Pea root nodule bacteria for improving soil of tobacco field rotation and application thereof

CN117305182BActive Publication Date: 2026-09-25SICHUAN AGRI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202311356617.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-19
Publication Date
2026-09-25
Estimated Expiration
2043-10-19

AI Technical Summary

Technical Problem

[0013]仅基于对植物生长的促进效果进行鉴定导致无法明确区分不同的根瘤菌株,因为许多其他微生物或因素也促进植物生长

Benefits of technology

[0030]第一,与现有技术相比,本发明提供了一种特定的豌豆根瘤菌,专门用于改善烟地轮作土壤。此外,本发明还提供了一种详细的鉴定方法,包括基于基因的鉴定,这可以确保更准确和可靠地鉴定和分类菌株。因此,本发明能够更有效地应对烟地轮作土壤中的特定挑战,并确保所提供的菌株在实际应用中的稳定性和效果。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117305182B_ABST
    Figure CN117305182B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of agricultural microorganism technology, and discloses a pea rhizobium for improving tobacco field rotation soil and application thereof. The strain number of the pea rhizobium for improving tobacco field rotation soil is CP4-2, which was preserved in the China Typical Culture Collection Center of Wuhan University in Wuhan City, Hubei Province, China on October 23, 2017, and the preservation number is CCTCC M 2017616. The fast-growing rhizobium R.anhuiense CP4-2 of the present application is suitable for the ecological environment of Sichuan, and has good compatibility with the main pea varieties in Sichuan. The strain not only has high nitrogen fixation efficiency, but also has the ability to dissolve calcium phosphate, aluminum phosphate, iron phosphate and organic phosphorus lecithin, and has the promoting growth effect of secreting plant auxin. Meanwhile, the growth temperature range of the strain is wide, and the acid and alkali resistance is strong. After the pea green manure of inoculating CP4-2 is buried in the tobacco area soil, the soil quality can be obviously improved, and the pea-tobacco rotation production in Sichuan can be popularized and applied.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial technology, and in particular relates to a pea rhizobium that improves soil in tobacco rotation fields and its application. Background Technology

[0002] Currently, flue-cured tobacco, as an important component of modern agricultural production in my country, occupies a vital position in the national economy. Flue-cured tobacco is an economic crop that emphasizes both yield and quality; however, the pursuit of high yields has led to numerous problems in agricultural production. On the one hand, the long-term and excessive use of chemical fertilizers has resulted in declining tobacco leaf quality, soil compaction, and reduced soil fertility, becoming a bottleneck for the sustainable development of tobacco production. On the other hand, continuous cropping is prevalent in flue-cured tobacco production, and tobacco is extremely sensitive to this. Many studies have shown that continuous cropping of flue-cured tobacco causes soil nutrient imbalance, significant yield reduction, decreased tobacco leaf quality, and reduced aroma. Statistics show that continuous cropping of flue-cured tobacco in my country results in direct and indirect economic losses of up to 4 billion yuan annually, seriously threatening the sustainable development of the tobacco industry. Therefore, exploring reasonable fertilization methods, improving tobacco leaf quality, refining tobacco-growing soils, and paying attention to the impact of fertilization on the ecological environment are of paramount importance for the sustainable development of high-quality flue-cured tobacco production.

[0003] Green manure, as an important organic fertilizer, has received widespread attention in recent years for its cultivation and timely application in tobacco-growing areas. One invention patent (application number 201510175054.6) demonstrates that planting flue-cured tobacco the year after burying arrowroot green manure can improve soil nutrients, soil microbial biomass, and enzyme activity, thereby enhancing tobacco leaf quality, maintaining and improving soil quality, and promoting the sustainable development of flue-cured tobacco production in tobacco-growing areas. Studies have also shown that planting green manure during the winter fallow period in tobacco fields can fully utilize light and heat resources and conserve moisture, while also increasing the organic matter content in the soil.

[0004] my country boasts abundant and widely distributed green manure resources, totaling 98 species, including 72 legumes and 26 non-legumes. Among these, 32 species from 20 genera and 6 families are widely cultivated, with 26 legumes and 6 non-legumes. Furthermore, research indicates that legume green manures have higher fertilizer and feed value than non-legume green manures. Common legume green manures include arrowhead pea, purple vetch, pea, and milkvetch. Peas, as the world's second largest edible legume, are increasingly in demand both domestically and internationally due to their rich nutrition, versatility as both food and medicine, and dual use as grain, vegetable, and fertilizer. Moreover, peas thrive in shade, are drought-tolerant, and can tolerate poor soil conditions, exhibiting strong adaptability. In arid and semi-arid regions of many countries, peas are also an important crop for crop rotation, possessing excellent nitrogen-fixing capacity, with a nitrogen fixation rate reaching 75 kg / hm². 2This is equivalent to 375 kg of ammonium sulfate or 225 kg of urea. Meanwhile, peas, as green manure, can first be harvested as vegetable tips, green pea pods, and green pea seeds, generating economic value and making them more popular with farmers than other green manures.

[0005] Leguminous green manure requires interaction with corresponding rhizobia to form a symbiotic relationship in order to fully realize the advantages of a symbiotic nitrogen-fixing system. The establishment of this symbiotic relationship between rhizobia and leguminous plants is the result of interactions among bacteria, plants, and the environment, not merely a dialogue between bacteria and plants. Furthermore, this symbiotic relationship varies depending on regional geographical environments. Therefore, different regions should select suitable leguminous green manure crops and inoculate them with compatible, highly efficient rhizobia strains to maximize their biological nitrogen-fixing capabilities and provide greater value to modern agriculture. Previous studies have largely focused on the effects of green manure incorporation without matching rhizobia and the combined application of chemical fertilizers on the growth and economic traits of flue-cured tobacco. There were earlier invention patents for green manure incorporation in tobacco fields (application numbers 201711362671.2; 201510789710.1, 201711433694.8 (application in tobacco rotation soil)). However, there are many types of leguminous green manures, and the soil characteristics of different regions vary significantly. There are few reports on selecting suitable leguminous green manure crops and inoculating them with matching high-efficiency rhizobia strains to reduce the amount of chemical fertilizers used in tobacco fields. Therefore, conducting research on the matching of leguminous green manure rhizobia can provide some guidance for the selection of green manure-flue-cured tobacco rotation methods in tobacco-growing areas of Sichuan.

[0006] In tobacco production, winter fallow land and abundant light and heat resources can be fully utilized. High-quality leguminous green manure can be produced without chemical fertilizers, solely through inoculation with highly efficient rhizobia. After tilling and compaction, the soil is improved and fertilized for tobacco cultivation. This provides a scientific foundation for achieving zero or reduced fertilizer use in later flue-cured tobacco production, while also improving quality and efficiency. An earlier invention patent (application number 201210459188.7) for rotating purple vetch in tobacco-growing areas, however, did not use rhizobia inoculation during green manure growth; instead, it used superphosphate and urea to promote growth, increasing production costs and environmental pressure. Applying rhizobia inoculants promotes nodulation in leguminous plants, effectively increasing yield, reducing fertilizer use, lowering production costs, and improving soil fertility. In the leguminous green manure production process, only rhizobia inoculation is required, eliminating the need for any other fertilizers. However, there are few reports on the inoculation of rhizobia with leguminous green manure. To enhance the symbiotic nitrogen fixation of rhizobia, both the strain and the leguminous plant variety are two fundamental factors. The distribution of rhizobia populations is geographically limited; therefore, in the selection of rhizobia, it is necessary to consider their adaptability to the environment of the application area. The most effective rhizobia in a given region often come from strains originating in that region or from regions with similar conditions. Therefore, when selecting rhizobia strains, it is essential to consider not only the compatibility between the rhizobia and the leguminous plant variety but also the regional specificity of the inoculant application.

