmaceutical development value, glycosylation modification often results in better biological activity, higher bioavailability, and fewer toxic side effects. As an important class of secondary metabolites in plants, flavonoids have been extensively studied and developed, and most possess rich and diverse pharmacological activities. Flavonoids are characterized by multiple hydroxyl groups, and glycosylation of these compounds significantly alters their physicochemical properties. In nature, glycosides of flavonoids linked to glucose, galactose, rhamnose, and glucuronic acid have been widely isolated and identified. However, the low content of these flavonoid glycosides in plants, the cumbersome isolation and extraction procedures, and the low product recovery rate greatly hinder their development and application. Flavonoid glycosides in plants are generally formed by catalysis of glycosyltransferases (UGTs). In most cases, glycosyltransferases exhibit good regioselectivity and stereoselectivity, allowing for the synthetic transformation of glycosides using biocatalysis. Isolating and identifying more novel glycosyltransferase genes with diverse functions will facilitate research on the glycosylation modification of natural flavonoids.

[0004] Glycosylation, a hot topic in the synthesis of flavonoid glycosides, has attracted widespread attention. Currently, the problem of monosaccharide synthesis is relatively well-solved, with practical methods available; however, secondary glycosylation (i.e., disaccharide synthesis) is more difficult, and successful secondary glycosylation has only been achieved in plants, demonstrating significant research potential. Most flavonoid glycosides undergo secondary glycosylation to rhamnose, which exists only in plant cells. As a component of plant cell walls, bacteria and yeasts cannot synthesize rhamnose, thus posing a challenge to secondary glycosylation in bacteria and Saccharomyces cerevisiae. In plants, the active form of rhamnose is UDP-rhamnose, formed from UDP-glucose catalyzed by UDP-rhamnose synthase (RHM), requiring NAD+ and NADPH as cofactors. Therefore, there is an urgent need to develop a biotransformation method to synthesize flavonoid disaccharides. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the technical problems in the prior art and provide a recombinant engineered bacteria that can synthesize common flavonoid glycosides in citrus, as well as its construction method and application. The recombinant engineered bacteria can obtain senna-2, new North American senna-2, hesperidin, neohesperidin, diosmin and naringin, which is green and environmentally friendly.

[0006] To solve the above-mentioned technical problems, the present invention provides a recombinant engineered bacterium for synthesizing common flavonoid glycosides in citrus, wherein the recombinant engineered bacterium is recombinant engineered bacterium 1 or recombinant engineered bacterium 2;

[0007] The recombinant engineered strain 1 was obtained by co-expressing the AtGT gene from Arabidopsis thaliana, the OlRHM gene from Ornithogalum longebracteatum, and the Cs1,6-RhaT gene from Citrus species with the endogenous PGM2 gene of Saccharomyces cerevisiae in Saccharomyces cerevisiae strain E033.

[0008] The recombinant engineered strain 2 was obtained by co-expressing the AtGT gene from Arabidopsis thaliana, the OlRHM gene from Ornithogalum longebracteatum, and the Cm1,2-RhaT gene from Citrus maxima with the endogenous PGM2 gene of Saccharomyces cerevisiae in Saccharomyces cerevisiae strain E033.

[0009] Furthermore, the DNA sequence of the AtGT gene in the aforementioned recombinant engineered bacteria is as described in SEQ ID NO.1;

[0010] The DNA sequence of the OlRHM gene is shown in SEQ ID NO.2;

[0011] The DNA sequence of the Cs1,6-RhaT gene is shown in SEQ ID NO.3;

[0012] The DNA sequence of the Cm1,2-RhaT gene is shown in SEQ ID NO.4;

[0013] The DNA sequence of the PGM2 gene is shown in SEQ ID NO.5.

[0014] Furthermore, the aforementioned recombinant engineered bacteria, specifically the Saccharomyces cerevisiae strain E033, is a Saccharomyces cerevisiae C800 strain with the EXG1, EGH1, and SPR1 genes knocked out.

[0015] Based on a general technical concept, the present invention also provides a method for constructing the recombinant engineered bacteria, wherein the method for constructing the recombinant engineered bacteria 1 includes the following steps:

[0016] A1. The gene fragments RPY26, TDH1p, OlRHM, Ter22, AtGT, ADH6p, SHM2p and Cs1,6-RhaT were sequentially linked to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT.

[0017] A2. Connect the RPRS424, TDH1p and PGM2 fragments in sequence to obtain the PRS424-TDH1p-PGM2 plasmid;

[0018] A3. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid and the PRS424-TDH1p-PGM2 plasmid were transferred into Saccharomyces cerevisiae strain E033 to obtain recombinant engineered strain 1.

[0019] The method for constructing the recombinant engineered bacteria 2 includes the following steps:

[0020] B1. The gene fragments RPY26, TDH1p, OlRHM, Ter22, AtGT, ADH6p, SHM2p and Cs1,2-RhaT are sequentially linked to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT.

[0021] B2. Connect the RPRS424, TDH1p and PGM2 fragments in sequence to obtain the PRS424-TDH1p-PGM2 plasmid.

[0022] B3. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT plasmid and the PRS424-TDH1p-PGM2 plasmid were transferred into Saccharomyces cerevisiae strain E033 to obtain recombinant engineered strain 2.

