Circular RNA and its use in promoting the transition of embryonic stem cells from naive state to ground state

Abstract

The application provides a circular RNA and application thereof in promoting conversion of embryonic stem cells from a naive state to a ground state, wherein the circular RNA has a nucleotide sequence as shown in SEQ ID NO:1 or a nucleotide sequence with at least 80% homology with the nucleotide sequence shown in SEQ ID NO:1. By overexpressing the circular RNA, the conversion of embryonic stem cells from the naive state to the ground state with better developmental potential can be effectively promoted, thereby providing a new direction for stem cells in future scientific research and clinical application.

Description

Technical Field

[0001] This invention relates to the field of biology. Specifically, this invention relates to circular RNA and its application in promoting the transition of embryonic stem cells from the primordial state to the primitive state. Background Technology

[0002] During embryonic development, stem cells exist at different stages and in different states. The naïve and primed states are two of the most studied states of embryonic stem cells, exhibiting significant differences in cell morphology, culture conditions, and gene expression. Current research generally suggests that naïve embryonic stem cells possess better developmental potential than primed ones and are capable of xenogeneic chimerism. Many scientists are dedicated to studying the transition from primed to naïve state (PNT) of embryonic stem cells to obtain naïve embryonic stem cells with even better developmental potential. Obtaining tissues or organs through xenogeneic chimerism using mouse or human embryonic stem cells has significant research value and application prospects, especially for human embryonic stem cells. Xenogeneic chimerism of humanized tissues and organs will provide more options for future medical endeavors.

[0003] Currently, how to promote the transformation of embryonic stem cells from the primordial state to the primitive state still needs further research. Summary of the Invention

[0004] The present invention aims to at least partially solve the technical problems existing in the prior art.

[0005] It should be noted that this invention is based on the following discoveries of the inventors: Circular RNAs (circRNAs) are a special class of non-coding RNA molecules and a recent research hotspot in the field of RNA. Unlike traditional linear RNAs, circRNA molecules have a closed circular structure, are unaffected by RNA exonucleases, are more stable in expression, and are less prone to degradation. In recent years, circRNAs from different gene sources have been reported to play important regulatory roles in physiological and pathological processes. However, the effect of circular RNAs on PNT conversion has not yet been reported.

[0006] The inventors discovered a circular RNA (circTET2) in mouse embryonic stem cells. Overexpression of circTET2 effectively promotes the transition of mouse embryonic stem cells from the primed to the naïve state. The inventors extracted and analyzed this circular RNA, obtaining its complete sequence. Furthermore, existing methods for overexpressing circular RNA primarily rely on transient transfection or viral infection via vectors to establish cell lines. However, due to the relatively large length of circTET2, transient transfection or viral packaging is ineffective, making cell line establishment difficult. Based on this, the inventors, through in-depth research, added circular elements to both ends of the circular RNA sequence when constructing the overexpression vector, and added a PB transposon element at the end of the circular elements furthest from the circular RNA sequence. This allows for the overexpression of both large-length circular RNAs and the establishment of stable, passaged cell lines.

[0007] Therefore, in one aspect of the present invention, a circular RNA is proposed. According to embodiments of the present invention, the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1. Overexpression of this circular RNA can effectively promote the transformation of embryonic stem cells from the primordial state into primitive embryonic stem cells with better developmental potential, providing a new direction for future scientific research and clinical applications of stem cells.

[0008] In another aspect, the present invention provides a recombinant expression vector for obtaining the aforementioned circular RNA. According to an embodiment of the present invention, the recombinant expression vector comprises: linear RNA having a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1; a first circular element attached to one end of the linear RNA; and a second circular element attached to the other end of the linear RNA.

[0009] In another aspect, the present invention provides a recombinant cell. According to embodiments of the present invention, the recombinant cell comprises: the aforementioned circular RNA or the aforementioned recombinant expression vector.

[0010] In another aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit comprises: the aforementioned circular RNA, the recombinant expression vector, or the recombinant cells.