[0007] Prior Art 1: A soybean rhizobium that improves soil fertility in paddy fields. This soybean rhizobium promotes nitrogen fixation in paddy field soil, increasing soil nitrogen content. However, its identification method is based solely on morphological and biochemical characteristics.

[0008] Technical Issue 1:

[0009] Identification based solely on morphological and biochemical characteristics is insufficient for accurate identification of microbial strains, as many microorganisms are very similar in morphology and biochemical characteristics.

[0010] For nitrogen fixation in soil, relying solely on soybean rhizobia is insufficient to achieve the desired effect, especially under different soil types and environmental conditions.

[0011] Prior art 2: A rhizobium for enhancing plant growth, which helps plants absorb minerals and nutrients from the soil by living in symbiosis with plant roots. However, its identification method is based solely on its growth-promoting effect on plants and does not involve specific genetic identification.

[0012] Technical Issue 2:

[0013] Identifying plants solely based on their growth-promoting effects makes it impossible to clearly distinguish between different root nodule strains, as many other microorganisms or factors also promote plant growth.

[0014] Without genetic identification, it is difficult to determine the stability and adaptability of this rhizobium, especially under changing environmental conditions. Summary of the Invention

[0015] To address the problems existing in the prior art, this invention provides a pea rhizobium for improving soil in tobacco rotation fields and its application.

[0016] This invention is achieved as follows: a pea rhizobium that improves soil in tobacco rotation fields. The strain number of the pea rhizobium that improves soil in tobacco rotation fields is CP4-2, and its classification name is Rhizobium anhuiense CP4-2. It was deposited on October 23, 2017 at the China Center for Type Culture Collection (CCTCC) in Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC NO: M 2017616.

[0017] Another object of the present invention is to provide a method for identifying pea rhizobia in tobacco-rotation soils, the method comprising the following steps:

[0018] Step 1: Isolate and purify rhizobia from pea root nodules to determine the initial selected strains;

[0019] Step 2: Conduct hydroponic re-inoculation experiments on the initially selected strains to obtain the target strain CP4-2;

[0020] Step 3: Conduct stress resistance and growth-promoting tests on the target strain CP4-2.

[0021] Step four: Gene amplification and phylogenetic analysis of the target strain CP4-2 were performed to determine its taxonomic position.

[0022] Furthermore, in step one, rhizobia are isolated and purified from pea root nodules, and strains with typical rhizobium colony characteristics and Gram-negative cells that appear as small rods in Gram staining are selected.

[0023] Furthermore, in step two, hydroponic re-inoculation experiments were conducted on the initially selected strains using the main cultivated pea varieties in the target region to screen out strains that could form nodules and had strong nodulation ability and good symbiotic nitrogen fixation effect as the target strain CP4-2.

[0024] Furthermore, in step three, the target strain CP4-2 is subjected to stress resistance tests in terms of acid and alkali resistance, salt resistance, and growth temperature range, as well as growth-promoting tests in terms of IAA secretion capacity, phosphorus solubility, and potassium solubility.

[0025] Furthermore, in step four, total DNA was extracted from the target strain CP4-2, multiple housekeeping genes were sequenced, a phylogenetic tree was constructed, and the taxonomic position of the target strain CP4-2 was clarified.

[0026] Another object of the present invention is to provide a pea rhizobium inoculant for improving tobacco rotation soil, the pea rhizobium inoculant for improving tobacco rotation soil comprising the aforementioned pea rhizobium for improving tobacco rotation soil.

[0027] Another object of the present invention is to provide a microbial fertilizer for improving tobacco rotation soil, the microbial fertilizer for improving tobacco rotation soil comprising the aforementioned pea rhizobium inoculant for improving tobacco rotation soil.

[0028] Another object of the present invention is to provide the application of the pea rhizobium that improves tobacco rotation soil and / or the pea rhizobium agent that improves tobacco rotation soil in the preparation of products that improve tobacco rotation soil.

[0029] Based on the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solution to be protected by this invention are as follows:

[0030] First, compared with existing technologies, this invention provides a specific pea rhizobium strain specifically designed to improve tobacco rotation soils. Furthermore, this invention provides a detailed identification method, including gene-based identification, which ensures more accurate and reliable identification and classification of strains. Therefore, this invention can more effectively address specific challenges in tobacco rotation soils and ensure the stability and effectiveness of the provided strains in practical applications.

[0031] This invention provides a highly efficient nitrogen-fixing pea rhizobium strain, CP4-2. The strain's stress resistance and growth-promoting effects validate its application in the green manure-tobacco rotation system in Sichuan tobacco-growing areas. First, the invention uses conventional methods to isolate and purify rhizobia from pea root nodules, selecting strains with typical rhizobium colony characteristics, exhibiting small rod-shaped cells and Gram-negative staining. The initially selected strains are then subjected to hydroponic inoculation experiments with a major pea variety cultivated in Sichuan, screening for strains capable of nodulation with strong nodulation ability and good symbiotic nitrogen fixation, which are designated as the target strain, CP4-2. This invention conducts stress resistance tests on CP4-2, including acid and alkali tolerance, salt tolerance, and growth temperature range, as well as growth-promoting tests on its IAA secretion capacity, phosphorus solubility, and potassium solubility. Total DNA is extracted from strain CP4-2, and multiple housekeeping genes are sequenced to construct a phylogenetic tree, clarifying the taxonomic position of the target strain CP4-2. The strain CP4-2 provided by this invention was deposited on October 23, 2017, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC M2017616. This invention uses the target strain CP4-2 to prepare a rhizobium inoculant, which is then applied to pea green manure in Panzhihua and incorporated into tobacco-growing areas to improve soil.

[0032] Secondly, this invention provides a fast-growing rhizobium strain, *R. anhuiense* CP4-2, suitable for the ecological environment of Sichuan and with good compatibility with the main pea varieties cultivated in Sichuan. Strain *R. anhuiense* CP4-2 is a broad-spectrum, highly efficient strain with good compatibility with the main fresh pea variety (vegetable pea) cultivated in Sichuan. Strain *R. anhuiense* CP4-2 not only fixes nitrogen efficiently but also has the ability to dissolve calcium phosphate, aluminum phosphate, iron phosphate, and organophosphorus lecithin, and secretes plant growth hormones (IAA) to promote growth. Simultaneously, this strain has a wide growth temperature range and strong acid and alkali tolerance. Strain *R. anhuiense* CP4-2 is an excellent rhizobium suitable for the Panxi region. In pea production, inoculation with strain *R. anhuiense* CP4-2 significantly increased plant dry weight and root nodule number compared to the uninoculated control, and also showed a significant yield increase. The pea rhizobium strain *R. anhuiense*... Inoculating CP4-2 with pea green manure and then burying it in tobacco-growing areas can significantly improve soil quality and can be promoted and applied in pea-tobacco rotation production in Sichuan.

