Mutant for improving enzyme activity of arginine deiminase and application thereof

Abstract

The application discloses a mutant of arginine deiminase with improved enzyme activity and application thereof, and belongs to the technical field of genetic engineering and enzyme engineering in molecular biology. The amino acid sequence of the arginine deiminase mutant is shown as SEQ ID NO. 2-9. The known arginine deiminase gene is subjected to molecular modification by using a site-directed mutagenesis technique, and mutant enzymes F44W, N163P, E220I, E220L, N318E, A336G, T340I and N382F are obtained. The catalytic activity of the series of mutant enzymes provided by the application is increased by 1.04-2.35 times compared with that of the original bacteria, and the mutant enzymes have good stability. The mutant enzymes can be used for the biological preparation of arginine deiminase and in vitro citrulline, and have a potential application prospect.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and enzyme engineering, specifically to mutants that enhance the activity of arginine deiminase and their applications. Background Technology

[0002] Arginine deiminase (EC 3.5.3.6), abbreviated as ADI, catalyzes the conversion of arginine to citrulline and ammonia in vivo. This reaction has advantages such as relatively mild reaction conditions, high conversion efficiency, and simple extraction process, therefore ADI is widely used in the production of citrulline.

[0003] However, recent studies have shown that ADI can be used to treat arginine auxotrophic tumors, such as melanoma, lung cancer, prostate cancer, and hepatocellular carcinoma. Therefore, ADI inhibits the in vitro and in vivo proliferation of various malignant tumor cells. Furthermore, ADI is considered a better leukemia treatment drug than L-asparaginase. Arginine deiminase, as a novel antitumor substance, has attracted increasing attention from researchers.

[0004] Arginine deiminoses (ADIs) are widely found in Streptococcus lactis, Enterococcus faecalis, yeast, Pseudomonas, Mycoplasma, Halobacillus, and some eukaryotic cells. However, the optimal pH, optimal temperature, and other enzymatic properties of ADIs from different microbial sources vary. Generally, they suffer from low enzyme activity, short half-life, and low stability. Therefore, arginine deiminoses with higher activity and greater stability have higher production value. Summary of the Invention

[0005] To solve the above problems, the present invention uses Enterococcus faecalis ( E. faecalis Using arginine deiminase derived from arginine as the starting enzyme, and targeting the protein structure of arginine deiminase, SWISS-MODEL software was used to simulate and experimentally screen the starting enzyme to obtain arginine deiminase mutants with increased enzyme activity or optimal pH that is close to physiological neutrality.

[0006] In one embodiment, the nucleotide sequence of the starting enzyme is shown in SEQ ID NO.1.

[0007] In one embodiment, the amino acid sequence of the starting enzyme is shown in SEQ ID NO.18.

[0008] In this invention, the mutant is obtained by mutating phenylalanine at position 44 of the starting enzyme to tryptophan, resulting in mutant F44W, whose amino acid sequence is shown in SEQ ID NO.2.

[0009] In this invention, the mutant is obtained by mutating asparagine at position 163 of the starting enzyme to proline, resulting in mutant N163P, the amino acid sequence of which is shown in SEQ ID NO.3.

[0010] In this invention, the mutant is obtained by mutating the glutamic acid at position 220 of the starting enzyme to isoleucine and leucine, resulting in mutants E220I and E220L, with amino acid sequences as shown in SEQ ID NO.4 and SEQ ID NO.5.

[0011] In this invention, the mutant is obtained by mutating asparagine at position 318 of the starting enzyme to glutamic acid, resulting in mutant N318E, whose amino acid sequence is shown in SEQ ID NO.6.

[0012] In this invention, the mutant is obtained by mutating alanine at position 336 of the starting enzyme to glycine, resulting in mutant A336G, whose amino acid sequence is shown in SEQ ID NO.7.