[0023] Furthermore, the above-described construction method is used to construct the Saccharomyces cerevisiae strain E033 using the following method:

[0024] S3-1. Design the corresponding sgRNAs for the EXG1, EGH1, and SPR1 genes, and construct multi-gene editing plasmids;

[0025] S3-2. Using the Saccharomyces cerevisiae genome as a template, design homologous arms for the EXG1, EGH1, and SPR1 genes.

[0026] S3-3. Transform the multi-gene editing plasmid and the homologous arm into Saccharomyces cerevisiae C800, and screen for positive clones, which are strains E033 that have eliminated the EXG1, EGH1 and SPR1 genes.

[0027] Furthermore, in accordance with the above construction method, the sgRNA of the EXG1 gene is shown in SEQ ID NO.6; the sgRNA of the EGH1 gene is shown in SEQ ID NO.7; and the sgRNA of the SPR1 gene is shown in SEQ ID NO.8.

[0028] The above-described construction method, further, the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid in A1 is constructed using the following method:

[0029] S1-1, The promoter TDH1p, gene OlRHM and terminator TER22 were respectively linked into fragment 1 by fusion PCR;

[0030] S1-2, promoter ADH6p and gene AtGT are fused together by PCR to form fragment 2;

[0031] S1-3, promoter SHM2p and gene Cs1,6-RhaT were fused together by PCR to form fragment 3;

[0032] S1-4. Using a one-step cloning enzyme, fragment 1, fragment 2, fragment 3 and the linearized vector PY26 are ligated to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT.

[0033] The above-described construction method, further, the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT plasmid in B1 is constructed using the following method:

[0034] Using the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid as a template, after linearization, it was ligated with the Cm1,2RhaT gene using a one-step cloning enzyme to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cm1,2RhaT.

[0035] Based on a general technical concept, the present invention also provides the application of recombinant engineered bacteria in the synthesis of common flavonoid disaccharides in citrus fruits, wherein the method of application is as follows:

[0036] Using sucralose, hesperidin, or geraniol as substrates, the recombinant engineered bacteria 1 was used to ferment and synthesize sucralose glycoside, hesperidin, or diosmin.

[0037] Using sennaol, hesperidin, or naringenin as substrates, the recombinant engineered bacteria 2 were used to ferment and synthesize new North American sennaol, new hesperidin, or naringenin.

[0038] Further, in the above application, the fermentation specifically involves: fermenting recombinant engineered bacteria 1 or recombinant engineered bacteria 2 in a shaker at 30°C and 220 rpm for 72 hours, and adding 400 mg / L of substrate at the 12th hour of fermentation.

[0039] Compared with the prior art, the advantages of the present invention are as follows:

[0040] This invention provides a recombinant engineered strain for synthesizing common flavonoid glycosides found in citrus fruits. First, the genes EXG1, EGH1, and SPR1 are knocked out using a CRISPR / Cas9 editing system to obtain chassis cells E033, enabling *Saccharomyces cerevisiae* to effectively accumulate flavonoid glycosides. Then, AtGT from *Arabidopsis thaliana*, OlRHM from *Ornithogalum longebracteatum*, and Cs1,6-RhaT from *Citrus* species or Cm1,2-RhaT from *Citrus maxima* are co-expressed with the endogenous *PGM2* gene from *Saccharomyces cerevisiae* in E033. AtGT catalyzes the glycosylation of flavonoid substrates at the 7-O position to synthesize the corresponding monoglycosides; OlRHM catalyzes the conversion of UDP-glucose to UDP-rhamnose to provide a glycosyl donor for the second glycosylation step; Cs1,6-RhaT and Cm1,2-RhaT catalyze the linkage of flavonoid glucosides and rhamnose through 1,2-glycosidic bonds or 1,6-glycosidic bonds to synthesize the corresponding flavonoid glycosides; PGM2 catalyzes the conversion of 6-phosphate-glucose to 1-phosphate-glucose to increase the supply of UDP-glucose. By using engineered bacteria for fermentation, with the addition of different substrates at 400 mg / L during the fermentation process, 111.5 mg / L of neo-hesperidin, 297.8 mg / L of hesperidin, 192.1 mg / L of neo-hesperidin, 133.3 mg / L of naringin, 133.5 mg / L of speridin, and 23.8 mg / L of diosmin can be produced after 72 hours of fermentation. This method has advantages such as low cost and high yield, and is a green method for obtaining speridin, neo-hesperidin, hesperidin, neo-hesperidin, diosmin, and naringin. Attached Figure Description

[0041] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0042] Figure 1 This is a schematic diagram of the use of CRISPR / Cas9 to knock out genes EXG1, EGH1 and SPR1 in Example 1 of the present invention.

[0043] Figure 2 This is a plasmid diagram of the knockout genes EXG1, EGH1, and SPR1 in Example 1 of the present invention.

[0044] Figure 3 This is a schematic diagram of the homologous arms EXG1A-EXG1B, EGH1A-EGH1B, and SPR1A-SPR1B in Embodiment 1 of the present invention.

[0045] Figure 4This is a diagram of the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid in Example 2 of the present invention.

[0046] Figure 5 This is a diagram of the PRS424-TDH1p-PGM2 plasmid in Example 2 of the present invention.

[0047] Figure 6 This is a diagram of the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cm1,2-RhaT plasmid in Example 3 of the present invention.