[0033] Third, the expected benefits and commercial value of the technical solution of the present invention after transformation are as follows: (1) The treatment PR+80%F, which involves turning over pea green manure inoculated with rhizobia and reducing the amount of chemical fertilizer by 20% during tobacco planting, has higher yield, output value, and proportion of high-grade tobacco leaves compared to the full chemical fertilizer treatment F. The yield increases by 19.66%, the output value increases by 30.16%, and the proportion of high-grade tobacco leaves increases by 78.70%. (2) Compared with the treatment P+80%F, which involves turning over pea green manure without inoculation with rhizobia and reducing the amount of chemical fertilizer by 20% after tobacco planting, the yield, output value, and proportion of high-grade tobacco leaves in the PR+80%F treatment are higher than those in the P+80%F treatment. The yield increases by 2.15%, the output value increases by 9.33%, and the proportion of high-grade tobacco leaves increases by 52.2%. (3) When green manure is used in Panzhihua tobacco fields, peas can be harvested at least once for fresh pods, which can be used as high-quality vegetables for early market and have considerable economic value. Therefore, especially after the African swine fever outbreak in recent years, farmers have raised fewer pigs and reduced the use of cattle for plowing. As a result, compared with other green manure crops, tobacco farmers now prefer to grow peas because peas can be harvested as vegetables such as pea shoots, tender pea pods, or fresh pea seeds. In the warmer Panzhihua-Xichang region, peas are high-quality vegetables for early market and are very popular with consumers, while also having good economic value. Peas treated with rhizobia showed a 1.2-fold increase in the yield of the first batch of tender pods compared to peas not treated with rhizobia, and the remaining yield used as green manure increased by 1 time. (4) Similarly, tilling the tobacco fields with leguminous green manure inoculated with rhizobia significantly improved soil fertility, significantly increased the pH of acidic soils, and significantly reduced the bulk density of relatively compacted soils. Compared with the F treatment, the organic matter of PR+80%F and P+80%F increased by 71.14% and 45.44%, respectively; total nitrogen increased by 25.61% and 20.73%, respectively; available phosphorus increased by 96.68% and 68.06%, respectively; and available potassium increased by 38.12% and 1.09%, respectively. The results showed that alkaline nitrogen increased by 37.49% and 14.50%, respectively; the number of culturable bacteria increased by 234.56% and 57.38%, respectively; the number of actinomycetes increased by 636.17% and 103.19%, respectively; and the number of fungi increased by 108.12% and 33.92%, respectively. Green manure inoculated with rhizobia and reduced fertilizer by 20% in flue-cured tobacco significantly increased the number of the three major microbial groups, showing a more significant increase than the uninoculated P+80%F treatment. In summary, green manure inoculated with rhizobia can more effectively increase the content of total nitrogen, organic matter, alkaline nitrogen, available phosphorus, and available potassium in the soil, improve the soil microbial community structure, and enhance soil fertility. In addition to reducing fertilizer by 20%, it also significantly improved the yield and quality of flue-cured tobacco. This patented technology achieves fertilizer reduction, increased yield, increased efficiency, and soil fertility improvement, demonstrating significant ecological and economic benefits.

[0034] The above results indicate that, in the Panzhihua experiment, with a 20% reduction in chemical fertilizers, incorporating green manure increased the proportion, yield, and value of high-grade flue-cured tobacco. Furthermore, incorporating green manure inoculated with rhizobia further enhanced these three aspects, resulting in a better overall effect.

[0035] Fifth, the technical solution of this invention fills a technical gap in the domestic and international industry: A: Superior rhizobia of other legumes in this region, such as Southwest China, cannot replace the pea rhizobia of this invention. This is because legume rhizobia have a certain host specificity. For example, in Example 6 of this patent, some of the patented superior rhizobia of soybeans, purple vetch, arrowhead peas, and broad beans from Sichuan did not form nodules when inoculated into peas, while others formed a small number of ineffective nodules. Only CP4-2, isolated and screened from peas, produced a large number of nodules when inoculated into peas, significantly promoting pea growth. B: Superior rhizobia isolated and screened from other regions are not suitable for the ecological environment of Sichuan. This is because the most effective rhizobia in a certain region often come from strains from that region or regions with similar conditions. Therefore, the regionality of the inoculant application must be considered when selecting superior rhizobia. The pea rhizobia screened in Southwest China is suitable for Southwest China, while superior pea rhizobia screened from other regions with significantly different ecological environments are often not suitable for Sichuan. C: There are currently no reports of pea rhizobia with field application value in Southwest China. In summary, the strain CP4-2 of this invention fills the gap in the field application value of superior pea rhizobia in Sichuan. Attached Figure Description

[0036] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0037] Figure 1 This is a flowchart of the method for identifying pea rhizobia to improve tobacco rotation soil provided in this embodiment of the invention;

[0038] Figure 2 This is a phylogenetic diagram of the 16S rDNA sequence of the highly efficient nitrogen-fixing broad-spectrum rhizobium CP4-2 provided in the embodiments of the present invention;

[0039] Figure 3 This is a phylogenetic diagram of the three housekeeping genes recA, atpD, and glnII of the highly efficient nitrogen-fixing broad-spectrum rhizobium CP4-2 provided in this embodiment of the invention. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0041] To address the problems existing in the prior art, the present invention provides a pea rhizobium for improving tobacco rotation soil and its application. The present invention will be described in detail below with reference to the accompanying drawings.

[0042] The pea rhizobium strain for improving tobacco rotation soil provided in this embodiment of the invention is CP4-2, which was deposited on October 23, 2017 at the China Center for Type Culture Collection, Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC M2017616.

[0043] like Figure 1 As shown, the method for identifying pea rhizobia in tobacco rotation soil provided in this embodiment of the invention includes the following steps:

[0044] S101, Isolation and purification of rhizobia from pea root nodules, and identification of preliminary selected strains;

[0045] S102, hydroponic re-inoculation test was conducted on the initially selected strains to obtain the target strain CP4-2;

[0046] S103, stress resistance test and growth promotion test were performed on the target strain CP4-2 respectively;

[0047] S104, gene amplification and phylogenetic analysis of the target strain CP4-2 were performed to determine its taxonomic position.

[0048] As a preferred embodiment, the method for identifying pea rhizobia in tobacco rotation soils provided by this invention specifically includes the following steps:

[0049] (1) Isolate and purify rhizobia from pea root nodules, and select strains with typical rhizobia colony characteristics, Gram staining results showing small rod-shaped cells and Gram-negative cells;

[0050] (2) Hydroponic inoculation experiments were conducted on the primary pea varieties in the target area to screen out strains that could form nodules, had strong nodulation ability, and had good symbiotic nitrogen fixation effect as target strain CP4-2.

[0051] (3) Conduct stress resistance tests on the target strain CP4-2, including acid and alkali resistance, salt resistance and growth temperature range, as well as growth-promoting tests on its ability to secrete IAA, solubilize phosphorus and potassium.

[0052] (4) Total DNA was extracted from the target strain CP4-2, and multiple housekeeping genes were sequenced to construct a phylogenetic tree and clarify the taxonomic position of the target strain CP4-2.