[0013] In this invention, the mutant is obtained by mutating threonine at position 340 of the starting enzyme to isoleucine, resulting in mutant T340I, whose amino acid sequence is shown in SEQ ID NO.8.

[0014] In this invention, the mutant is obtained by mutating asparagine at position 382 of the starting enzyme to phenylalanine, resulting in mutant N382F, the amino acid sequence of which is shown in SEQ ID NO.9.

[0015] The present invention also provides a gene encoding the mutant.

[0016] In one embodiment, the nucleotide sequence of the gene is shown in SEQ ID NO.10-17.

[0017] The present invention also provides a recombinant plasmid expressing the gene.

[0018] The present invention also provides recombinant microbial cells expressing the mutant or the gene.

[0019] In one embodiment, the microbial cells include bacteria or fungi.

[0020] In this invention, the microbial cells include Escherichia coli.

[0021] In this invention, the *E. coli* uses *E. coli* BL21(DE3) as the host and pET-28a as the vector to express the arginine deiminase mutant.

[0022] This invention provides a method for increasing arginine deiminase activity or altering the optimal pH, the method being to use Enterococcus faecalis (… E. faecalis In SK32.001, the arginine deiminase has the following mutations: phenylalanine at position 44 is replaced with tryptophan, asparagine at position 163 is replaced with proline, glutamic acid at position 220 is replaced with isoleucine and leucine, asparagine at position 318 is replaced with glutamic acid, alanine at position 336 is replaced with glycine, threonine at position 340 is replaced with isoleucine, or asparagine at position 382 is replaced with phenylalanine.

[0023] In one embodiment, the amino acid sequence of the starting enzyme is shown in SEQ ID NO.18.

[0024] The present invention also provides a method for producing the arginine deiminase mutant, wherein the recombinant microbial cells are inoculated in a culture medium and cultured at 35-38°C for at least 12 hours.

[0025] In this invention, the method further induces recombinant microbial cells; the induction method involves culturing the recombinant microbial cells to OD200. 600 Within the range of 0.6 to 0.8, add 0.5 mmol / L IPTG and induce for 7-24 h at 16-25℃ and 200 r / min.

[0026] This invention provides the application of the arginine deiminase mutant in the production of citrulline from arginine. The application includes: using the enzyme obtained by fermenting wet bacterial cells containing the arginine deiminase mutant gene, followed by cell disruption, as a catalyst; using arginine dissolved in sodium phosphate buffer (5 g / L, pH=7.5) as a substrate; and conducting a catalytic reaction under water bath heating conditions. After the reaction, the reaction solution is separated and purified to obtain citrulline.

[0027] The present invention also provides the application of the arginine deiminase mutant in amino acid production.

[0028] Beneficial effects: The arginine deiminase mutant provided by this invention exhibits significantly improved enzyme activity and stability compared to the wild-type enzyme. The mutant enzyme activity at 55°C and optimal pH reaches 174%, 235%, 222%, 104%, 137%, 133%, 202%, and 174% of the original enzyme, respectively, representing a 1.04–2.35-fold increase compared to the wild-type enzyme activity. Furthermore, the optimal pH for all mutants remains between 7 and 8, and the mutant also exhibits high activity under physiologically neutral conditions (pH 7.4). This invention creates better operating conditions for this enzyme in practical applications. Attached Figure Description

[0029] Figure 1 The results show the docking of arginine deiminase molecules; the yellow molecule is the substrate L-arginine.

[0030] Figure 2 This is a liquid phase diagram of citrulline and arginine, with citrulline on the left and arginine on the right.

[0031] Figure 3 The whole-cell relative enzyme activities of the original enzyme WT and the mutant enzyme are given. Detailed Implementation

[0032] Materials and reagents: Restriction endonucleases and Solution I ligases were purchased from TaKaRa Biotechnology Co., Ltd.; PCR reagents, plasmid extraction kits, and gel extraction kits were purchased from Nanjing Novizan Biotechnology Co., Ltd.; primers were purchased from Suzhou Genewiz Biotechnology Co., Ltd. E. coli DH5α, E.coil The BL21(DE3) strain was preserved in the laboratory; all other reagents were analytical grade reagents purchased domestically or internationally. LB liquid medium: yeast extract 0.5 g / 100 mL, tryptone 1.0 g / 100 mL, NaCl 1.0 g / 100 mL.