[0011] In another aspect of the invention, the invention proposes the use of the aforementioned circular RNA, the recombinant expression vector, the recombinant cells, or the kit in promoting the transformation of embryonic stem cells from the primordial state to the primitive state or in preparing primitive embryonic stem cells.

[0012] In another aspect, the present invention provides a method for promoting the transformation of embryonic stem cells from a primordial state to a primitive state. According to an embodiment of the present invention, the method includes: overexpressing circular RNA in embryonic stem cells in the primordial state; wherein the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology to the nucleotide sequence shown in SEQ ID NO: 1.

[0013] In another aspect, the present invention provides a method for preparing primordial embryonic stem cells. According to an embodiment of the present invention, the method includes: providing primordial embryonic stem cells; overexpressing circular RNA in the primordial embryonic stem cells; wherein the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology to the nucleotide sequence shown in SEQ ID NO: 1.

[0014] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0015] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which: Figure 1 A schematic diagram of circTET2 expression levels according to an embodiment of the present invention is shown; Figure 2 A schematic diagram of sequencing results according to an embodiment of the present invention is shown; Figure 3 A schematic diagram of a plasmid structure according to an embodiment of the present invention is shown; Figure 4 A schematic diagram of circTET2 expression levels according to an embodiment of the present invention is shown; Figure 5 This diagram illustrates the PNT conversion efficiency of the overexpression control sequence of circNC according to an embodiment of the present invention. Figure 6 A schematic diagram illustrating the PNT conversion efficiency of the overexpression sequence circTET2 according to an embodiment of the present invention is shown. Detailed Implementation

[0016] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0017] The term "homology" refers to the sharing of at least partially complementary regions (sites) between two or more nucleic acids. In this document, the term "% homology" is used interchangeably with the term "% identity" and refers to the level of identity between nucleic acid sequences when aligned using a sequence alignment program. For example, as used herein, 80% homology means that the same thing has 80% sequence identity determined by a defined algorithm, and therefore homologs of a given sequence have greater than 80% sequence identity over the length of the given sequence. Exemplary levels of sequence identity include, but are not limited to, 80%, 85%, 90%, 95%, 98%, or greater sequence identity for a given sequence, such as an inventive nucleic acid sequence as described herein. Exemplary computer programs that can be used to determine the identity between two sequences include, but are not limited to, the BLAST program group, such as BLASTN, BLASTX, and TBLASTX, BLASTP, and TBLASTN, and BLAT, which are publicly available on the Internet.

[0018] The term "vector" refers to any genetic factor capable of acting as a vehicle for the genetic transfer, expression, or replication of foreign polynucleotides in host cells. For example, a vector may be an artificial chromosome or plasmid and may be stably integrated into the host cell genome, or it may exist as an independent genetic factor (e.g., an episome, plasmid). A vector may exist as a single polynucleotide or as two or more separate polynucleotides. When present in a host cell, the vector may be a single-copy vector or a multi-copy vector. Preferred vectors for use in this invention are expression vector molecules in which one or more functional genes can be appropriately oriented into and near expression control elements residing in the expression vector molecule, so as to guide the expression of one or more proteins when the vector molecule resides in a suitable (homologous) host cell.

[0019] Expression vectors may include, but are not limited to, eukaryotic plasmid vectors, eukaryotic viral vectors, prokaryotic plasmids, bacteriophage vectors, shuttle vectors (e.g., vectors that can replicate in eukaryotic and prokaryotic cells), miniature chromosomes, and various artificial chromosomes (e.g., bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC)). Preferably, the expression vector used in this invention is a plasmid, more preferably a plasmid expression vector that is stably integrated into the host cell genome, and even more preferably a plasmid expression vector that is stably integrated into the host cell genome through non-homologous recombination.

[0020] Circular RNA In one aspect of the invention, a circular RNA is proposed. According to embodiments of the invention, the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1. Overexpression of this circular RNA (circTET2) can effectively promote the transformation of embryonic stem cells from the primordial state into primitive embryonic stem cells with better developmental potential, providing a new direction for future scientific research and clinical applications of stem cells.