[0048] Figure 7 This is a schematic diagram of the synthesis pathway from sennaol to senna glycoside in an embodiment of the present invention.

[0049] Figure 8 The following are structural diagrams of various flavonoid glycosides in the embodiments of the present invention.

[0050] Figure 9 This is a liquid phase diagram of flavonoids in the fermentation broth after fermentation in Example 4 of the present invention.

[0051] Figure 10 This is a liquid phase diagram of flavonoids in the fermentation broth after fermentation in Example 5 of the present invention. Detailed Implementation

[0052] The present invention will be further described below with reference to the accompanying drawings and specific preferred embodiments, but this does not limit the scope of protection of the present invention. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0053] Unless otherwise specified, all raw materials, reagents, instruments, and equipment used in this invention can be purchased commercially or prepared using existing methods. Unless otherwise specified, the methods in the following examples are conventional methods in the art.

[0054] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0055] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.

[0056] The hesperidin standard used in the following examples is a product of Shanghai Yuanye Biotechnology Co., Ltd. The chromatographic grade acetonitrile, methanol, and formic acid are products of Fisher Scientific (USA).

[0057] The preparation methods for the working solutions of the standard curves for each substance are as follows:

[0058] Preparation of standard solutions: Dissolve solid standard in methanol to prepare a 1000 mg / L standard solution, and then dilute with methanol to prepare standard curve working solutions of 500 mg / L, 400 mg / L, 200 mg / L, 100 mg / L, 50 mg / L, 20 mg / L and 10 mg / L respectively.

[0059] Preparation of standard curves for each substance: The working solutions of the standard curves were detected using ultra-high performance liquid chromatography (UHPLC), and the peak areas at different concentrations of working solutions were calculated at different retention times. The standard substance concentrations were plotted on the x-axis, and the peak areas on the y-axis. Linear regression analysis was performed based on the relationship between concentration and peak area to plot the standard curves. The standard curve equations obtained from the standard curves are as follows: Hesperidin: Y = 18469.1X - 145442; Neo-North American Hesperidin: Y = 16088.79715X - 92638.90827; Hesperidin: Y = 13628.89036X - 31752.38001; Neo-Hesperidin: Y = 17393.86305X - 123441.81555; Naringin: Y = 15150.51733X - 34445.59828; Diosmin: Y = 9317.63991X + 5958.845.

[0060] The culture medium preparation methods used in the following examples are as follows:

[0061] LB medium: Take 10 g / L tryptone, 5 g / L yeast extract and 10 g / L NaCl, sterilize at 121℃ for 20 min and store (add 15 g / L agar to solid medium).

[0062] YNB medium: 50 mL / L of 20×YNB stock solution, 20 g / L of glucose, and add 50 mg / L of uracil, histidine, tryptophan and leucine as needed (add 15 g / L of agar to solid medium).

[0063] YPD medium: 20 g / L tryptone, 10 g / L yeast extract, 20 g / L glucose (solid medium with an additional 15 g / L agar).

[0064] Example 1

[0065] A recombinant engineered Saccharomyces cerevisiae strain E033 of the present invention was constructed using the following method:

[0066] (1) The corresponding sgRNAs of genes EXG1, EGH1 and SPR1 were designed using the website http: / / chopchop.cbu.uib.no / . The sgRNA of EXG1 is shown in SEQ ID NO.6, specifically: AACCGATAGGAATTCTGACA; the sgRNA of EGH1 is shown in SEQ ID NO.7, specifically: CACTTCGAATGACTTACCAG; and the sgRNA of SPR1 is shown in SEQ ID NO.8, specifically: AATTAGTAAACTGTAATCCT.

[0067] 1.1 Using RMCas9-F / RMCas9-R primers and CRISPR multi-gene editing plasmid as template, linearized plasmids were obtained by PCR.

[0068] The specific DNA sequence of RMCas9-F is: TTTGGTCTCTTTTTTTTGTTTTTTATGTCTGCATAGC TTC;

[0069] The specific DNA sequence of RMCas9-R is: TGTGGTCTCTGATCATTTATCTTTCACTGCGGAGAA GT.

[0070] PCR system: 2×Phanata mix 25μL; ddH2O 22μL; RMCas9-F 1μL; RMCas9-R 1μL; template 1μL.

[0071] PCR program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 2 min, 72℃ extension for 30 s / kb; cycle denaturation, annealing, and extension steps 29 times; 72℃ final extension for 5 min.

[0072] 1.2 Using sgEXG1-F / sgEXG1-R, sgEGH1-F / sgEGH1-R, and sgSPR1-F / sgSPR1-R as primers and CRISPR multi-gene editing plasmids as templates, the corresponding sgRNAs of genes EXG1, EGH1, and SPR1 were obtained by PCR.

[0073] The DNA sequence of sgSPR1-F is as follows: TTTGGTCTCTAATTAGTAAACTGTAATCCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA.

[0074] The DNA sequence of sgSPR1-R is: TTTGGTCTCTGGTTTGCGCAAGCCCGGAATCGAA.

[0075] The DNA sequence of sgEXG1-F is as follows: TTTGGTCTCTAACCGATAGGAATTCTGACAGTTTTAGAGCTAGAAATAGCAAGTTAAAAT.