[0053] Sequence CP4-2 16S rDNA 1379nt

[0054]

[0055] CP4-2 atpD 495nt

[0056] atcggcgagccggtcgacgaagccggtccgctggtcaccgctcacaagcgcgccatccaccaggatgcgccgtcctatgtcgagcagtcgacggaatcgcagattctcgtcaccggcatcaaggtcgttgaccttctcgctccctatgcacgcggcggcaagatcggcctgttcggcggcgctggcgtcggcaagaccgttttgatcatggaactgatcaacaacgtcgccaaggcgcatggtggttattcggtttttgcgggcgtcggtgaacgtacccgcgaaggcaacgacctctatcacgaaatgatcgaatcgaacgtcaacaagcatggcggcggcgaaggttcgaaggctgcgctggtttacggccagatgaacgaaccgccgggcgcccgcgcccgtgtcgccctgaccggcctgacggtcgctgaacatttccgcgaccagggccaggacgttctgttcttcgtcgacaacatcttccgcttcacg

[0057] CP4-2 glnⅡ850nt

[0058] cgatgggtacactccggtaccgaacctgcgtggcaagacgcagatcaaggaattcgacgcattcccgacgctggaacagcttccgctctggggctttgacggctcctcgacgcagcaggctgaaggccgcagctccgattgcgtgctgaagccggttgccatctatcccgacccggcccgcaccaacggcgctctcgtcatgtgcgaagtcatgatgccggatggggtcacgccgcacgcatcgaatgcccgcgccaccatcctcgacgacgaagatgcctggttcggcttcgagcaggaatatttcttctaccagaacggccgtccgctcggcttccccgagcagggctacccggctccgcagggtccttactacaccggcgtcggctattcgaatgtcggcgacgtcgcccgcgaaatcgtcgaagaacatctcgacctctgcctcgctgccggcatcaatcacgaaggcatcaatgccgaagtggccaagggccagtgggaattccagattttcggcaagggctccaagaaggccgccgaccaaatctggatggcacgctacctcttgcagcgcctgaccgaaaagtatggcatcgacatcgagtatcattgcaagccgctcggtgacaccgactggaacggctcggggcatgcaatgatactcgatgtcgatgccatacttttcggtcaggcgctgcaagaggtagcgtgccatccagatttggtcggcggccttcttggagcccttgccgaagatctggaattgccactggcccttgggcacttcggcattgatgctttcgtgattgatgccggaagggaggcagagtttcagcagttccgggcg

[0059] CP4-2 recA 493nt

[0060] ctcgattatgaaactcggctccaacgagaacgttgtcgagatcgagacgatctcgaccggctcgcttggcctcgatatcgcacttggcgtcggcggcctgccgaggggccgcatcatcgaaat ttacgggccggaaagctccggtaaaacgacgcttgcgctgcagaccattgccgaagcgcagaaaaagggcggtatctgcgccttcgtcgatgccgagcatgcgctcgatcctgtctatgcccg caagcttggcgtcgatctgcagaaccttctgatctcgcagcccgataccggcgagcaggcgcttgaaatcaccgatacgctggtgcgctccggcgccgtcgacgtcctcgtcgtcgactcggt cgccgcactgacaccacgcgccgaaatcgaaggcgagatgggcgacagccttcccggcctgcaggcgcgcctgatgagccaggcgctgcgcaagctaaccgcttcgatctcgaagtcgaacacc

[0061] An application embodiment of the present invention provides a pea rhizobium inoculant for improving soil in tobacco rotation fields. The pea rhizobium inoculant for improving soil in tobacco rotation fields contains pea rhizobium.

[0062] An application embodiment of the present invention provides a microbial fertilizer for improving tobacco rotation soil, which includes a pea rhizobium inoculant for improving tobacco rotation soil.

[0063] The application embodiment of the present invention provides the application of pea rhizobium and / or pea rhizobium inoculant for improving tobacco rotation soil in the preparation of products for improving tobacco rotation soil.

[0064] Example 1: Isolation, purification, and re-inoculation test of pea rhizobium CP4-2

[0065] The peas were mainly grown in more than 10 cities and counties in Sichuan Province. Large, plump, red root nodules were selected from the main root of the pea plants during the flowering period. The nodules were cleaned, and harvested with some root bark intact. They were then dried with paper and placed in a small tube containing anhydrous calcium chloride and covered with absorbent cotton. Nearly 50 pea rhizobium strains were isolated and purified in this embodiment of the invention. All were fast-growing rhizobia. When cultured on YMA medium supplemented with Congo red, the bacteria did not absorb Congo red; the colonies were small, round, milky white, viscous, highly raised, and not turbid. Gram staining and microscopic examination revealed Gram-positive results. - It appears as small rods. In a re-inoculation experiment with a local green pea variety, CP4-2 was found to be the best match. The collection, isolation, purification, and re-inoculation methods for CP4-2 are as follows:

[0066] Pea root nodules collected in Qingyi Town, Fucheng District, Mianyang City, Sichuan Province were cleaned, removed with some root bark attached, and the surface moisture was absorbed with absorbent paper. They were then placed in a small tube containing anhydrous calcium chloride and covered with absorbent cotton. The following procedures were performed in the laboratory: The collected root nodules were soaked in sterile water to absorb swelling, then soaked in 95% ethanol for 30 seconds to eliminate surface tension. Next, they were surface-sterilized with 0.1% (w / v) mercuric chloride for 5 minutes, and then rinsed with sterile water 6-8 times. Under aseptic conditions, individual root nodules were broken open and streaked on YMA medium containing Congo red (mannitol 10g, yeast powder 0.8g, KH2PO4 0.25g, MgSO4·7H2O 0.2g, CaCl2·6H2O 0.1g, NaCl 0.1g, 1% (w / v) sodium molybdate 2mL, 1% (w / v) boric acid 2mL, 1% (w / v) Congo red 2.5mL, pH 6.8-7.0, agar 18-20g, water 1000mL). The nodules were then incubated in a constant temperature incubator at 28℃.

[0067] The isolated and purified strain CP4-2 provided in this embodiment of the invention is a fast-growing rhizobium. When cultured on YMA medium supplemented with Congo red, the bacteria do not absorb Congo red; the colonies are small, round, milky white, viscous, highly raised, and slightly transparent, growing in 2-3 days. Gram staining and microscopic examination show it to be Gram-positive. - It is shaped like a small rod.

[0068] More than 40 isolated and purified rhizobium strains were matched with local fresh pea varieties from Panzhihua City, Sichuan Province, for sand culture re-inoculation experiments. The experiments were conducted in a light chamber (temperature controlled at 22–24℃, light intensity approximately 2800 lux, day length 14 h / d). Sterilized nitrogen-free nutrient solution was added periodically. 300 mL plastic cups were used as the sand culture containers, and vermiculite was used as the substrate. Uninoculated plants of the same variety served as the control (CK). Each treatment was replicated three times. After harvest, the number of root nodules and the dry weight of the pea plants were used to evaluate the inoculation effect of the rhizobium.

[0069] (1) Bacterial culture: Rhizobium CP4-2 was inoculated into YMA liquid medium and placed on a shaker at 120 rpm / min and cultured at 28°C until the logarithmic growth phase (about 3 days).