[0033] LB solid medium: Based on LB liquid medium, add 1.5 g / 100 mL of agar powder.

[0034] Phosphate buffer (PB): 50 mmol / L, pH 7.0.

[0035] Binding Buffer: 50mmol / L PB, 500mmol / L NaCl, pH7.0.

[0036] Washing Buffer: 50mmol / L PB, 500mmol / L NaCl, 50mmol / L imidazole, pH7.0.

[0037] Elution Buffer: 50mmol / L PB, 500mmol / L NaCl, 500mmol / L imidazole, pH7.0.

[0038] Dialysis buffer A: 50 mmol / L PB, 10 mmol / L EDTA, pH 7.0.

[0039] Dialysis buffer B: 50 mmol / L PB, pH 7.0.

[0040] Example 1: Design of arginine deiminase mutant sites The structure of the arginine deiminase protein was found on the uniprot website (https: / / www.uniprot.org). Figure 1The protein was simulated using SWISS-MODEL software, and the simulated structure was uploaded to Deep DDG (http: / / protein.org.cn / ddg.html) for analysis to identify mutants that might improve stability. The results were then input into mCSM-PPI2 (https: / / biosig.lab.uq.edu.au / mcsm_ppi2 / ) for a second screening of mutants that increase intermolecular forces. Homology alignment was also performed to determine the amino acid sites to be mutated.

[0041] Example 2: Site-directed mutagenesis of arginine deiminase According to SEQ ID NO.1 E. faecalis Primers were designed to target the mutation site in the arcA-encoding gene derived from SK32.001. The specific primers are as follows: F44W-F: CATCCCT tgg CTTGAAAAAGCCCAGGCAGAAC; F44W-R: TTTCAAG cca AGGGATGTCGTCAAACAGAAGG.

[0042] N163P-F: CGAT ccc TTCGCAACAATGGGTCATGGGATCT; N163P-R: TTGTTGCGAA ggg ATCGCGCGTAAAGTACAGATTG.

[0043] E220I-F: GGGGGAGAT atc TTGATTCTGTCGAAGGAAGTTGTAG; E220I-R: ATCAA gat ATCTCCCCCCTCGATACGAGTGCT.

[0044] E220L-F: GGGAGAT ctg TTGATTCTGTCGAAGGAAGTTGTAG; E220L-R: GAATCAA cag ATCTCCCCCCTCGATACGAGTG.

[0045] N318E-F: GGATACACTTGAT gaa ATTTTGTGTAAGTATCTTCACTTAGATAATGTAC; N318E-R:T ttc ATCAAGTGTATCCTTCTCCTTCGTAATT.

[0046] A336G-F: TGGG ggt GGGAACTTAACCGCTGCTGCCCGCG; A336G-R: TTAAGTTCCC acc CCCACAGCGGATAAGTTGTACA.

[0047] T340I-F: GAACTTA atc GCTGCTGCCCGCGAGCAATGGA; T340I-R: CAGCAGC gat TAAGTTCCCCGCCCCACAGCGG.

[0048] N382F-F: CGGCGTGAAGTTA ttc TACATTCCGGGATCGGAGTTG; N382F-R: A gaa TAACTTCACGCCGGCCTCCTCCAGTGCC.

[0049] The underlined parts represent the codons corresponding to the mutant gene encoding phenylalanine at position 44, asparagine at position 163, glutamic acid at position 220, asparagine at position 318, alanine at position 336, threonine at position 340, and asparagine at position 382.