[0076] The DNA sequence of sgEXG1-R is as follows: TTTGGTCTCTAGTGTGCGCAAGCCCGGAATCGA A.

[0077] The DNA sequence of sgEGH1-F is as follows: TTTGGTCTCTCACTTCGAATGACTTACCAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA.

[0078] The DNA sequence of sgEGH1-R is as follows: TTTGGTCTCTAAAATAAATTGGCCATAGAAAAATTCTGTTATCCACT.

[0079] 1.3 Construct multi-gene editing plasmids using the Golden Gate kit. Figure 1 Flowchart for multi-gene editing plasmids that knock out the genes EXG1, EGH1, and SPR1; Figure 2 This is a plasmid diagram of the knockout genes EXG1, EGH1, and SPR1 in Example 1 of the present invention.

[0080] from Figure 1 As can be seen, using the CRISPR / Cas9 multi-gene editing system, a homologous arm fragment carrying the gene to be knocked out is transferred into Saccharomyces cerevisiae C800. Under the action of CRISPR / Cas9, the gene on the genome is replaced, thus achieving the knockout of the target gene.

[0081] (2) Construct homologous arms.

[0082] 2.1 Using the Saccharomyces cerevisiae genome as a template, homologous arms EXG1A, EXG1A-R, EXG1B-F / EXG1B-R, EGH1A-F / EGH1A-R, EGH1B-F / EGH1B-R, SPR1A-F / SPR1A-R, and SPR1B-F / SPR1B-R were obtained by PCR using primers EXG1A-F / EXG1A-R, EXG1B-E, EGH1A, EGH1B, SPR1A, and SPR1B, respectively.

[0083] The specific sequence of EXG1A-F is: ACGAGCCTGAGACAAGCCCG.

[0084] The specific sequence of EXG1A-R is: AACAAGGCCCCACGGTGTGGTTTCTTTAGTTGGTAATTAACTAGAAAAAGAAAGTAAAC.

[0085] The specific sequence of EXG1B-F is: TTCGCCCTATAGTGAGTCGTATTACGTCGCCCTCAGTCCG CTCAT.

[0086] The specific sequence of EXG1B-R is: GTTGTTTAAGTTCTTTTATCCTTCCTTAGATAACACC.

[0087] The specific sequence of EGH1A-F is: TTTTTTTTTTGACGAACCAGATTGTCAAATAAACAT.

[0088] The specific sequence of EGH1A-R is: ATGATCTGTTCTTATTAAATTCAAACAATTTAGGTACGA A.

[0089] The specific sequence of EGH1B-F is: TTTGAATTTAATAAGAACAGATCATACAAAAATTGAACCAAAAGCTATAGTAGTCA.

[0090] The specific sequence of EGH1B-R is: GCAAAGAGAAGTGGAATGATATAGATCAGATAGC.

[0091] The specific sequence of SPR1A-F is: TGGAAACCCTCTTCAGGAAAAAAGGAC.

[0092] The specific sequence of SPR1A-R is: TTACTTCTAAAGTTTATAAAGATTTTATGCGGAGCA.

[0093] The specific sequence of SPR1B-F is: AAATCTTTATAAACTTTAGAAGTAAAATTTTGTGGCATATATTTAAGGTCTTGGGAAT.

[0094] The specific sequence of SPR1B-R is: ATATGTCTTCATTATCTGAATCGGCTAGTGTAAG.

[0095] 2.2. The corresponding homologous arms were ligated by fusion PCR to obtain EXG1A-EXG1B, EGH1A-EGH1B, and SPR1A-SPR1B.

[0096] Step 1 of fusion PCR:

[0097] Reaction system: 2×Phanata mix: 10 μL; ddH2O: 7 μL; fusion fragment 1: 1 μL; fusion fragment 2: 1 μL; fusion fragment 3: 1 μL.

[0098] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 2 min, 72℃ extension for 30 s / kb; repeat the denaturation, annealing, and extension steps 9 times; 72℃ complete extension for 5 min.

[0099] Step 2 of fusion PCR:

[0100] Reaction system: 2×Phanata mix: 25 μL; ddH2O: 22 μL; primer 1: 1 μL; primer 2: 1 μL; template: 1 μL.

[0101] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 2 min, 72℃ extension for 30 s / kb; cycle denaturation, annealing, and extension steps 29 times; 72℃ complete extension for 5 min.

[0102] Figure 3 Schematic diagram of the homologous arms of EXG1A-EXG1B, EGH1A-EGH1B, and SPR1A-SPR1B.

[0103] (3) The constructed multi-gene editing plasmid and homologous arms EXG1A-EXG1B, EGH1A-EGH1B, and SPR1A-SPR1B were transformed into Saccharomyces cerevisiae C800 by lithium acetate conversion. The plasmids were then plated on YNB solid plates containing histidine, tryptophan, and leucine and incubated at 30°C for 3 days until single colonies grew.

[0104] (4) Using CeEXG1-F / CeEXG1-R, CeEGH1-F / CeEGH1-R, and CeSPR1-F / Ce SPR1-R as primers, colony PCR was performed, and a positive clone (a strain that successfully knocked out the genes EXG1, EGH1 and SPR1) was selected and inoculated into YPD liquid medium for 1-2 generations.

[0105] The specific sequence of CeEXG1-F is: GCAGACGTTTTAAATACTCCCTCCCT.

