A linear polypeptide targeting DDR1 and a preparation method and application thereof

Abstract

The present application relates to a kind of polypeptide targeting DDR1 and its preparation method and application. Wherein polypeptide includes straight-chain polypeptide Z1 And Z2. The amino acid sequence of Z1 is IHLQGGVGWQKYGGG, and the amino acid sequence of Z2 is YVYDIFPERWNVGGG. The present application also includes the method for preparing straight-chain polypeptide, preliminary step includes using phage screening technology to construct engineering bacteria, and straight-chain polypeptide is synthesized by chemical synthesis method. In addition, the present application also relates to the method for preparing the straight-chain polypeptide prepared and applied to antitumor drug. Specifically, the antitumor drug can be used to prepare the drug for treating cancer types such as lung cancer and breast cancer, wherein lung cancer is non-small cell lung cancer (NSCLC), and breast cancer is invasive ductal carcinoma.

Description

Technical Field

[0001] This invention relates to the field of targeted therapy drugs for tumors, specifically to a linear polypeptide targeting DDR1, its preparation method, and its application. Background Technology

[0002] In recent years, targeted therapy has become a research hotspot in cancer treatment. Within targeted therapy, the tyrosine kinase family is closely related to tumorigenesis. Protein kinases participate in regulating signaling networks crucial for cell growth, proliferation, and survival. Discoidin domain receptor 1 (DDR1) is an important member of the tyrosine kinase receptor (RTK) family. DDR1 expression is increased to varying degrees in various tumor tissues. Integrated diagnosis and treatment targeting DDR1 has broad application prospects and advantages.

[0003] DDR1 is a protein kinase associated with tumorigenesis and development. Its overactivation or aberrant expression is related to the formation and invasion of various tumors. Therefore, researchers have been exploring the possibility of using DDR1 as a new target for tumor therapy. Currently, diagnostic and therapeutic technologies targeting DDR1 (DNA-dependent protein kinase 1) are still in the research and development stage. Research on DDR1 inhibitors mainly focuses on two directions: small molecule inhibitors and antibody drugs. Small molecule inhibitors can be screened for highly selective and affinity molecules through molecular mimicry and drug screening. Some small molecule inhibitors targeting DDR1 have undergone in vitro and animal experiments and have achieved some encouraging results. Antibody drugs generally have higher specificity and affinity, and can more accurately recognize and bind to DDR1, thereby effectively inhibiting its activity. Some antibody drugs targeting DDR1 (such as KT17638, D17125, UC6254, erlotinib, etc.) are undergoing early clinical trials to evaluate their efficacy and safety in certain tumor types.

[0004] However, there are currently no reported studies on peptide drugs targeting DDR1. Nevertheless, due to the rapid development and continuous innovation in scientific research, new treatment strategies, including peptide inhibitors, may emerge in the future to target DDR1. Summary of the Invention

[0005] This invention provides a linear polypeptide targeting DDR1, its preparation method, and its application, which fills the gap in the types of drugs targeting DDR1 and can be used as a potential anti-tumor drug for research and development.

[0006] The specific technical solution is as follows:

[0007] A polypeptide targeting DDR1, wherein the polypeptide is a linear polypeptide, including linear polypeptides Z1 and Z2.

[0008] Furthermore, the amino acid sequence of the linear polypeptide Z1 is SEQ ID No:1

[0009] The molecular structure of IHLQGGVGWQKYGGG is:

[0010]

[0011] Furthermore, the amino acid sequence of the linear polypeptide Z2 is SEQ ID No:2

[0012] YVYDIFPERWNVGGG, the molecular structural formula is:

[0013]

[0014] A method for preparing a linear polypeptide targeting DDR1 includes the following steps:

[0015] S1. A linear peptide phage display peptide library kit was used to select positive clones that could specifically bind to DDR1. DNA was extracted and sequenced, and a peptide library was constructed based on the sequencing results to obtain the peptide amino acid sequence.

[0016] S2, chemically synthesized linear polypeptides; using a solid-phase synthesis process, linear polypeptides are synthesized sequentially from the C-terminus to the N-terminus of the peptide chain.

[0017] An application of a prepared linear polypeptide targeting DDR1, wherein the linear polypeptide targeting DDR1 can specifically bind to DDR1, thereby preparing linear polypeptide-based targeted...

