A gene for catalyzing synthesis of camphene, a biological enzyme and application thereof in production of camphene

Abstract

This invention provides a gene, a bioenzyme, and their application in camphene production, belonging to the field of bioenzyme catalysis technology. The nucleotide sequence of the gene is shown in SEQ ID No. 1; the amino acid sequence of the bioenzyme is shown in SEQ ID No. 2. The method for producing camphene provided by this invention includes the following steps: mixing and incubating a substrate, a reaction solution, and the protein; terminating the reaction; and adding calf intestinal alkaline phosphatase to dephosphorylate the product to obtain camphene. The bioenzyme can achieve highly efficient catalytic production of camphene under mild reaction conditions, with high yield, and without producing harmful byproducts, realizing a green and sustainable camphene synthesis process.

Description

Technical Field

[0001] This invention belongs to the field of bio-enzyme catalysis technology, and particularly relates to a gene, a bio-enzyme for catalyzing the synthesis of camphene, and its application in the production of camphene. Background Technology

[0002] Camphene, chemically known as camphene, is a compound with C 10 H 16 Camphene is an organic compound with a chemical formula. It is widely used in the pharmaceutical industry as a preservative and is also an important raw material for the synthesis of camphor and fragrances. Camphene belongs to the bicyclic monoterpenoid class of compounds, is almost insoluble in water but soluble in common organic solvents. It is volatile and has a pungent odor. Camphene is found in various oils and fragrances, such as turpentine, tar, camphor oil, and citronella oil. Industrially, camphene is mainly produced through the catalytic isomerization reaction of the common α-pinene.

[0003] However, current domestic and international methods for producing camphene mainly yield ordinary-grade products with a camphene content of approximately 96%. This is because current camphene distillation processes typically employ single distillation, making them prone to mixing with other similar compounds. However, with expanding market demand, particularly in the fragrance, pharmaceutical, and food industries, the need for high-quality camphene products (with a camphene content of over 98%) is constantly increasing. Current processes are insufficient for mass production of products with a camphene content exceeding 98%. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a gene, a bioenzyme, and its application in camphene production for catalytic synthesis. This invention obtains a bioenzyme with high catalytic activity through screening, capable of catalyzing the synthesis of camphene from inexpensive substrates. The catalytic reaction conditions are mild, the yield is high, and no harmful byproducts are generated, achieving a green and sustainable camphene synthesis process. This enzymatic catalysis method not only increases camphene yield but also reduces production costs and environmental impact.

[0005] This invention provides a gene for catalyzing the synthesis of camphene, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0006] This invention provides a protein for catalyzing the synthesis of camphene, the amino acid sequence of which is shown in SEQ ID No. 2.

[0007] This invention provides a method for preparing the aforementioned protein, comprising the following steps:

[0008] 1) The gene clone is ligated into the initial vector to obtain a recombinant vector;

[0009] 2) The recombinant vector was transferred into the initial strain to obtain the recombinant strain;

[0010] 3) Culturing the recombinant strain to obtain bacterial cells;

[0011] 4) The bacterial cells were lysed to obtain cell lysate, which was then purified to obtain the target protein.

[0012] Preferably, the initial carrier is a pCold carrier.

[0013] This invention provides a method for producing camphene, comprising the following steps:

[0014] The substrate, reaction solution, and the protein were mixed and incubated. After the reaction was terminated, calf intestinal alkaline phosphatase was added to dephosphorylate the product, yielding camphene.

[0015] Preferably, the temperature for the mixed incubation is 25–35°C, and the incubation time is 10–20 min.

[0016] Preferably, the substrate is gerany pyrophosphate, and the concentration of the substrate in the reaction system is 0.5–5 mM; the concentration of the protein in the reaction system is 0.5–10 mg / mL.

[0017] Preferably, the reaction solution includes Tris-HCl, MgCl2, DTT, and PMSF.

[0018] Preferably, the volume of the calf intestinal alkaline phosphatase is 1-2% of the reaction system volume; the dephosphorylation temperature is 36-38°C; and the dephosphorylation time is 50-70 min.