[0070] (2) Seed germination: Select large, plump, and undamaged pea seeds, soak them in 95% alcohol for 5 minutes, pour off the alcohol, add mercuric chloride (0.1%) and soak for surface disinfection for 5 minutes. Finally, rinse with sterile water 6-8 times, 5 minutes each time. Finally, scatter the seeds on sterilized sawdust for germination at a temperature of 25℃. Sow the seeds when the radicle has just emerged (indicating that the seeds are viable).

[0071] (3) Preparation of sand culture container: Select a 300mL plastic cup as a sand culture container. First, add the sterilized vermiculite into the plastic cup of the sterilizer, filling the cup to 3 / 4 of its volume. Then, add sterile nitrogen-free nutrient solution to keep the vermiculite moist. Sterilize the plastic cup and vermiculite separately. Select quartz sand with a particle size of 2-4mm and spread it on the surface of the vermiculite. The quartz sand also needs to be sterilized before use.

[0072] (4) Nitrogen-free nutrient solution formula: 0.46g calcium sulfate, 0.136g dipotassium hydrogen phosphate, 0.075g potassium chloride, 0.075g ferric citrate, 0.06g magnesium sulfate, 0.03g calcium nitrate, 1000mL distilled water, 1mL trace element solution.

[0073] (5) Trace element solution formula: 2.86g boric acid, 1.81g manganese sulfate, 0.8g copper sulfate, 0.22g zinc sulfate, 0.02g molybdic acid, plus distilled water to 1000mL.

[0074] (6) Planting and index measurement: Germinated seeds were planted in plastic cups filled with vermiculite, and 2 mL of bacterial solution was gently pipetted onto the vicinity of the pea roots. A control (CK) of the same variety was also included without inoculation. CK plants were planted first. Each treatment was repeated three times. The experimental results showed that CP4-2 was the strain with the best matching to the local pea variety. The results of the sand culture experiment of CP4-2 are listed in Table 1.

[0075] Table 1 shows that Rhizobium CP4-2 exhibited good nodulation ability in the tested peas. Compared with the control group without Rhizobium inoculation, CP4-2 increased the dry weight, fresh weight, and plant height of pea plants by 74.6%, 54.0%, and 31.3%, respectively. Therefore, Rhizobium CP4-2 is a superior and highly efficient strain well-matched with local pea varieties in Panzhihua City that are harvested for green seeds.

[0076] Table 1. Results of hydroponic experiments with local pea varieties inoculated with Rhizobium CP4-2.

[0077]

[0078] Note: The data is the average of three repetitions.

[0079] Example 2: Stress resistance of Rhizobium CP4-2

[0080] The stress resistance of rhizobium CP4-2 was mainly determined by its salt tolerance, acid and alkali tolerance, and optimal growth temperature range. YMA medium was used as the basal medium, with YMA plates cultured at pH 7 and 28℃ for 4 days serving as a positive control (CK). The YMA slant cultures of rhizobium CP4-2 were prepared as bacterial suspensions by scraping with sterile water. Spot inoculation was used, with each treatment repeated three times. The results of acid and alkali tolerance tests, salt tolerance tests, and optimal growth temperature range determinations were observed and recorded after 4 days of culture at 28℃.

[0081] (1) Formula of culture medium for acid and alkali resistance test: YMA medium is used as the base medium, and the pH value is adjusted by HCl and NaOH to make the pH value of the medium 4.0, 5.0, 6.0, 8.0, 9.0, 10.0 and 11.0 respectively.

[0082] (2) Salt tolerance test culture medium formulation: YMA medium with NaCl removed is used as the base culture medium. The NaCl concentration is set to 0.2%, 0.4%, 0.6%, 1.0%, 1.5%, 2.5%, 3.5%, 4.5% and 6%.

[0083] (3) Determination of growth temperature range: The strain was inoculated on YMA medium and a total of 7 temperature treatments were set up. The strain was cultured for 9 days in biochemical incubators at 4℃, 10℃, 15℃, 20℃, 28℃, 35℃ and 45℃.

[0084] The experimental results show that Rhizobium CP4-2 has strong acid and alkali resistance and can grow on plates with pH 4 to 11, but its growth is severely inhibited at pH 4; it has a certain salt tolerance and can grow on YMA plates with NaCl 0.2% to 0.6%; it has a wide growth temperature range and can grow in the temperature range of 15 to 45℃.

[0085] Example 3: Growth-promoting ability of Rhizobium CP4-2

[0086] The growth-promoting ability of the rhizobium CP4-2 was mainly investigated by examining its ability to secrete plant growth hormone (IAA), solubilize phosphorus, and solubilize potassium.

[0087] (1) Determination of the ability to secrete auxin

[0088] The ability of rhizobia to secrete plant growth hormone (IAA) was determined by colorimetry. The assay medium was a modified Congo red liquid medium with the following composition: 10g mannitol, 1g yeast extract, 1g NH4NO3, 0.5g K2HPO4·3H2O, 0.2g MgSO4·7H2O, 0.1g NaCl, 10mL Congo red (0.25%), 100mg L-tryptophan, 1000mL distilled water, pH 7.0. The colorimetric solution consisted of 31mL 0.5M FeCl3, 30mL concentrated H2SO4, and 50mL distilled water.

[0089] The strain was inoculated into an Erlenmeyer flask containing 50 mL of culture medium and cultured on a shaker at 160 rpm / min and 28℃ for 7 days, with three replicates. After centrifugation at 8000 rpm / min for 10 min, 10 mL of the bacterial solution was collected, and 10 mL of colorimetric solution was added. After incubation in the dark for 30 min, the OD value was measured at a wavelength of 530 nm using a UV spectrophotometer. The IAA content was calculated based on the standard curve. The standard curve was prepared by using IAA stock solution to prepare a series of standard solutions with concentrations of 0, 5, 10, 20, and 40 mg / L as working solutions. The colorimetric determination results showed that rhizobium CP4-2 secreted 28.99 mg / L of IAA, indicating that rhizobium CP4-2 also has the ability to secrete IAA.

[0090] (2) Ability to dissolve organic and inorganic phosphorus phosphorus

[0091] The ability of the strain to solubilize organic and inorganic phosphorus was determined using the phosphate solubility zone method. The organic phosphorus source was lecithin, and the three inorganic phosphorus sources were calcium phosphate, aluminum phosphate, and iron phosphate. All reagents were commercially available analytical grade. Mongkina agar and PKO agar plates were prepared, and the strain preparation and inoculation methods were the same as in Example 3 for the stress resistance test. Each treatment was repeated three times. After incubation at 28°C for 7 days, the colony diameter was measured and compared with the colony diameter of the 28°C YMA control.

[0092] ① The culture medium with the ability to dissolve organophosphorus compounds uses the following Monkina medium formula (g / L): 10g glucose, 5g CaCO3, 0.5g (NH4)2SO4, 0.4g yeast extract, 0.3g KCl, 0.2g lecithin, 0.3g NaCl, 0.03g MnSO4·4H2O, 0.03g FeSO4·7H2O, 20g agar, 1000mL distilled water, pH 7.0–7.5. The lecithin is dissolved in 75% ethanol by heating, sterilized separately, and then mixed with the sterilized culture medium cooled to approximately 60°C before being poured into plates.