[0021] Recombinant expression vector In another aspect, the present invention provides a recombinant expression vector for the aforementioned circular RNA. According to an embodiment of the present invention, the recombinant expression vector comprises: linear RNA having a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1; a first circular element attached to one end of the linear RNA; and a second circular element attached to the other end of the linear RNA.

[0022] By inserting linear RNA into a backbone vector, linear RNA overexpression can be facilitated. Furthermore, the circularization of this linear RNA can be achieved through the design of circularization elements at both ends, resulting in circular RNA. This circular RNA can effectively promote the transformation of embryonic stem cells from the primordial state into primitive embryonic stem cells with better developmental potential, providing a new direction for future scientific research and clinical applications of stem cells.

[0023] The present invention does not strictly limit the type of backbone vector, and can be any commonly used vector in the field, preferably a commonly used circular RNA overexpression vector, specifically, it can be a pCDH-ciR vector, a plenti-ciR vector, a pLO-ciR vector, a pb-ciR vector, etc.

[0024] According to an embodiment of the present invention, the first circulating element and the second circulating element are inverse complementary sequences. During overexpression, the inverse complementary sequences pair complementarily to circulate the linear RNA.

[0025] It should be noted that the reverse complementary sequence used in this invention can be either a reverse complementary sequence commonly used in the art for the preparation of circular RNA, such as an Alu element, or an artificially synthesized reverse complementary pairing sequence. According to specific embodiments of the invention, the first and second circumforming elements are selected from Alu elements. Alu elements facilitate the correct circumforming, maturation, and processing of circular RNA. In some embodiments, the Alu element has a nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 2.

[0026] According to an embodiment of the present invention, the recombinant expression vector further comprises: a first PB transposon, the first PB transposon being connected to the end of the first circular element away from the circular RNA; and a second PB transposon, the second PB transposon being connected to the end of the second circular element away from the circular RNA.

[0027] Because the linear RNA sequence of this invention is relatively long, transient transfection expression or infection of cells by vector-packaged viruses are both ineffective, making it difficult to establish cell lines. Therefore, the inventors, through extensive experimentation, surprisingly discovered that by attaching a PB transposon to the end of the first / second circular element furthest from the linear RNA, circular RNA overexpression can be effectively achieved, and stable passaged cell lines can be established. In some embodiments, the first and second PB transposons each independently have a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence with at least 80% homology to the nucleotide sequence shown in SEQ ID NO: 3.

[0028] TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGC TTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGT GATAACTTATTATATATATATTTTCTTGTTATAGATATCTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAG TGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAA (SEQ ID NO: 3) In this invention, terms such as "connected" and "linked" should be interpreted broadly. For example, they can refer to direct connection, such as two fragments on a vector being directly connected, specifically, the linear RNA being directly connected to the first / second circular element or the first / second circular element being directly connected to the first / second PB transposon. They can also refer to indirect connection through an intermediate medium, such as the linear RNA being separated from the first / second circular element or the first / second PB transposon by a gene fragment, such as an exon. Unless otherwise explicitly defined, those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0029] It should be noted that the characteristics and advantages described above for circular RNA also apply to this recombinant expression vector, and will not be repeated here.

[0030] Recombinant cells In another aspect, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell comprises: the aforementioned circular RNA or the aforementioned recombinant expression vector. Recombinant cells are constructed by transferring the aforementioned recombinant expression vector into initial cells, in which the circular RNA can be overexpressed and stably passaged.

[0031] It should be noted that the present invention does not strictly limit the type of "initial cells," which can be animal cells, plant cells, or microbial cells, but does not include human embryonic stem cells, germ cells, fertilized eggs, embryos, or individuals. In some embodiments, the recombinant cells are selected from animal embryonic stem cells, and the animals can be humans, mice, cattle, rabbits, sheep, horses, etc. In animal embryonic stem cells, circular RNA can promote the transformation of animal embryonic stem cells from the primordial state to the primitive state, providing a new direction for future scientific research and clinical applications of stem cells. Human embryonic stem cells can be obtained by purchase.