[0019] Compared with existing technologies, the present invention has the following beneficial effects: the gene and bioenzyme for catalyzing camphene synthesis provided by the present invention can catalyze the synthesis of camphene from inexpensive substrates; the catalytic reaction conditions are mild, the yield is high, and no harmful byproducts are generated, realizing a green and sustainable camphene synthesis process. The enzymatic catalysis method of the present invention not only increases the yield of camphene but also reduces production costs and environmental impact. According to the examples, the bioenzyme-catalyzed camphene synthesis provided by the present invention achieves a yield of 23.8 mg / L. Attached Figure Description

[0020] Figure 1 This is a camphene-catalyzed reaction, with geranyl pyrophosphate (Gpp) as the substrate;

[0021] Figure 2 The following are the GC-MS detection results of camphene in the examples, where a is the result of GC detection of camphene in the sample, with a peak elution time of about 7.3 min, b is the mass spectrometry result of camphene in the sample, and c is the information of camphene in the database, which is consistent with the experimental results. Detailed Implementation

[0022] The present invention provides a gene for catalytic synthesis of camphene, and the nucleotide sequence of the gene is shown in SEQ ID No.1, specifically as follows:

[0023] ATGAAAATGTCTGCTTTCACCTCTATGGCTCTGCCGCTGCAGGCTTCTCTGCCGGTTACCGCTATCTCTACCCGTCTGATCTTCCCGTCTTCTT

[0024] GCACCAAACGTTACGTTCCGCGTCGTGTTACCGCTCTGAAACTGTCTA

[0025] ACGAACTGACCATGCGTCGTTCTGCTTACTACAAACCGCCGATCTGGT

[0026] CTTTCGAATACATCCAGTCTCTGAAACTGGAATACGTTGGTGGTGAAT

[0027] CTTTCAAACGTCACATCAACAAACTGAAAGAAGACGTTATCGCTATGC

[0028] TGGAAGGTGAAGAAATGGACAAAGACCCGTCTCACCAGCTGGAACTG

[0029] ATCGACACCCTGCAGCGTCTGGGTCTGTCTTACCACTTCGAAAACGAA

[0030] ATCAACCGTATCCTGAAAAAAGTTTACACCAAACACCAGGGTTACTA

[0031] CGGTCTGGAACGTCACTCTCTGTACGTTGCTGCTCTGGAATTCCGTAT

[0032] CCTGCGTCAGCACGGTTACAAAGTTCCGCAGGAAATCTTCAAATCTTT

[0033] CCTGAACGAACGTGGTAACTTCAAACCGTGCCTGAAAAACGACTGCA

[0034] AAGGTATGCTGTTCCTGTACGAAGCTTCTTTCCTGTCTCTGGAAGGTG

[0035] AATCTATCCTGGACGCTGCTCGTACCTTCGCTCGTAACTACCTGTCTG

[0036] AATACGTTAAACTGAACGAAACCAAAGACCCGTACCTGTCTACCCTG

[0037] GTTGAACACGCTCTGGAATTCCCGCTGCACTGGCGTATGCCGCGTATG

[0038] GAAGCTCGTTGGTTCATCGAAGTTTACAAACAGTCTCCGGACATGAAC

[0039] CCGGTTCTGCTGGACCTGGCTAAACTGGACTTCAACATGGTTCAGGCT

[0040] ACCTACCAGGAAGACCTGAAAGACGCTTCTCGTTGGTGGAACAAATC

[0041] TGGTCTGGGTCAGAACCTGGAATTCATCCGTGACCGTCTGGTTGAAAA

[0042] CTTCCTGTGGACCACCGGTGTTCTGTTCCAGCCGCAGTACGCTTACTA

[0043] CCGTCGTATGGCTACCCAGGTTAACGCTCTGCTGACCACCATCGACGA

[0044] CGTTTACGACGTTTACGGTACCCTGGACGAACTGGAACTGTTCACCGA

[0045] CGTTATCGAACGTTGGGACATCAACGCTATCGAACAGCTGCCGGACT

[0046] ACATGAAACTGTGCTTCTTCGCTGTTCACAACTCTATGAACCAGATCG

[0047] CTTCTGACATCTTCCAGGAACAGGGTATCAACATCCTGCCGTACTCTA

[0048] AAAAAGCTTGGCTGGACCTGTGCAAATCTTACCTGATCGAAGCTAAAT

[0049] GGTACCACCAGGGTTACAAACTGTCTCTGCACGAATACATCGACAAC

[0050] GCTGTTATCTCTATCGCTGCTCCGCTGATGCTGATCCACGCTTACATCC

[0051] TGTCTTCTAACCACATCACCACCGAAGTTCTGCAGTACCTGGAAGAAG

[0052] AACTGCCGAACATCATCCGTTGCTCTTCTATGGTTCTGCGTCTGGCTG