[0106] The specific sequence of CeEXG1-R is: GGTAGATAAATTAACGTTCTGTTAAGTTTTGCTGATGAAAAATAACATTAGAAAATTCA.

[0107] The specific sequence of CeEXH1-F is: GCCCCTAACAAGAAAAAAATATCGTCGA.

[0108] The specific sequence of CeEGH1-R is: GGCCCCTTTTTGTATTCATCCTGCT.

[0109] The specific sequence of CeSPR1-F is: GGCACGTCATTTATGAAATTCACAAATTG.

[0110] The specific sequence of SPR1B-R is: ATATGTCTTCATTATCTGAATCGGCTAGTGTAAG.

[0111] (5) The passaged bacterial culture was streaked onto a YPD plate containing 1 g / L of 5-fluoroorotic acid (5-FOA) and incubated at 30°C for 3 days until a single colony grew. The single colony that grew was the strain E033 that had eliminated the genes EXG1, EGH1 and SPR1.

[0112] Example 2:

[0113] A recombinant engineered bacterium 1 of the present invention is constructed using the following method:

[0114] (1) Construct the recombinant plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT.

[0115] 1.1 Download the gene sequences of 7-O-glucosyltransferase (AtGT) from Arabidopsis thaliana, UDP-rhamnosyltransferase (OlRHM) from Ornithogalum longebracteatum, and 1,6-rhamnosyltransferase (Cs1,6-RhaT) from Citrus species from NCBI (https: / / www.ncbi.nlm.nih.gov / ). After codon optimization for Saccharomyces cerevisiae, the specific sequences are as follows:

[0116] The DNA sequence of AtGT is shown in SEQ ID NO.1, specifically:

[0117]

[0118] The DNA sequence of OlRHM is shown in SEQ ID NO.2, specifically:

[0119]

[0120] The DNA sequence of Cs1,6-RhaT is shown in SEQ ID NO.3, specifically:

[0121]

[0122] 1.2 The codon-optimized gene was synthesized in its entirety at Sangon Biotech (Shanghai) Co., Ltd., and cloned into pUC57 to obtain recombinant plasmids pUC57-AtGT, pUC57-OlRHM, and pUC57-Cs1,6-RhaT.

[0123] 1.3. The genes AtGT, OlRHM, and Cs1,6-RhaT were obtained by PCR using primers AtGT-F / AtGT-R, RHM-F / RHM-R, and 6RhaT-F / 6RhaT-R, respectively.

[0124] The specific sequence of AtGT-F is: ATAGCCAACATGGAAGCCAACCTATTTAAACTTTTTCTTTCTGCAGTTTAACCAGGGT.

[0125] The specific sequence of AtGT-R is: ATGGGCACCCCGGTTGAAGT.

[0126] The specific sequence of RHM-F is: ATGGCTTCTCATACCCCAAAGAACA.

[0127] The specific sequence of RHM-R is: ATGGCACCTTGAGGCTTTTGACATTTTAAACCTTCTTATTTGGTTCAAAAACATACTTAATCA.

[0128] The specific sequence of 6RhaT-F is: ATGCATGCTCCATCCAACCAAC.

[0129] The specific sequence of 6RhaT-R is: GCCGGGGGATCCACTAGTTCTAGATTAAGCTAAAGCCTTCAAATCCTTAACAAAATCAG.

[0130] 1.4 Using the Saccharomyces cerevisiae genome as a template, and using TDH1p-F / TDH1p-R, ADH6p-F / ADH6p-R, SHM2p-F / SHM2p-R and Ter22-F / Ter22-R as primers, PCR was performed to obtain fragments TDH1p, ADH6p, SHM2p and Ter22, respectively.

[0131] The specific sequence of TDH1p-F is: CTAAAGGGAACAAAAGCTGGAGCTCATGTCCCACCAGCC AACACT.

[0132] The specific sequence of TDH1p-R is: TGTTCTTTGGGGTATGAGAAGCCATTTTGTTTTGTGTGTAAATTTAGTGAAGTACTGTT.

[0133] The specific sequence of Ter22-F is: AATGTCAAAAGCCTCAAGGTGCC.

[0134] The specific sequence of Ter22-R is: TAAACTGCAGAAAGAAAAAGTTTAAATAGGTTGGCTTCCATGTTGGCTAT.

[0135] The specific sequence of ADH6p-F is: TGCTAACTTCAACCGGGGTGCCCATGATTTTGGCTTTTCTTGTTGTTGTGTTGAA.

[0136] The specific sequence of ADH6p-R is: TACCTCACCTGAGTTTTGCTTTTTTCTCTG.

[0137] The specific sequence of SHM2p-F is: AAAAAAGCAAAACTCAGGTGAGGTATGTAGAAAAAAAAAAAGAAAAAAGAAGTGAAATT.

[0138] The specific sequence of SHM2p-R is: GTGTTGGTTGGATGGAGCATGCATGTTAAGGAGGATTCGGTTTAAGCTGTTATG.

[0139] 1.5 Using plasmid PY26 as a template and RPY26-F / RPY26-R as primers, PCR was performed to obtain the linearized vector RPY26.

[0140] The specific sequence of RPY26-F is: TCTAGAACTAGTGGATCCCCCGGG.