[0032] In addition, the present invention does not strictly limit the method of transfecting the recombinant expression vector into the initial cells. It can be transformation, transfection or infection, etc. Specifically, it can be transient transfection or stable transfection, such as calcium phosphate transfection, liposome transfection, electroporation transfection or lentivirus transfection, which can be flexibly selected according to the actual situation.

[0033] It should be noted that the features and advantages described above for circular RNA or recombinant expression vectors also apply to this recombinant cell, and will not be repeated here.

[0034] Reagent test kit In another aspect, the present invention provides a kit. According to an embodiment of the invention, the kit comprises: the aforementioned circular RNA, the recombinant expression vector, or the recombinant cells. The kit according to an embodiment of the invention can achieve overexpression of circular RNA and facilitate the transformation of embryonic stem cells from their primordial state to their primitive state, providing a new direction for future scientific research and clinical applications of stem cells.

[0035] It should be noted that the characteristics and advantages described above for circular RNA, recombinant expression vectors, or recombinant cells also apply to this recombinant cell, and will not be repeated here.

[0036] Uses and methods In another aspect, the present invention proposes the use of the aforementioned circular RNA, the recombinant expression vector, the recombinant cells, or the kit in promoting the transformation of embryonic stem cells from the primordial state to the primitive state or in preparing primitive embryonic stem cells. This provides a new direction for future scientific research and clinical applications of stem cells.

[0037] In another aspect, the present invention provides a method for promoting the transformation of embryonic stem cells from the primordial state to the primitive state. According to an embodiment of the present invention, the method includes: overexpressing circular RNA in embryonic stem cells in the primordial state; wherein the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1. Thus, by overexpressing circular RNA, the transformation of embryonic stem cells from the primordial state to the primitive state can be promoted, providing a new direction for future scientific research and clinical applications of stem cells.

[0038] According to an embodiment of the present invention, the method includes: transferring the aforementioned recombinant expression vector into nascent embryonic stem cells to induce overexpression of circular RNA.

[0039] In another aspect, the present invention provides a method for preparing primordial embryonic stem cells. According to an embodiment of the present invention, the method includes: providing primordial embryonic stem cells; overexpressing circular RNA in the primordial embryonic stem cells; wherein the circular RNA has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in SEQ ID NO: 1. Thus, by overexpressing circular RNA, the transformation of embryonic stem cells from the primordial state to the primitive state can be promoted, providing a new direction for future scientific research and clinical applications of stem cells.

[0040] According to an embodiment of the present invention, the method includes: transferring the aforementioned recombinant expression vector into nascent embryonic stem cells to induce overexpression of circular RNA.

[0041] It should be noted that the features and advantages described above for circular RNA, recombinant expression vectors, recombinant cells and kits also apply to this use and method, and will not be repeated here.

[0042] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0043] Example 1 1. Provide OG2-ESC cell line as mouse naïve embryonic stem cells and OG2-EpiSCs cell line as primed embryonic stem cells.

[0044] 2. The two cell lines were cultured separately in the same environment. Total RNA was extracted from the cells after culture, reverse transcribed into cDNA, and the expression level of circTET2 was detected by qPCR. The results are as follows: Figure 1 As shown, circTET2 is abundant in naïve cells.

[0045] 3. Sequencing of circTET2 yielded the following results: Figure 2 As shown, circTET2 has a nucleotide sequence as shown in SEQ ID NO: 1.

[0046] Example 2 1. Genomic DNA was extracted from naïve embryonic stem cells cultured in Example 1. The circTET2 sequence was amplified by PCR. Then, Alu elements (SEQ ID NO: 2) were added to both ends of the target sequence. The elements had restriction enzyme sites at both ends. The PB-vector transposon expression vector (containing PB transposons, the sequence of which is the nucleotide sequence shown in SEQ ID NO: 3) was ligated to obtain the ligation product.