[0053] ACGACCTGGGTACCTCTCCGGACGAAATGCGTCGTGGGTGACGTTCCGA

[0054] AATCTATCCAGTGCTACATGCACGAAACCGGTGCTTCTGAAGAAAAC

[0055] GCTCGTGAATACATCCAGGACCTGATCGACAAAACCTGGAACAAAAT

[0056] GAACAAAGACCAGTTCGAACACTCTCCGCTGCCGCAGACCCTGATCG

[0057] AAGCTGCTATGAACCTGGCTCGTATTGGCTCAGTTCATGTACAAACACG

[0058] GTGACGGTCACTCTTCTCAGGACGACGTTATGCGTCACTCTGTTCTGT

[0059] CTCTGCTGATCAACCCGATCCCCGCTGCCGGCTCCGGAAGAATCTCACA

[0060] TCACCGCT

[0061] This invention provides a protein for catalyzing the synthesis of camphene, the amino acid sequence of which is shown in SEQ ID No. 2; specifically as follows:

[0062] .

[0063] This invention provides a method for preparing the aforementioned protein, comprising the following steps:

[0064] 1) The gene clone is ligated into the initial vector to obtain a recombinant vector;

[0065] 2) The recombinant vector was transferred into the initial strain to obtain the recombinant strain;

[0066] 3) Culturing the recombinant strain to obtain bacterial cells;

[0067] 4) The bacterial cells were lysed to obtain cell lysate, which was then purified to obtain the target protein.

[0068] In this invention, the gene clone is ligated into an initial vector to obtain a recombinant vector; the initial vector is preferably a pCold vector; the pCold vector contains an inducible promoter, which can initiate the expression of the target protein under low temperature conditions, and is preferably purchased from Miaoling Biotechnology Co., Ltd. In this invention, the gene is preferably cloned between the Nde1 and EcoR1 restriction sites of the pCold vector; in this invention, the recombinant vector is preferably constructed using a double enzyme digestion and ligation method. This invention does not have specific limitations on the specific operating parameters, as long as the recombinant vector can be constructed.

[0069] In this invention, after obtaining the recombinant vector, the recombinant vector is transformed into an initial strain to obtain a recombinant strain. In this invention, the initial strain is preferably *Escherichia coli* BL21(DE3). This invention does not specifically limit the method for constructing the recombinant strain; conventional methods for constructing recombinant strains in the art can be used.

[0070] After obtaining the recombinant strain, the present invention cultivates the recombinant strain to obtain bacterial cells. During the cultivation of the recombinant strain, the present invention uses IPTG as an inducer to induce the expression of the target protein.

[0071] In this invention, after obtaining the bacterial cells, the bacterial cells are lysed to obtain cell lysate, which is then purified to obtain the target protein.

[0072] In this invention, high-pressure crushing is preferably used for crushing, with the crushing temperature preferably being 3-5°C, more preferably 4°C; the crushing pressure preferably being 800-1000 bar; and the crushing time being 3-5 minutes; further preferably, a high-pressure low-temperature crusher is used. After crushing, the crushed bacterial solution is centrifuged, and the supernatant is collected; then purification is performed, preferably using a Ni affinity chromatography column.