[0141] The specific sequence of RPY26-R is: GAGCTCCAGCTTTTGTTCCCTTTAGT.

[0142] 1.6. Using a one-step cloning enzyme, fragments RPY26, TDH1p, OlRHM, Ter22, AtGT, ADH6p, SHM2p, and Cs1,6-RhaT were sequentially ligated to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT.

[0143] Figure 4Image of PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid.

[0144] (2) Construct the recombinant plasmid PRS424-TDH1p-PGM2.

[0145] 2.1 The gene PGM2 derived from *Saccharomyces cerevisiae* was downloaded from the website https: / / www.yeastgenome.org / . Its specific sequence is shown in SEQ ID NO.5, and is as follows:

[0146]

[0147] 2.2 After extracting the Saccharomyces cerevisiae genome, it was used as a template, and the promoter TDH1p and gene PGM2 were obtained by PCR using TDH1p-F / TDH1p-R and PGM2-F / PGM2-R primers, respectively.

[0148] The specific sequence of TDH1p-F is: CTAAAGGGAACAAAAGCTGGAGCTCATGTCCCACCAGCC AACACT.

[0149] The specific sequence of TDH1p-R is: TGTTCTTTGGGGTATGAGAAGCCATTTTGTTTTGTGTGTAAATTTAGTGAAGTACTGTT.

[0150] 2.3 Using plasmid PRS424 as a template and RPRS424-F / RPRS424-R as primers, linearized plasmid RPRS424 was obtained by PCR. The fragments RPRS424, TDH1p, and PGM2 were sequentially ligated using a one-step cloning enzyme to obtain plasmid PRS424-TDH1p-PGM2.

[0151] The specific sequence of RPRS424-F is: CAGCTTTTGTTCCCTTTAGTGAGGG.

[0152] The specific sequence of RPRS424-R is: CGCGCGCTCACTGGCCGTCG.

[0153] Figure 5 Image of PRS424-TDH1p-PGM2 plasmid.

[0154] (3) Construct recombinant engineered bacteria 1.

[0155] 3.1 Using the Saccharomyces cerevisiae E033 from Example 1 as the starting strain, plasmids PY26-TD H1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT and PRS424-TDH1p-PGM2 were transformed into the plasmids PY26-TD H1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT and PRS424-TDH1p-PGM2 by lithium acetate conversion.

[0156] 3.2 Spread the plating onto YNB plates containing histidine and leucine (plasmid PY26 contains the Ura tag, plasmid PRS424 contains the Trp tag), and the resulting single colonies are the recombinant engineered bacteria 1.

[0157] Implementation Case 3:

[0158] A recombinant engineered bacterium 2 of the present invention is constructed using the following method:

[0159] (1) Construct the recombinant plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cm1,2-RhaT.

[0160] 1.1 Download the 1,2-rhamnosyltransferase (Cm1,2-RhaT) from Citrus maxima from NCBI (https: / / www.ncbi.nlm.nih.gov / ). After codon optimization using Saccharomyces cerevisiae, its specific sequence is shown in SEQ ID NO.4, specifically:

[0161]

[0162] The DNA sequence of Cm1,2-RhaT is shown in SEQ ID NO.4.

[0163] 1.2 The codon-optimized gene was synthesized in its entirety at Sangon Biotech (Shanghai) Co., Ltd., and cloned into pUC57 to obtain the recombinant plasmid pUC57-Cm1,2-RhaT.

[0164] 1.3. PCR was performed using primers 2RhaT-F / 2RhaT-R to obtain the gene Cm1,2-RhaT. Using R2RhaT-F / R2RhaT-R as primers and plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT as a template, a linearized plasmid was obtained by PCR.

[0165] The DNA sequence of 2RhaT-F is as follows: CAGCTTAAACCGAATCCTCCTTAACATGGATACTAAGCACCAAGATAAGCCAT.

[0166] The DNA sequence of 2RhaT-R is as follows: GCCCGGGGGATCCACTAGTTCTAGATTATTCAGACTTCTTAACTAATTGCAACAATTTT.

[0167] The specific DNA sequence of R2RhaT-F is: TCTAGAACTAGTGGATCCCCCGGG.

[0168] The specific DNA sequence of R2RhaT-R is: GTTAAGGAGGATTCGGTTTAAGCTGTTATG.

[0169] 1.4 Then, the plasmid was ligated to the gene Cm1,2-RhaT using a one-step cloning enzyme to obtain the recombinant plasmid PY26-TDH1p-Ol RHM-ADH6p-AtGT-SHM2p-Cm1,2-RhaT.

[0170] Figure 6 Image of PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cm1,2-RhaT plasmid.

[0171] (2) Construct recombinant engineered bacteria 2.

[0172] Using Saccharomyces cerevisiae E033 as the starting strain, plasmids PY26-TDH1p-OlRHM-AD H6p-AtGT-SHM2p-Cm1,2-RhaT and PRS424-TDH1p-PGM2 were transformed into plasmids via lithium acetate conversion. The resulting plasmids were then plated onto YNB plates containing histidine and leucine, and the resulting single colonies were identified as recombinant engineered strain 2.

[0173] Figure 7 This is a schematic diagram of the synthesis pathway from sennaol to senna glycoside in an embodiment of the present invention. Figure 8 The following are structural diagrams of various flavonoid glycosides in the embodiments of the present invention.