[0047] 2. Take 10 μL of the ligation product obtained in the previous step and transform it into 100 μL of Stbl3 competent cells: After mixing the product with the competent cells, incubate on ice for 30 min, heat shock at 42℃ for 90 s, immediately place on ice for 2 min, add 500 μL of LB medium preheated to room temperature, and culture on a shaker at 37℃ for 1 h at 200 rpm. Centrifuge at 8000 rpm for 1 min, discard 500 µL of culture supernatant, mix the remaining 100 µL with a pipette, spread it evenly on an LB plate containing 50 µg / mL ampicillin, invert, and incubate overnight at 37℃.

[0048] 3. Select positive single colonies and send them to Sangon Biotech Co., Ltd. for sequencing.

[0049] 4. For positive strains with correct sequencing, expand the culture by adding 20 ml of LB medium containing the corresponding antibiotic at 37°C. Incubate overnight at ℃, extract plasmids, and obtain a vector containing circular RNA overexpression. The schematic diagram is shown below. Figure 3 As shown.

[0050] 5. Using a lipo3000 transfector, the vector containing circular RNA overexpression constructed in Example 2 was transfected into the OG2-EpiSCs cell line. After transfection, the cells were passaged five times, and RNA was extracted from the cells, reverse transcribed into cDNA, and the circTET2 content was detected by qPCR. The results are as follows. Figure 4 As shown, plenti-vector is a lentiviral vector, PB-vector is a transposon vector (a circular RNA overexpression vector constructed in Example 2), circNC is a control formed by replacing TET2 in PB-vector with a random sequence, which expresses a random sequence of circular RNA in cells. circTET2 is the target circular RNA. It can be seen that the expression level of large circular RNA in cell lines using plenti-vector is much lower than that using PB-vector, proving that PB transposon can effectively overexpress large circular RNA in cell lines.

[0051] Example 3 The OG2-EpiSCs cell lines overexpressing circNC or containing circTET2, established in Example 2, were used to transition from the primary state to the primitive state. The OG2-EpiSCs cell lines contain the GFP gene as a reporter gene, and the GFP gene is significantly expressed when the cells transition from the primary state to the primitive state, producing a detectable fluorescent signal.

[0052] The results are as follows Figure 5 and Figure 6 As shown, overexpression of circTET2 can transform mouse embryonic stem cells from the primordial state to the primitive state, with the transformation rate increasing to 13.7% compared to 5.46% in the control group.