[0073] The present invention also provides a method for producing camphene, comprising the following steps:

[0074] The substrate, reaction solution, and the protein were mixed and incubated. After the reaction was terminated, calf intestinal alkaline phosphatase was added to dephosphorylate the product, yielding camphene.

[0075] In this invention, the substrate, reaction solution, and protein are mixed and incubated. The incubation temperature is preferably 25–35°C, more preferably 28–32°C, and most preferably 30°C. The incubation time is preferably 10–20 min, more preferably 12–18 min, and most preferably 15 min. In this invention, the substrate is preferably Gpp, and the concentration of the substrate in the reaction system is preferably 0.5–5 mM, more preferably 1–4 mM, and most preferably 3 mM. The concentration of the protein in the reaction system is preferably 0.5–10 mg / mL. In this invention, the reaction solution comprises Tris-HCl, MgCl2, DTT, and PMSF; the concentration of Tris-HCl in the reaction system is preferably 40–60 mM, more preferably 45–55 mM, and most preferably 50 mM; the pH value of Tris-HCl is preferably 7.2; the concentration of MgCl2 in the reaction system is preferably 8–12 mM, more preferably 9–11 mM, and most preferably 10 mM; the concentration of DTT in the reaction system is preferably 3–7 mM, more preferably 4–6 mM, and most preferably 5 mM; the concentration of PMSF in the reaction system is preferably 0.5–1.5 mM, more preferably 0.8–1.2 mM, and most preferably 1 mM.

[0076] The present invention terminates the reaction after the mixing and incubation; the preferred method of terminating the reaction is to quench the reaction system on ice.

[0077] In this invention, calf intestinal alkaline phosphatase is added to dephosphorylate the product. The volume of the calf intestinal alkaline phosphatase is preferably 1-2% of the reaction system volume, more preferably 1.5%. The dephosphorylation temperature is preferably 36-38°C, more preferably 37°C. The dephosphorylation time is preferably 50-70 min, more preferably 55-65 min, and most preferably 60 min.

[0078] After obtaining the camphene, the present invention preferably further includes the extraction and GC-MS detection of the camphene. In this invention, the extraction is preferably performed using n-hexane as the extraction solvent, the volume of n-hexane being 1 to 2 times the volume of the reaction system, the extraction time being preferably 10 to 20 minutes, and the extraction process preferably involving stirring; after the extraction is completed, GC-MS detection is preferably performed.

[0079] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0080] Example 1

[0081] Construction of recombinant strains expressing proteins

[0082] The gene sequence shown in SEQ ID No. 1 was synthesized from Wuhan Jinkairui Biotechnology Co., Ltd.

[0083] To achieve efficient expression of the target protein, the pCold vector (purchased from Miaoling Biotechnology Co., Ltd.), which is widely used in protein expression, was selected to construct the recombinant vector.

[0084] Specific steps:

[0085] First, the linearized pCold vector was digested with restriction endonucleases Nde1 and EcoR1, and then the linearized vector was separated, recovered and purified by electrophoresis.

[0086] The purified vector and the gene fragment (SEQ ID No. 1) were mixed at a molar ratio of 1:1 and ligated using the gibson assembly method. The mixture was then incubated at 50°C for 1 hour to construct the recombinant expression vector.

[0087] DH5α competent cells (approximately 100 μL) were removed from the cryogenic freezer and immediately placed on ice. After thawing, 5 μL of the constructed vector was added, and the cells were incubated on ice for 30 min. Then, they were heat-shocked in a 42°C metal bath for 45 s, and immediately placed on ice for 2 min to cool. 1 mL of LB medium was then added, and the cells were incubated at 37°C for 45 min at 220 rpm. All cells were then plated onto ampicillin (Amp, 100 μg / mL) resistant solid plates and incubated overnight at 37°C. Three positive clones were then picked from the overnight plates, transferred to 5 mL of LB medium, and cultured for 8 h. Plasmids were then extracted. Sequencing verification confirmed the correct strain was preserved.