[0093] ② The PKO medium formula (g / L) for dissolving inorganic phosphorus is as follows: 10g glucose, 3.0g Ca3(PO4)2 or AlPO4·2H2O or FePO4·2H2O, 0.5g (NH4)2SO4, 0.2g KCl, 0.2g NaCl, 0.03g MnSO4, 0.03g MgSO4·7H2O, 0.003g FeSO4·7H2O, 0.5g yeast extract, 20g agar, 1000mL distilled water, pH 7.0–7.5. Calcium phosphate, aluminum phosphate, and iron phosphate are ground in a mortar and pestle, passed through a 300-mesh sieve, and sterilized separately by dry heat. They are then mixed with the medium, which has been sterilized to approximately 60℃, and poured into plates.

[0094] The results showed that Rhizobium CP4-2 had the ability to dissolve both organic and inorganic phosphorus sources. The ratios of colony diameters measured on lecithin, calcium phosphate, iron phosphate, and aluminum phosphate plates to the colony diameters of the 28℃ YMA control were 1.13, 0.96, 0.75, and 0.75, respectively. This indicates that strain CP4-2 has a good ability to dissolve organic phosphorus and calcium phosphate, and a certain ability to dissolve iron phosphate and aluminum phosphate.

[0095] (3) Potassium solubility

[0096] The potassium-solubilizing medium used was a potassium-free medium (1L): 10g sucrose, 0.5g MgSO4·7H2O, 0.1g NaCl, 0.5g yeast extract, 20g agar, 1000mL distilled water, pH 7.0–7.5. The purified strain was inoculated onto the potassium-solubilizing solid medium and incubated at 28℃ for 7 days. The colony diameter d was then measured and compared with the colony diameter D of the 28℃ YMA control. The potassium-solubilizing characteristics of the strain were qualitatively determined based on the d / D ratio.

[0097] The results showed that Rhizobium CP4-2 had a strong ability to dissolve potassium ore powder. The ratio of the colony diameter measured on the plate to the colony diameter of the 28℃ YMA control was 1.45.

[0098] Example 4: Amplification and phylogenetic analysis of the 16S rRNA gene and other housekeeping genes recA, atpD, and glnII of Rhizobium CP4-2.

[0099] Total DNA was extracted from strain CP4-2, and the four genes mentioned above were amplified by PCR using the primers shown in Table 2. The PCR reaction was performed using Bio-RAD MyCycler. TM After the PCR amplification products were detected by 1.0% agarose gel electrophoresis, they were sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing. The gene amplification primers of this invention are listed in Table 2. Gene sequence similarity was calculated using DNAman 7.0 software.

[0100] Table 2. PCR primers used in this experiment

[0101]

[0102]

[0103] Note: Y=C or T, H=A, C or T, R=A or G, S=C or G, K=G or T, N=A, C, G or T, I=inosine, M=A or C, N=any base.

[0104] (1) Amplification of 16S rDNA and construction of phylogenetic tree

[0105] Using total DNA as a template, 16S rDNA was amplified using the universal primers P1 and P6 listed in Table 2. The PCR reaction system (50 μL) consisted of 25 μL of 2×PCR Mix, 1 μL each of primers P1 and P6 (20 μM), 1 μL of DNA template, and ultrapure water to a final volume of 50 μL. PCR conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 1 min, 56℃ annealing for 30 s, 72℃ extension for 1 min, repeated 30 times; and a final extension at 72℃ for 10 min. The amplified products were analyzed using the above method, and the sequencing results from Chengdu Qingke Zixi Biotechnology Co., Ltd. are shown in SEQ ID No. 1.

[0106] The 16S rDNA sequences of the obtained CP4-2 strain were aligned with EzTaxon. A highly similar type strain was selected as the reference strain to construct a phylogenetic tree. The 16S rDNA phylogenetic tree was constructed using the neighbor-joining method in Mega7 software, with a bootstrap value of 1000. The phylogenetic tree is shown below. Figure 2 .

[0107] (2) Construction of a combined phylogenetic tree of multi-site gene sequences

[0108] To further and more accurately determine the taxonomic position of the pea rhizobium CP4-2, the housekeeping gene sequences recA, atpD, and glnII at three additional loci were selected to construct a combined phylogenetic tree.

[0109] Primers recAF2 and recAR2 were used to amplify recA, primers atpDF3 and atpDR were used for atpD, and primers glnII-5 and glnII-6 were used for glnII. The primer sequences are shown in Table 2. The reaction system was 50 μL, and the reaction solution composition was as follows: 2×PCR Mix 25 μL; 0.5 μL each of 10 mM forward and reverse primers; DNA template 1 μL; ddH2O 23 μL. (1) The PCR amplification reaction program for recA and atpD was the same: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 45 s, 60℃ annealing for 1 min, 74℃ extension for 1.5 min, 30 cycles; 74℃ final extension for 6 min. (2) glnII amplification conditions: 92℃ pre-denaturation for 3 min; 94℃ denaturation for 1 min, 55℃ annealing for 1.5 min, 72℃ extension for 2 min, 30 cycles; 72℃ final extension for 10 min. The amplified products were detected using the above method and then sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing. Two-way sequencing (forward and reverse primer sequences) was performed on each gene. The forward and reverse primer sequences were then assembled using DNAman 7.0 software. After removing the forward and reverse primer sequences, the recA, atpD, and glnII sequences were obtained with sizes of 493 nt, 495 nt, and 850 nt, respectively. The sequence results are shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4, respectively.

[0110] The obtained sequence results were compared with those obtained from the National Center for Biotechnology Information (NCBI) in the United States. The type strain with the highest sequence similarity to the housekeeping genes at the recA, atpD, and glnII sites of *Rhizobium anhuiense* CCBAU 23252 was found to be the same strain. T The similarity to the model strain was 100%, 100%, and 100%, respectively. Based on the comparison results of each gene sequence on NCBI, the model strains with high gene similarity were selected as reference strains for tree construction.

[0111] Construction of a combined phylogenetic tree for three genes (recA, atpD, and glnII): First, the sequences of the three housekeeping genes (recA, atpD, and glnII) were aligned with the corresponding gene sequences of the reference strain using MEG7. The sequences were then trimmed to the minimum length and saved in FASTA format. The three sequences were opened with Notepad and concatenated. The combined phylogenetic tree was constructed using the neighbor-joining method in MEGA7 software, with a bootstrap value of 1000. The combined phylogenetic tree for recA, atpD, and glnII is shown below. Figure 3 As shown.

[0112] Depend on Figure 2and Figure 3 The results showed that the 16S rRNA gene of CP4-2, as well as the combined sequences of the three housekeeping genes recA, atpD, and glnII, were associated with R. anhuiense CCBAU 23252. T On the same branch node. As analyzed previously, the strain is similar to the type strain R. anhuiense CCBAU 23252. T The similarity of these three genes is 100%, indicating that strain CP4-2 belongs to the genus R. anhuiense.