[0050] The PCR amplification system is as follows:

[0051] The PCR conditions were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 1 min 40 s, for a total of 30 cycles, and 72℃ final extension for 5 s followed by incubation at 4℃.

[0052] After PCR amplification under the above conditions, the PCR products were subjected to agarose gel electrophoresis at 120V for 30 min to verify the correctness of the PCR. After recovering the gel using a gel extraction kit, 1 μL of DpnI restriction endonuclease (10 U / μL) was added to the reaction solution, and the mixture was incubated at 37℃ for 2 h to eliminate the template. The obtained PCR products were then transformed into... E.coilDH5α cells were plated onto LB agar plates containing 50 μg / mL kanamycin and incubated overnight at 37°C. Single colonies were picked from the plates and activated in liquid LB medium. Plasmids were extracted, and the correct mutant plasmids were obtained by sequencing. The successfully constructed mutant plasmids were then transformed into... E.coil Mutants F44W, N163P, E220I, E220L, N318E, A336G, T340I, and N382F were obtained from BL21(DE3).

[0053] Example 3: Expression of the starting enzyme and the mutant enzyme and the optimal reaction pH Single colonies were picked from LB solid medium and incubated in LB liquid medium containing 0.5 mmol / L kanamycin at 37°C and 200 rpm for 12–16 h. The bacterial culture was then transferred at an inoculum rate of 2% (v / v) to LB liquid medium containing 0.5 mmol / L kanamycin and incubated at 37°C and 200 rpm until OD500 was reached. 600 When the pH value is around 0.6 to 0.8, add IPTG (isopropyl β-D-Thiogalactoside) to make the final concentration of IPTG in the culture medium reach 0.5 mmol / L, and continue to induce culture at 16℃ for 24 h, and collect the fermentation broth.

[0054] The collected fermentation broth was centrifuged at 8000 r / min and 4℃ for 10 min, the supernatant was discarded, and the bacterial cells were collected. The cells were washed three times with phosphate buffer (50 mmol / L, pH=6.5) and then resuspended in 20 mL of phosphate buffer. 50 μL of whole-cell bacterial culture was added to 1 mL of the reaction system, and the volume was brought up to 1 mL with substrate. The substrate was 5 g / L of L-arginine at different pH values ​​(pH=4.5 / 5 / 5.5 / 6 / 6.5 / 7 / 7.5 / 8 / 8.5 / 9). The reaction was carried out at 55℃ for 10 min. After the reaction was completed, the reaction was stopped by boiling in a water bath for 10 min. The reaction solution was centrifuged at 12000 rpm for 5 min to remove the precipitate, and the supernatant was used for membrane preparation.

[0055] The contents of arginine and citrulline after the reaction were measured by high performance liquid chromatography. Figure 2 The elution was performed using gradient elution with the following program: 0 min, 8% B; 17 min, 50% B; 20.1 min, 100% B; 24.0 min, 0% B; the mobile phase flow rate was 1.0 mL / min; the column temperature was 40 °C; and the UV detector (VWD) wavelength was 338 nm.

[0056] The method for preparing the mobile phase for high-performance liquid chromatography is as follows: Mobile phase A (pH=7.2±0.5): 27.6 mmol / L sodium acetate-triethylamine-tetrahydrofuran (volume ratio 500:0.11:2.5). Weigh sodium acetate, dissolve it in ultrapure water, add triethylamine, stir well, adjust the pH to 7.2±0.5 with 5% acetic acid, then add tetrahydrofuran and stir well. Filter through a membrane for later use.

[0057] Mobile phase B (pH=7.2±0.5): 80.9 mmol / L sodium acetate - methanol - acetonitrile (volume ratio 1:2:2). Weigh sodium acetate into a beaker, add ultrapure water and stir until dissolved. Adjust the pH to 7.2±0.5 with 2% acetic acid, then add acetonitrile and methanol and mix thoroughly. Filter the mixture through a membrane for later use.