[0088] Protein expression using recombinant strains

[0089] 1. Expressing the target protein using recombinant strains

[0090] a) The preserved recombinant strain was inoculated into a small test tube containing 5 mL of LB liquid medium (Amp content 100 μg / mL) and cultured overnight at 37°C and 220 rpm to obtain the seed culture.

[0091] b) Transfer the seed culture to a 50 mL bottle containing LB liquid medium (Amp content 100 μg / mL) and incubate on a shaker at 37 °C and 220 rpm to reactivate the bacterial culture.

[0092] c) Using an inoculum of 1% (v / v), transfer the reactivated bacterial culture to a bottle containing 800 mL of 2YT liquid medium (Amp content 100 μg / mL) and incubate on a shaker at 37°C and 220 rpm until the OD600 reaches 0.6-0.8.

[0093] d) Reduce the temperature of the shaker to 16-18℃, add isopropyl thio-β-D-galactoside (IPTG) to a final concentration of 0.5mM, and induce expression for 14-16h.

[0094] e) After expression is complete, collect the culture medium into a bottle, pre-cool the centrifuge to 4°C, and centrifuge at 5500 rpm for 10 min.

[0095] f) Discard the supernatant, add 30 mL of protein purification buffer, and resuspend the bacteria using a vortex mixer. Centrifuge again at 5500 rpm for 10 min. Discard the supernatant, add another 30 mL of protein purification buffer, resuspend the bacteria using a vortex mixer (ensuring no solid particles remain), and transfer to a 50 mL centrifuge tube. Store at -80°C.

[0096] 2. Perform high-pressure crushing and centrifuge to collect the supernatant.

[0097] a) Take the collected bacterial culture and use a high-pressure cryogenic disruptor at 4°C and 800-1000 bar for 3-5 minutes to fully lyse the cells and release the target protein into the protein buffer.

[0098] b) Centrifugation: Place the broken bacterial culture into a pre-cooled 4℃ centrifuge and centrifuge at 8000rpm for 60min. Separate the precipitate and supernatant after centrifugation and collect the supernatant.

[0099] 3. Protein purification was performed using a Ni affinity chromatography column.

[0100] a) The supernatant was purified by nickel affinity chromatography, and the specific steps are as follows:

[0101] First, wash the column with double-distilled water for 2 column volumes, then equilibrate the Ni affinity chromatography column with protein buffer for 1 column volume.

[0102] b) Take the supernatant and slowly pass it through the Ni affinity chromatography column, collecting the first few drops of sample.

[0103] c) Elute with protein buffers containing 20 mM, 50 mM, 100 mM, 200 mM and 300 mM imidazole to remove bound contaminating proteins. Use the first few drops of the flow-through sample for sample preparation and perform detection using 12% SDS-PAGE.

[0104] d) Concentration and buffer replacement: The eluent containing the target protein was concentrated by centrifugation (4°C, 3400 rpm) using a 10 kDa Amicon ultrafiltration tube (Millipore) to a final volume of 1 mL. Then, 10 mL of protein buffer was added to concentrate the eluent to a final volume of 1 mL. This step was repeated once to ensure that imidazole in the protein was removed and a purified protein sample was obtained.

[0105] 4. Protein concentration determination

[0106] Protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).

[0107] First, the protein concentration was initially determined by measuring the absorbance at 280 nm, and the protein was diluted to a concentration of 0.5-1 mg / mL based on the preliminary results. Then, reagent A and reagent B were prepared in a 50:1 ratio to prepare the reaction solution.

[0108] Take 200 μL of the reaction solution into the ELISA plate and add 25 μL of diluted protein sample. Mix well by pipetting and incubate the reaction solution at 37°C for 30 min.

[0109] Subsequently, the ELISA plate was placed in an ELISA reader to measure the absorbance at 562 nm, and the data was processed according to the protein standard curve to determine the protein concentration.