[0053] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0054] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences <120> Circular RNA and its application in promoting the transition of embryonic stem cells from the primordial state to the primitive state <130> BI3220274 <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 3206 <212> DNA <213> Artificial Sequence <220> <223> 1 <400> 1 gattcattca aagggcagcc ttgtggatgg ccccgaagca agcctgatgg aacaggacag 60 aaccacccat gctgagggca ccagactgag tccattcctg atagcaccac cttctcccat 120 cagccataca gaacctctgg ctgtcaaact ccagaatgga agcccgttag cagagagacc 180 tcatccagaa gtaaatggag acaccaagtg gcaatcttcc caaagctgtt atggaatatc 240 ccacatgaaa ggcagccaga gcagtcatga gagtccacat gaagacagag ggtattccag 300 gtgcttacag aatggaggga taaaacgcac agtcagtgaa ccatctctct ctgggctcca 360 tccaaacaag atattgaaac tagaccaaaa agctaaggga gaaagcaata tcttcgagga 420 aagccaagaa agaaaccacg gtaaaagcag ccgtcagcca aatgtctccg gactaagtga 480 taatggagag cccgtgacct cgaccaccca ggaaagttca ggtgcagatg ctttcccaac 540 acggaactac aatggagttg aaattcaggt tctcaacgag caggaagggg aaaaaggcag 600 gagcgttaca ttacttaaaa acaagattgt gctaatgcct aatggtgcta cagtttctgc 660 ccattctgag gagaacacac gtggtgaact cctggaaaaa acacagtgtt atccagattg 720 tgtctccatt gccgtgcaga gtaccgcatc tcatgtaaac acccctagca gtcaggctgc 780 tatcgagttg tcccacgaga tccctcaacc atcgcttacc tcagcgcaga tcaatttctc 840 ccagacctca agcttgcagc tgcctccaga gccagctgca atggtgacta aggcctgtga 900 tgctgataat gccagtaaac cagctatagt accaggtacc tgtccttttc agaaagcaga 1020. aagtcagctt tggacatagg cccatctcgt gcagaaaca aaaccatcca aggaagcatg gagctatttg ctgaagata ctatcctagt tccgaccgga atttgcaagc ttcgcatggc agctctgac agtattcaaa gcaaaagga accaatggtg cttacttcag gcaaagctcg aagttcccta aagattccat ctctcccact actgtgaccc caccgtcaca atcacttctt gctccccgtc ttgttcttca gcctccttta gaggaaag gcgctctaaa tgatgtagct ttggaagaac accatgacta ccccaaccga agcaaccga ctcttttaag ggaaggaa atagaccatc aacccaagac atcatctagc cagagtctga atccatctgt acatacaccc aaccccccct tgatgcttcc agacagcat cagaatgatt gtggctcacc gagccctga aagtcaaga aaatgtcaga atatctcatg tattacctgc caaatcatgg ccacagtgga ggtttacaag aacatagcca atacctgatg gggcacaggg agcaagagat tccgaaggat gcaaacggga aacaaacgca aggctctgta caggcagcac ctggctggat agaactgaaa gccccgaatt tgcatgaagc actccatcag acaaaacgca aggatatatc 1680 cttgcactca gtcctccact ctcagaccgg ccctgtcaat cagatgagct ccaaacagtc 1740 cactggcaat gtcaacatgc caggaggatt ccaaaggcta ccttacctcc agaaaacagc 1800 ccagccagag cagaaggcac aaatgtacca agtgcaagtg aaccaaggac cgtctccagg 1860 tatgggggac caacatcttc agttccagaa agctttatac caggagtgca tccccaggac 1920 agatccgtca tctgaggctc acccgcaagc accgagcgtt cctcagtatc atttccagca 1980 aagagtaaat ccctccagtg ataagcattt gagtcaacag gccacagaga ctcaacggtt 2040 atcaggcttt ttacaacata ctcctcagac gcaggcatca caaacaccag catcccagaa 2100 ctcaaatttc cctcaaatct gccagcagca gcagcagcag cagttacaga ggaagaataa 2160 agagcaaatg cctcagactt tctctcatct ccaaggtagc aatgataagc aaagagaagg 2220 ctcgtgcttt ggccagatta aagtggaaga aagcttttgt gtcggaaatc agtactccaa 2280 atcaagtaat ttccaaactc acaataatac ccaagggggg ttggagcaag tacaaaatat 2340 aaataaaat tttccttatt cgaagatctt aacaccaaat