[0174] As shown in the figure, the synthetic pathway from sucralose to sucralose glycoside is as follows: sucralose is converted to sucralose-7-O-glucoside by 7-O-glucosyltransferase (AtGT used in this invention), which requires UDP-glucose as a glycosyl donor; then sucralose-7-O-glucoside is converted to sucralose glycoside by 1,6-rhamnosyltransferase (1,6-RhaT), which requires UDP-rhamnose as a glycosyl donor; simultaneously, UDP-glucose can be converted to UDP-rhamnose by UDP-rhamnose synthase (RHM).

[0175] Example 4:

[0176] A method for synthesizing common flavonoid glycosides in citrus fruits: senna-2-glucosinolate, hesperidin, and diosmin.

[0177] Includes the following steps:

[0178] (1) The recombinant engineered bacteria 1 from Example 2 was streaked onto a YNB solid plate containing leucine and histidine and cultured at 30°C for 3 days until a single colony grew.

[0179] (2) Pick a single colony into a 50 mL Erlenmeyer flask containing 5 mL of YNB liquid medium (containing leucine and histidine) and incubate at 30°C and 220 rpm for 16 h.

[0180] (3) Transfer the cultured seed solution at an inoculation rate of 1% to a 250mL Erlenmeyer flask containing 25mL YPD liquid medium and incubate at 30℃ and 220rpm for 12h.

[0181] (4) Add 400 mg / L of the substrate sennaol when fermentation is in progress for 12 hours, and continue fermentation for 72 hours. Take a sample of the fermentation broth and process it. The fermentation broth contains sennaol.

[0182] (5) Transfer 500 μL of fermentation broth to a 1.5 mL EP tube, add 500 μL of methanol, vortex for 5 min to mix, and centrifuge at 12000 rpm for 2 min. Pass the supernatant through a 0.22 μm organic filter membrane and analyze the processed sample by high performance liquid chromatography.

[0183] Using the same method, hesperidin and diosmin were synthesized using hesperidin or geraniol as substrates.

[0184] The liquid chromatography method was performed using a Thermo Fisher (Hypers11 ODS 250×4.6mm, 5μm) C18 column and a UV detector. Chromatographic conditions were: gradient elution, phase A was ultrapure water (0.1% formic acid), and phase B was acetonitrile (0.1% formic acid); 0 min–10 min, phase B: 10%–40%; 10 min–30 min, phase B: 40%–80%; 30 min–35 min, phase B: 80%; 35 min–40 min, phase B: 80%–10%; detection wavelength was 284 nm.

[0185] See test results Figure 9 As can be seen from the figure, the method of Example 4 of this invention can be used to synthesize senna-2-glucosinolate, hesperidin and diosmin.

[0186] Example 5:

[0187] A method for synthesizing a common flavonoid glycoside in citrus fruits: neohesperidin, neohesperidin, and naringin, comprising the following steps:

[0188] (1) The recombinant engineered bacteria 2 from Case 3 was streaked onto a YNB solid plate containing leucine and histidine and cultured at 30°C for 3 days until a single colony grew.

[0189] (2) Pick a single colony into a 50 mL Erlenmeyer flask containing 5 mL of YNB liquid medium (containing leucine and histidine) and incubate at 30°C and 220 rpm for 16 h.

[0190] (3) Transfer the cultured seed solution at an inoculation rate of 1% to a 250mL Erlenmeyer flask containing 25mL YPD liquid medium and incubate at 30℃ and 220rpm for 12h.

[0191] (4) Add 400 mg / L of the substrate sennaol when fermentation is in progress for 12 hours, and continue fermentation for 72 hours before taking samples to process the fermentation broth.

[0192] (5) Transfer 500 μL of fermentation broth to a 1.5 mL EP tube, add 500 μL of methanol, vortex for 5 min to mix, and centrifuge at 12000 rpm for 2 min. Pass the supernatant through a 0.22 μm organic filter membrane and analyze the processed sample by high performance liquid chromatography.

[0193] Using the same method, new hesperidin and naringin were synthesized using hesperidin or naringin as substrates.

[0194] The liquid chromatography method was performed using a Thermo Fisher (Hypers11 ODS 250×4.6mm, 5μm) C18 column and a UV detector. Chromatographic conditions were: gradient elution, phase A was ultrapure water (0.1% formic acid), and phase B was acetonitrile (0.1% formic acid); 0 min–10 min, phase B: 10%–40%; 10 min–30 min, phase B: 40%–80%; 30 min–35 min, phase B: 80%; 35 min–40 min, phase B: 80%–10%; detection wavelength was 284 nm.

[0195] See test results Figure 10 As can be seen from the figure, the method of Example 5 of this invention can be used to synthesize new North American senna glycoside, new hesperidin and naringin.

[0196] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.