[0113] Example 5: Field planting effect and green manure incorporation effect

[0114] (1) Field insemination experiment

[0115] The field trial was conducted at the Laowangba flue-cured tobacco base in Matou Village, Pingdi Town, Renhe District, Panzhihua City. The experiment was designed with three treatments: P (peas without rhizobium inoculation), PR (peas inoculated with rhizobium, where R is the rhizobium CP4-2 inoculant prepared in Example 5 of this invention), and CK (winter fallow land, without green manure planting). No chemical fertilizers were applied to any of the treatments. Plump pea seeds (local variety, primarily harvested for fresh green peas, with the remaining green plants used as green manure or cattle fodder) were selected. The prepared pea rhizobium CP4-2 inoculant (3.1 × 10⁻⁶ viable cells) was inoculated into the seeds. 8 CFU / g inoculant was used to treat pea seeds at a rate of 14 kg / mu, with an inoculant dosage of 1 kg / mu. Sowing was done on October 7, 2015. Before sowing, the experimental plot was tilled using a rotary tiller, and then the seeds on the soil surface were turned into the soil using the same tiller. No chemical fertilizers were applied during the pea growth process. Appropriate drainage ditches were dug to ensure both drainage and irrigation. On February 28, 2016, the peas were at the harvest period for the first batch of effective fresh pods, while still flowering. The fresh pods harvested at this time were highly sought-after, early-marketed, and high-quality vegetables. In other parts of Sichuan, peas had not yet flowered or formed pods, making them a high-value, economically viable vegetable. However, to better utilize peas as green manure to improve soil fertility and to reduce fertilizer application for summer tobacco while maintaining high yield and quality, the peas were plowed into the field after the first batch of effective fresh pods were harvested. For ease of description, this period is referred to as the plowing period. This invention evaluates the inoculation effect of rhizobium during the plowing period. This invention first measures the actual yield of fresh pods in the plot, and then samples are taken. Sampling method: Using a 20cm × 30cm sampling frame, roots and root nodules of the above-ground plants and topsoil are collected from each plot. Three frames are randomly collected from each plot for yield measurement. Plant height, fresh grass yield, root yield, and root nodule number are measured using conventional methods to calculate nitrogen, phosphorus, and potassium accumulation. Nutrient accumulation (kg / hm²) 2 = Hay yield (kg / hm) 2 ) × Nutrient content%.

[0116] Table 3. Effects of pea inoculation with rhizobium CP4-2

[0117]

[0118] The inoculation effects are shown in Table 3. When peas were turned over and compacted, PR (presumably a specific type of pea) resulted in a 1.2-fold increase in young pod yield, a 1-fold increase in fresh grass yield, an 89.2% increase in dry grass yield, a 1.8-fold increase in root yield, a 90.3% increase in root nodule number, and an 18.5% increase in plant height compared to P (presumably a specific type of pea). This indicates that winter planting of peas in Panzhihua tobacco fields, inoculated with rhizobium CP4-2, significantly improves fresh pod yield, root nodule rate, root yield, green manure yield (fresh grass yield), or forage yield (dry grass yield). Due to the economically beneficial yield of young pea pods, pea cultivation is more popular among tobacco farmers than other green manure methods.

[0119] Table 4. Effects of Rhizobium inoculation on nutrient accumulation in pea plants.

[0120]

[0121] Table 4 shows the nutrient accumulation of pea plants during the green manure turning period. The total nitrogen, total phosphorus, and total potassium accumulation of PR plants increased by 123.5%, 162.3%, and 103.8%, respectively. It can be seen that after being turned into green manure and decomposed, nitrogen, phosphorus, potassium and other nutrients are released for use by the subsequent tobacco crop, which can partially replace chemical fertilizers in tobacco planting.

[0122] In summary, inoculation of peas with rhizobium CP4-2 significantly promotes pea growth, increases biomass and nodule formation, and substantially enhances nitrogen, phosphorus, and potassium accumulation in peas. Therefore, CP4-2 is a superior pea rhizobium that is well-matched with local pea varieties in Panzhihua and is suitable for the Panzhihua region.

[0123] (2) Effects of inoculating green manure with rhizobia on soil fertility in tobacco fields

[0124] On February 28, 2016, a rotary tiller completely tamped down the flowering peas into the soil to a depth of 10-20 cm. Peas treated with rhizobium (PR) and those not treated with rhizobium (P) were tamped down as green manure. The bare soil (CK) was also tamped down using the same method. Flue-cured tobacco was planted on May 8, 2016. Fertilization was carried out according to the recommended program of Panzhihua Tobacco Company.

[0125] The experimental design corresponded to the green manure season, with three treatments, as shown in Table 5. Treatment F was the winter fallow treatment where no green manure was planted. During the flue-cured tobacco season, fertilization was carried out according to the recommended methods and amounts by the local tobacco company, also known as full-scale fertilization. The other two treatments involved green manure cultivation. The fertilization and management methods were the same as treatment F, but the amounts of basal fertilizer, seedling fertilizer, and fertilizer applied after removing the mulch were all reduced by 20%, which is 80% of that in treatment F.

[0126] Table 5. Tobacco Season Management Settings

[0127]

[0128] Each treatment was repeated 3 times, for a total of 9 cells. Each cell was 6m long and 4m wide, with a cell area of ​​24m². 2 The planting area is spaced 1 meter apart, with 5 rows of tobacco plants per area and 8 plants per row. The tobacco planting density is 16,667 plants per hectare. 2 .

[0129] Soil samples were collected from the topsoil layer on September 6, 2016, the day after the tobacco harvest. Soil bulk density was determined using undisturbed soil samples. The number of the three major microbial groups in fresh soil was determined using the dilution plate colony isolation method. The physicochemical properties of air-dried soil were determined using conventional methods.

[0130] Table 6. Effects of peas inoculated with rhizobia on the physicochemical properties of tobacco-growing soil.

[0131]

[0132] The main physicochemical properties of the soil are listed in Table 6. Table 6 shows that after green manure was turned in, the soil physicochemical properties were significantly altered after tobacco harvesting due to decomposition and mineralization. Green manure inoculated with rhizobia significantly reduced soil bulk density (P<0.05) and effectively increased the pH of acidic soils. Compared with the F treatment, the PR+80%F and P+80%F treatments showed increases in organic matter of 71.14% and 45.44%, total nitrogen of 25.61% and 20.73%, available phosphorus of 96.68% and 68.06%, available potassium of 38.12% and 1.09%, and available nitrogen of 37.49% and 14.50%, respectively. This indicates that green manure inoculated with rhizobia can more effectively increase the content of total nitrogen, organic matter, available nitrogen, available phosphorus, and available potassium in the soil, thereby improving soil fertility.

[0133] Table 7. Effects of green manure inoculated with rhizobia on the abundance of the three major groups of soil microorganisms (CFU / g)

[0134]

[0135] The results of the determination of culturable microorganisms (bacteria, actinomycetes, and fungi) in tobacco-growing soil are shown in Table 6. Table 6 shows that compared with the F treatment, the PR+80%F and P+80%F treatments increased the number of culturable bacteria by 234.56% and 57.38%, respectively; the number of actinomycetes by 636.17% and 103.19%, respectively; and the number of fungi by 108.12% and 33.92%, respectively. It can be seen that the 20% reduction in fertilizer application during flue-cured tobacco planting and the inoculation of pea green manure with rhizobia significantly increased the number of these three major microbial groups, showing a more significant increase than the uninoculated P+80%F treatment.

[0136] (3) The effects of green manure inoculation with rhizobia on the yield and quality of flue-cured tobacco

[0137] The tobacco harvesting was conducted in six phases from July 14, 2016 to September 5, 2016, from bottom to top. Each plot was harvested, cured, and calculated individually. After curing, professional technicians graded the tobacco leaves, weighed them by plot, and calculated the yield of each treatment. The average price and output value of the tobacco were calculated based on the "2016 Tobacco Purchase Price List," and the results are listed in Table 8.