tcgagcaact tacagattct 2400 cccttcaaat gacacacacc cggcttgtga gcgggaacaa gctctacatc ccgtaggaag 2460 taagacctca aacctgcaga acatgcagta tttcccgaat aatgtgaccc caaatcagga 2520 cgttcaccgg tgctttcagg aacaagcgca gaagcctcag caagcttcgt ctctacaggg 2580 gcttaaggac agaagccagg gtgagtctcc agccccacca gctgaggcag ctcaacagag 2640 gtatttggtg cataatgaag caaaggcact ccctgtgcct gagcaaggag gaagtcagac 2700 acagacccct cctcagaagg acactcagaa gcacgctgcc ttaaggtggc ttctcttaca 2760 gaagcaagaa cagcagcaaa cacagcaatc ccagcctggt cataaccaga tgcttaggcc 2820 aatcaagact gagcctgtat ccaaaccttc ttcctataga taccccttgt caccgccaca 2880 agaaaatatg tccagcagga taaagcaaga gatctccct ccaagccgtg acaatgggca 2940 gccaaagagc atcattgaga ccatggaaca gcacctgaag cagtttcagc tcaagtcact 3000 ctgtgactat aaggctctga ctctcaagtc acagaaacac gtgaaagtgc caacagatat 3060 ccaggctgca gatcggaga accacgcccg agctgcagag cctcaagcaa ccaaagcac 3120 agattgttct gttctcgacg atgttcaga atcagatact cctggtgaac aaagtcagaa 3180 tggcaatgt gaggtgca atccag 3206 <210> 2 <211> 1190 <212> DNA <213> Artificial Sequence <220> <223> 2 <400> 2 aaaacaagaga gatgctata gtcgtatagt atagtttccc gactatctga tacccattac 60 ttatctaggg ggaatgcgaa cccaaattt tatcagtttt ctcggatatc gatagatatt 120 ggggataaa tttaataa taaatttgg gcgggttttag ggcgtggcaa aaagtttttt 180 ggcaaatcgc taggaattta cagactt aaaatttaga aaaataca caaattttta 240 aacacgtggg cgtgacagtt ttggcggtt ttaggcgtt agagtaggcg aggacaggtt 300 tacatcgact aggctttgat cctgatcaag atatatata ctttataccg cttccttcta 360 catgttacct atttttcaac gatctagta taccttttta ctgtacgatt tatgggtata 420 ataataagct aaatcgagac taagttttat tgttatatat attttttta ttttatgcag 480 gtaagtattc aaaattccaa aatttttac tagaaatatt cgatttttta ataggcagtt 540 tctatactat tgtatactat tgtagattcg ttgaaaagta tgtaacagga agaataaagc 600 atttccgacc atgtaaagta tatatatct tataaggat caatagccga gtcgatctcg 660 ccatgtccgt ctgtcttatt atttattac cgccgagaca tcaggaacta taaaagctag 720 aaggatgagt tttagcatac agattctaga gacaaggacg cagagcaagt ttgttgatcc 780 atgctgccac gctttaactt tctcaaattg cccaaaactg ccatgcccac atttttgaac 840 tatttcgaa atttttcat aattgtatta ctcgtgtaaa tttccatcaa tttgccaaaa 900 aactttttgt cacgcgttaa cgccctaaag ccgccaattt ggtcacgccc acactattga 960 gcaattatca aatttttct cattttattc cccaatatct atcgatatcc ccgattatga 1020 aattattaaa ttcgcgttc gcattcacac tagctgagta acgagtatct gatagttggg 1080 gaaatcgact tattttttat atacaatgaa aatgaattta atcatatgaa tatcgattat 1140 agctttttat ttaatatgaa tatttattg ggctttaggt gtaacctcct 1190 <210> 3 <211> 548 <212> DNA <213> Artificial Sequence <220> <223> 3 <400> 3 ttaaccctag aaagatagtc tgcgtaaaat tgacgcatgc attcttgaaa tattgctctc 60 tctttctaaa tagcgcgaat ccgtcgctgt gcatttagga catctcagtc gccgcttgga 120 gctcccgtga ggcgtgcttg tcaatgcggt aagtgtcact gatttgaac tataacgacc 180 gcgtgagtca aaatgacgca tgattatctt ttacgtgact ttgagattt aactcatacg 240 atattatat tgttattca tgttctactt acgtgataac ttattatata tatattttct 300 tgttatagat atctttgtta ctttatagaa gaaattttga gttttgtttt tttttaata 360 aaaaaaaaaaaa ttgtttgttg aatttattat tgtgtaa gtgtaaaat 420 aaaaactt atatctatt caattaata aaaacctc gatatacaga ccgataaaac 480 acatgcgtca attttacgca tgattatctt taacgtacgt cacaatga tattactttct 540 page 548