[0110] Example 2

[0111] Camphene was synthesized using the target protein prepared in Example 1 as a catalyst.

[0112] The reaction mixture consisted of 200 mL containing 3 mM GPP, 50 mM Tris-HCl (pH 7.2), 10 mM MgCl2, 5 mM DTT, and 1 mM PMSF.

[0113] At the start of the catalytic reaction, different concentrations of purified target protein (0.5 mg / mL, 1 mg / mL, 5 mg / mL, 10 mg / mL) were added, and the reaction mixture was incubated at 30 °C for 15 min.

[0114] The reaction was stopped 5 minutes after incubation and immediately quenched on ice.

[0115] To promote dephosphorylation of the product, 3 mL of calf intestinal alkaline phosphatase manufactured by TaKaRa was added after quenching on ice, and the mixture was incubated at 37°C for 1 h.

[0116] Subsequently, 300 mL of n-hexane was added, and the mixture was stirred for 15 min to extract monoterpenoids. The extracted n-hexane was filtered through a 0.22 μm filter membrane and then analyzed by GC-MS.

[0117] GC-MS analysis was performed using an Agilent 7890A gas chromatograph system equipped with a DB-5MS capillary gas chromatograph column coated with 5% diphenyl and 95% dimethyl polysiloxane (30 m long, 250 μm inner diameter, 0.25 mm film thickness, J&W Scientific, USA). The oven temperature program was set as follows: initial temperature 50 °C, hold for 2 min, then ramp to 180 °C at 5 °C / min (hold for 5 min), followed by ramp to 230 °C at 10 °C / min. The temperatures of the inlet, transfer line, and ion source were controlled at 250 °C, 290 °C, and 230 °C, respectively. Only 1 mL of sample was added in split mode, with an injection ratio adjusted to 10:1. Finally, mass spectrometry data were acquired in full scan mode, covering the m / z range of 35–650, with a solvent delay of 7.5 min.

[0118] Test results as follows Figure 2 As shown, the yield of camphene synthesized by the protein catalysis shown in SEQ ID No. 2 is 23.8 mg / L, with a purity of about 30%.

[0119] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A gene catalyzing the synthesis of camphene, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. A biocatalyst for the synthesis of camphene, characterized in that, The amino acid sequence of the bioenzyme is shown in SEQ ID No.

2.

3. The method of claim 2, wherein the biological enzyme is prepared by the steps of: Includes the following steps: 1) The gene clone of claim 1 is ligated into the initial vector to obtain a recombinant vector; 2) The recombinant vector was transferred into the initial strain to obtain the recombinant strain; 3) Culturing the recombinant strain to obtain bacterial cells; 4) The bacterial cells were lysed to obtain cell lysate, which was then purified to obtain the target protein.

4. The preparation method according to claim 3, characterized in that, The initial carrier is the pCold carrier.

5. A method for producing camphene, characterized in that, Includes the following steps: The substrate gerany pyrophosphate, the reaction solution, and the bioenzyme described in claim 2 were mixed and incubated. After the reaction was terminated, calf intestinal alkaline phosphatase was added to dephosphorylate the product to obtain camphene. The reaction solution includes 40-60 mM Tris-HCl, 8-12 mM MgCl2, 3-7 mM dithiothreitol DTT, and 0.5-1.5 mM benzyl sulfonyl fluoride PMSF.

6. The method according to claim 5, characterized in that, The temperature for the mixed incubation is 25~35℃, and the incubation time is 10~20min.

7. The method according to claim 5, characterized in that, The concentration of the substrate geranylide pyrophosphate in the reaction system is 0.5~5mM; the concentration of the bioenzyme in the reaction system is 0.5~10mg / mL.

8. The method according to claim 5, characterized in that, The volume of the calf intestinal alkaline phosphatase is 1-2% of the reaction system volume; the dephosphorylation temperature is 36-38℃, and the dephosphorylation time is 50-70 min.

Images