[0138] Table 8. The impact of green manure on flue-cured tobacco yield and economic benefits.

[0139]

[0140] Table 8 shows that compared with the F treatment, the PR+80%F and P+80%F treatments had higher yields, output values, and the proportion of high-grade tobacco. Yields increased by 19.66% and 17.14%, respectively; output values ​​increased by 30.16% and 19.05%, respectively; and the proportion of high-grade tobacco increased by 78.70% and 17.39%, respectively. These results indicate that, with a 20% reduction in chemical fertilizers, turning in green manure can increase the proportion of high-grade tobacco, yield, and output value in Panzhihua flue-cured tobacco. Turning in green manure inoculated with rhizobia further enhances the proportion of high-grade tobacco, yield, and output value, resulting in a better overall effect.

[0141] Rotating peas in tobacco fields solves the problem of idle land in tobacco-growing areas during winter and makes full use of light and heat resources. Peas are inoculated with rhizobium inoculants, requiring no other fertilizers, making it environmentally friendly. Rotating peas in tobacco-growing soils with rhizobium-inoculated soil effectively increases soil organic matter, available phosphorus, available nitrogen, and available potassium content, and also increases the number of the three major types of microorganisms in the soil, improving the soil microbial community structure and achieving soil fertility. This invention provides a method for soil fertility improvement through pea + rhizobium rotation in tobacco fields in Panzhihua and even Sichuan, contributing to the production of flue-cured tobacco in Sichuan.

[0142] Example 6: Compatibility of rhizobia from other legume species in Sichuan with Sichuan peas

[0143] Can patented strains of highly efficient rhizobia suitable for the Sichuan habitat of soybean, broad bean, leguminous green manure sweet potato, and arrowhead pea form nodules and efficiently fix nitrogen in peas? To this end, typical patented strains of these bean varieties and the aforementioned strains were used as test strains for a compatibility test with "Taiwan Changshouren," another widely cultivated variety in Sichuan that is commonly harvested for its fresh seeds as vegetables. Seeds of "Taiwan Changshouren" peas with similar seed coat size and color were selected and surface-sterilized. After soaking the seeds in sterile water overnight, they were sown on sterilized vermiculite for germination (25℃), with sterile water added as needed. Seeds with newly emerged radicles were planted in the upper plastic cup of a double-layered pot, one seed per cup, and inoculated with CP4-2 and other patented strains of other bean varieties (cultured in YMA liquid culture on a shaker at 28℃ and 120 r / min until the logarithmic growth phase). The uninoculated rhizobia treatment served as a control (CK). Each treatment was repeated three times. The plants were cultivated in a light chamber (temperature 22-24℃, light intensity of about 3500 lux, day length 12h / d) for 36 days before harvest. During the cultivation period, sterile low-nitrogen nutrient solution was added regularly. After harvest, plant height, root nodule number and plant dry weight were measured. The experimental results are listed in Table 9.

[0144] Table 9. Results of cross-nodulation tests between CP4-2 and other major patented strains of Sichuan beans and peas.

[0145]

[0146] The results in Table 9 show that inoculating peas with four soybean rhizobia did not result in nodulation and had no effect on pea growth; four broad bean rhizobia could induce nodulation in peas, but the number of nodules was low and their effect on pea growth was ineffective or negligible; six *Vicia sativa* rhizobia resulted in nodulation of 0–23 nodules / plant in peas, with two strains slightly increasing the dry weight of pea plants, while the other six strains decreased the dry weight of pea plants by 1.9%–14.3%, all of which were ineffective or negligible; three *Vicia vetch* rhizobia resulted in nodulation of 0–18.9 nodules / plant in peas, with two strains decreasing the dry weight of pea plants by 2.1%–25.7%, and one strain slightly increasing the dry weight of pea plants by 4.3%. This indicates that the soybean, broad bean, *Vicia sativa*, and *Vicia vetch* rhizobia used in these patented incurable strains in Sichuan are incompatible with peas, meaning they are ineffective or ineffective strains for peas. Only strains isolated and screened from peas are highly efficient for pea growth.

[0147] Example 7: Preservation and use of pea rhizobia

[0148] (1) Preservation: Pea rhizobium strain CP4-2 has been preserved at the China Center for Type Culture Collection (CCTCC) at Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC M 2017616. This strain is used to improve soil in tobacco rotation fields.

[0149] (2) Application: When it is necessary to improve the soil of tobacco rotation, this strain can be obtained from the preservation center. First, the strain is cultured and amplified in the laboratory using an appropriate culture medium. Then, the cultured pea rhizobium is inoculated into the tobacco rotation soil to form a symbiotic relationship with the roots of pea plants, thereby improving soil texture and fertility.

[0150] Example 8: Identification method of pea rhizobia

[0151] (1) Step 1: Isolation and purification of rhizobia in pea root nodules. This can be accomplished using aseptic techniques and appropriate culture media. The goal of this step is to obtain purified rhizobia samples for further research.

[0152] (2) Step Two: Preliminary identification of the selected strains through hydroponic re-inoculation experiment. In this step, the purified rhizobium was inoculated onto sterile pea plants and cultured under hydroponic conditions to observe whether it could form root nodules in the pea roots.

[0153] (3) Step 3: Conduct stress resistance and growth promotion tests on the target strain CP4-2. For example, the stress resistance of the strain can be tested by setting different environmental stress conditions (such as acid-base, salt stress, etc.); the growth promotion of the strain can be tested by its ability to secrete IAA, solubilize phosphorus and potassium.

[0154] (4) Step 4: Gene amplification and phylogenetic analysis of the target strain CP4-2. The 16S rRNA gene of the strain can be amplified by PCR and sequenced. Then, the taxonomic position of the strain is determined by constructing a phylogenetic tree by comparing it with the 16S rRNA gene, housekeeping genes recA, atpD, and glnII sequences of known rhizobia in the database.

[0155] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A pea rhizobium for improving soil in tobacco rotation fields, characterized in that, The strain number of pea rhizobium that improves soil in tobacco rotation fields is R. anhuiense CP4-2 was deposited on October 23, 2017, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC M 2017616.

2. A pea rhizobium inoculant for improving soil in tobacco rotation fields, characterized in that, The pea rhizobium inoculant for improving tobacco rotation soil contains the pea rhizobium as described in claim 1.

3. A microbial fertilizer for improving soil in tobacco rotation fields, characterized in that, The microbial fertilizer for improving tobacco rotation soil includes the pea rhizobium inoculant for improving tobacco rotation soil as described in claim 2.

4. The use of a pea rhizobium inoculant for improving tobacco rotation soil as described in claim 1 and / or a pea rhizobium inoculant for improving tobacco rotation soil as described in claim 2 in the preparation of a product for improving tobacco rotation soil.

Citation Information

Patent Citations

  • Method for planting and tilling and compacting green manure in advance in soil of tobacco-growing area

    CN102907242A

  • Method for ecologically improving tobacco-planting soil

    CN104813769A

  • Method for three-stage in-situ application of green fertilizer in tobacco field

    CN109923984A

  • Vicia sativa rhizobium strain VS5-1 and application thereof

    CN107881134A

  • Method for reducing fertilizer application amount and improving effect in process of planting tobaccos in Sichuan region

    CN108029495A