Claims

1. A recombinant engineering bacteria for synthesizing flavonoid glycosides commonly found in citrus, characterized in that, The recombinant engineered bacteria is either recombinant engineered bacteria 1 or recombinant engineered bacteria 2; The recombinant engineered strain 1 was obtained by co-expressing the AtGT gene from Arabidopsis thaliana, the OlRHM gene from Ornithogalum longebracteatum, and the Cs1,6-RhaT gene from Citrus species with the endogenous PGM2 gene of Saccharomyces cerevisiae in Saccharomyces cerevisiae strain E033. The recombinant engineered strain 2 was obtained by co-expressing the AtGT gene from Arabidopsis thaliana, the OlRHM gene from Ornithogalum longebracteatum, and the Cm1,2-RhaT gene from Citrus maxima with the endogenous PGM2 gene of Saccharomyces cerevisiae in Saccharomyces cerevisiae strain E033. The DNA sequence of the AtGT gene is as described in SEQ ID NO.1; The DNA sequence of the OlRHM gene is shown in SEQ ID NO.2; The DNA sequence of the Cs1,6-RhaT gene is shown in SEQ ID NO.3; The DNA sequence of the Cm1,2-RhaT gene is shown in SEQ ID NO.4; The DNA sequence of the PGM2 gene is shown in SEQ ID NO.5; The *Saccharomyces cerevisiae* strain E033 is a strain in which the EXG1, EGH1, and SPR1 genes have been knocked out; the *Saccharomyces cerevisiae* strain E033 was constructed using the following method: S3-1. Design the corresponding sgRNAs for the EXG1, EGH1, and SPR1 genes, and construct multi-gene editing plasmids; S3-2. Using the Saccharomyces cerevisiae genome as a template, design homologous arms for the EXG1, EGH1, and SPR1 genes. S3-3. Transform the multi-gene editing plasmid and the homologous arm into Saccharomyces cerevisiae C800, and screen for positive clones, which are strains E033 with the plasmid eliminated.

2. A method for constructing the recombinant engineering bacteria of claim 1, characterized in that, The method for constructing the recombinant engineered bacteria 1 includes the following steps: A1. The gene fragments RPY26, TDH1p, OlRHM, Ter22, AtGT, ADH6p, SHM2p and Cs1,6-RhaT were sequentially linked to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT. A2. Connect the RPRS424, TDH1p and PGM2 fragments in sequence to obtain the PRS424-TDH1p-PGM2 plasmid; A3. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid and the PRS424-TDH1p-PGM2 plasmid were transferred into Saccharomyces cerevisiae strain E033 to obtain recombinant engineered strain 1. The method for constructing the recombinant engineered bacteria 2 includes the following steps: B1. The gene fragments RPY26, TDH1p, OlRHM, Ter22, AtGT, ADH6p, SHM2p and Cs1,2-RhaT are sequentially linked to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT. B2. Connect the RPRS424, TDH1p and PGM2 fragments in sequence to obtain the PRS424-TDH1p-PGM2 plasmid. B3. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT plasmid and the PRS424-TDH1p-PGM2 plasmid were transformed into Saccharomyces cerevisiae strain E033 to obtain recombinant engineered strain 2; the Saccharomyces cerevisiae strain E033 was constructed using the following method: S3-1. Design the corresponding sgRNAs for the EXG1, EGH1, and SPR1 genes, and construct multi-gene editing plasmids; S3-2. Using the Saccharomyces cerevisiae genome as a template, design homologous arms for the EXG1, EGH1, and SPR1 genes. S3-3. Transform the multi-gene editing plasmid and the homologous arm into Saccharomyces cerevisiae C800, and screen for positive clones, which are strains E033 with the plasmid eliminated. The sgRNA of EXG1 is shown in SEQ ID NO.6; the sgRNA of EGH1 is shown in SEQ ID NO.7; and the sgRNA of SPR1 is shown in SEQ ID NO.

8. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid in A1 was constructed using the following method: S1-1, The promoter TDH1p, gene OlRHM and terminator TER22 were respectively linked into fragment 1 by fusion PCR; S1-2, promoter ADH6p and gene AtGT are fused together by PCR to form fragment 2; S1-3, promoter SHM2p and gene Cs1,6-RhaT were fused together by PCR to form fragment 3; S1-4. Using a one-step cloning enzyme, fragment 1, fragment 2, fragment 3 and the linearized vector PY26 are ligated to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT. The PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,2-RhaT plasmid in B1 was constructed using the following method: Using the PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cs1,6-RhaT plasmid as a template, after linearization, it was ligated with the Cm1,2RhaT gene using a one-step cloning enzyme to obtain the plasmid PY26-TDH1p-OlRHM-ADH6p-AtGT-SHM2p-Cm1,2RhaT.

3. The use of the recombinant engineering bacteria of claim 1 in the synthesis of common flavonoid diglycosides in citrus, characterized in that, The method of application is as follows: Using sucralose, hesperidin, or geraniol as substrates, the recombinant engineered bacteria 1 was used to ferment and synthesize sucralose glycoside, hesperidin, or diosmin. Using sennaol, hesperidin, or naringenin as substrates, the recombinant engineered bacteria 2 were used to ferment and synthesize new North American sennaol, new hesperidin, or naringenin.

4. Use according to claim 3, characterized in that, The fermentation process specifically involves fermenting either recombinant engineered bacteria 1 or recombinant engineered bacteria 2 in a shaker at 30°C and 220 rpm for 72 h, with 400 mg / L of substrate added at the 12th hour of fermentation.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae gene engineering bacterium capable of utilizing xylose and glucose jointly as well as construction method and application of saccharomyces cerevisiae gene engineering bacterium

    CN106282040A

  • Skin protection composition comprising kaempferol glycoside compound

    CN115444778A