[0058] ADI enzyme activity definition (1 U): Under the reaction assay conditions, the amount of enzyme required to hydrolyze and catalyze the production of 1 μmol of L-citrulline per minute using L-arginine as a substrate.

[0059] Table 1. Relative enzyme activities of the starting enzyme and mutant enzyme (measured at pH 7.5).

[0060] Table 2. Optimal pH of starting enzyme and mutant enzyme

[0061] The fermentation enzyme activity of the starting enzyme was measured to be 16.4 U / mL. The enzyme activities of the other mutants were all higher than those of the wild type, and the pH value was between 7 and 8. Figure 3 ).

[0062] Comparative Example 1: Following the same strategy as in Examples 1 and 2, mutants and recombinant bacteria K47R, D63G, I171V, G188F, and N257R were constructed, respectively. The recombinant bacteria were cultured using the same method as in Example 3, and the fermentation enzyme activity was detected. The results showed that the enzyme activity of mutant K47R was lower than that of the starting enzyme, while mutants D63G, I171V, G188F, and N257R were inactivated.

[0063] The primers are as follows: K47R-F: TCTTGAA aga GCCCAGGCAGAACATGATGCTT; K47R-R: CCTGGGC tct TTCAAGAAAAGGGATGTCGTCAA.

[0064] D63G-F:GCGTTCAAAA ggt ATTGAAGTCGTCTATTTAGAAGACCTGG; D63G-R: CAAT acc TTTTGAACGCAACAGCTCTGCGAAA.

[0065] I171V-F: TCATGGG GTC TCTCTTAACCACATGTATTCCGTTACT; I171V-R: TAAGAGA gac CCCATGACCCATTGTTGCGAAG.

[0066] G188F-F: CAATCTTT ttc CAGTACATTTTCGATTACCATCCAC; G188F-R: GTACTG gaa AAAGATTGTTTCGCGTTGGCGAG.

[0067] N257R-F: TTTAAG cgc ATCTTGGCATTCGACATCGGTGA; N257R-R: GCCAAGAT gcg CTTAAATCCTAATTTTTGTTCAAAGATGT.

[0068] The underlined parts represent the codons corresponding to arginine at position 47, glycine at position 63, valine at position 171, phenylalanine at position 188, and arginine at position 257 encoded by the mutant gene.

[0069] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An arginine deiminase mutant, characterized in that, Based on the arginine deiminase with an amino acid sequence as shown in SEQ ID NO.18, the phenylalanine at position 44 was mutated to tryptophan.

2. The gene encoding the arginine deiminase mutant of claim 1.

3. A recombinant plasmid carrying the gene described in claim 2.

4. A recombinant microorganism expressing the arginine deiminase mutant of claim 1 or carrying the recombinant plasmid of claim 3.

5. The recombinant microorganism according to claim 4, characterized in that, The recombinant microorganism is a recombinant bacterium or a recombinant fungus.

6. The recombinant microorganism according to claim 5, characterized in that, The recombinant microorganism is recombinant Escherichia coli.

7. A recombinant Escherichia coli, characterized in that, Using Escherichia coli BL21(DE3) as the host and pET-28a as the vector, the mutant described in claim 1 was expressed.

8. A method for increasing the activity of arginine deiminase, characterized in that, The 44th phenylalanine of the arginine deiminase, as shown in SEQ ID NO.18, is mutated to tryptophan.

9. A method for preparing L-citrulline, characterized in that, The method involves using L-arginine as a substrate and catalyzing the production of L-citrulline using the arginine deiminase mutant described in claim 1, any of the recombinant microorganisms described in claims 4 to 6, or the recombinant Escherichia coli described in claim 7.

10. The application of the arginine deiminase mutant of claim 1, the gene of claim 2, the recombinant plasmid of claim 3, the recombinant microorganism of any one of claims 4 to 6, or the recombinant Escherichia coli of claim 7 in the production of L-citrulline.

Images