Claims

1. Uses of circular RNA, recombinant expression vectors, or kits in promoting the transformation of embryonic stem cells from the primordial state to the primitive state or in preparing primitive embryonic stem cells; The nucleotide sequence of the circular RNA is shown in SEQ ID NO: 1; The recombinant expression vector includes: Linear RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1; A first circulatory element, wherein the first circulatory element is connected to one end of the linear RNA; A second circulatory element is connected to the other end of the linear RNA; The kit includes: the circular RNA or the recombinant expression vector; The embryonic stem cells are either non-human embryonic stem cells or human embryonic stem cells obtained through purchase.

2. The use according to claim 1, characterized in that, The first ring-forming element and the second ring-forming element are inverse complementary sequences.

3. The use according to claim 1 or 2, characterized in that, The first and second ring-forming elements are selected from Alu elements.

4. The use according to claim 3, characterized in that, The nucleotide sequence of the Alu element is shown in SEQ ID NO:

2.

5. The use according to claim 1, characterized in that, The recombinant expression vector further includes: The first PB transposon is connected to the end of the first circular element away from the linear RNA; The second PB transposon is connected to the end of the second circular element away from the linear RNA.

6. The use according to claim 5, characterized in that, The independent nucleotide sequences of the first PB transposon and the second PB transposon are shown in SEQ ID NO:

3.

7. A method for promoting the transformation of embryonic stem cells from the primordial state to the primitive state, characterized in that, include: It induces overexpression of circular RNA in embryonic stem cells in the nascent stage; The nucleotide sequence of the circular RNA is shown in SEQ ID NO: 1; The embryonic stem cells are either non-human embryonic stem cells or human embryonic stem cells obtained through purchase.

8. The method according to claim 7, characterized in that, include: The recombinant expression vector was transferred into nascent embryonic stem cells to induce overexpression of circular RNA. The recombinant expression vector includes: Linear RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1; A first circulatory element, wherein the first circulatory element is connected to one end of the linear RNA; A second circulatory element is attached to the other end of the linear RNA.

9. The method according to claim 8, characterized in that, The first ring-forming element and the second ring-forming element are inverse complementary sequences.

10. The method according to claim 8 or 9, characterized in that, The first and second ring-forming elements are selected from Alu elements.

11. The method according to claim 10, characterized in that, The nucleotide sequence of the Alu element is shown in SEQ ID NO:

2.

12. The method according to claim 8, characterized in that, The recombinant expression vector further includes: The first PB transposon is connected to the end of the first circular element away from the linear RNA; The second PB transposon is connected to the end of the second circular element away from the linear RNA.

13. The method according to claim 12, characterized in that, The independent nucleotide sequences of the first PB transposon and the second PB transposon are shown in SEQ ID NO:

3.

14. A method for preparing primitive embryonic stem cells, characterized in that, include: Provide nascent embryonic stem cells; To induce overexpression of circular RNA in the primordial embryonic stem cells; The nucleotide sequence of the circular RNA is shown in SEQ ID NO: 1; The embryonic stem cells are either non-human embryonic stem cells or human embryonic stem cells obtained through purchase.

15. The method according to claim 14, characterized in that, The method includes: transferring a recombinant expression vector into nascent embryonic stem cells to induce overexpression of circular RNA; The recombinant expression vector includes: Linear RNA, the nucleotide sequence of which is shown in SEQ ID NO: 1; A first circulatory element, wherein the first circulatory element is connected to one end of the linear RNA; A second circulatory element is attached to the other end of the linear RNA.

16. The method according to claim 15, characterized in that, The first ring-forming element and the second ring-forming element are inverse complementary sequences.

17. The method according to claim 15 or 16, characterized in that, The first and second ring-forming elements are selected from Alu elements.

18. The method according to claim 17, characterized in that, The nucleotide sequence of the Alu element is shown in SEQ ID NO:

2.

19. The method according to claim 15, characterized in that, The recombinant expression vector further includes: The first PB transposon is connected to the end of the first circular element away from the linear RNA; The second PB transposon is connected to the end of the second circular element away from the linear RNA.

20. The method according to claim 19, characterized in that, The independent nucleotide sequences of the first PB transposon and the second PB transposon are shown in SEQ ID NO: 3.

Images