[0018] Inhibitors of DDR1, a linear polypeptide class of inhibitors targeting DDR1, are used to prepare anti-tumor drugs.

[0019] Furthermore, the tumors include lung cancer and breast cancer.

[0020] Furthermore, the lung cancer is non-small cell lung cancer, and the breast cancer is invasive ductal carcinoma.

[0021] Furthermore, the linear polypeptide Z1 or Z2 is capable of specifically binding to the lung cancer HARA cell line.

[0022] Furthermore, the linear polypeptide Z1 or Z2 is capable of specifically binding to the breast cancer MCF7 cell line.

[0023] Introduction to the working principle of this invention:

[0024] This invention synthesizes linear peptides Z1 and Z2 using phage screening technology. These peptides exhibit targeting of DDR1, and DDR1 is highly expressed in NSCLC cells and invasive ductal carcinoma cells. Upregulation of DDR1 can promote the occurrence, development, and invasiveness of malignant tumors, as well as early homing and colonization of tumor cells or bone metastases. Interference with DDR1 expression can inhibit tumor growth and metastasis. Targeted therapy with DDR1 can disrupt the collagen fiber arrangement of tumors and neutralize the immune escape function of DDR1, potentially achieving precise tumor treatment without damaging normal organ function. This invention yields linear peptides targeting DDR1, and experimental results show that they can bind to lung cancer and breast cancer cell lines that highly express DDR1. Future research could involve linking anti-tumor drugs to these peptides to exert therapeutic effects.

[0025] Compared with the prior art, the beneficial effects of the present invention are:

[0026] Two linear polypeptides targeting DDR1 were developed and synthesized. These polypeptides can be used for the subsequent development of molecular probes targeting DDR1 and the development of targeted drugs, and have potential targeted therapeutic value for tumors expressing DDR1. Attached Figure Description

[0027] Figure 1 Flowchart of screening technology for Ph.D.-12 phage display peptide library kit (#E8110S);

[0028] Figure 2 Sequencing analysis of positive clones obtained after screening for phage display peptide libraries (Ph.D.-12);

[0029] Figure 3 This is a molecular structure diagram of the linear polypeptide Z1 of the present invention;

[0030] Figure 4 This is a molecular structure diagram of the linear polypeptide Z2 of the present invention;

[0031] Figure 5 This is a high-performance liquid chromatography (HPLC) analysis report of the linear polypeptide Z1 of the present invention;

[0032] Figure 6 This is a high-performance liquid chromatography (HPLC) analysis report of the linear polypeptide Z2 of the present invention;

[0033] Figure 7 The image shows the fluorescence of FITC-Z1 binding to HARA lung cancer cells.

[0034] Figure 8 Fluorescence image of FITC-Z1 binding to MCF7 breast cancer cells;

[0035] Figure 9 The image shows the fluorescence of FITC-Z2 binding to HARA lung cancer cells.

[0036] Figure 10 This is a fluorescence image showing the binding of FITC-Z2 to MCF7 breast cancer cells. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that these descriptions are merely exemplary and not intended to limit the scope of the invention. Furthermore, in the following descriptions, well-known structures and techniques have been omitted to avoid unnecessarily obscuring the concept of the invention.

[0038] Example 1:

[0039] 1. Selection

[0040] The NEB random peptide library: Ph.D.-12 phage display peptide library kit (#E8110S) was screened using DDR1 Protein, Human, Recombinant (His Tag) protein to obtain 1-5 positive clones.

[0041] 2. Phage ELISA identification

[0042] 2.1 Preparation of Phage Supernatant

[0043] 1) Dilute ER2738 cultured overnight at a ratio of 1:100 and dispense 1 mL into centrifuge tubes.

[0044] 2) Pick a single clone into a centrifuge tube.

[0045] Note: Plaques on the plates should not be kept for more than 3 days and should be stored at 4°C. Each plate should contain no more than 100 single clones to ensure that only single clones are picked.

[0046] 3) Incubate at 37℃ and 220rpm for 4.5-5 hours.

[0047] Note: The incubation time should not exceed 5 hours.

[0048] 4) Centrifuge at 14000 rpm for 30 seconds, and transfer the supernatant to a new centrifuge tube; centrifuge at 14000 rpm for 30 seconds, and transfer 80% of the supernatant to a new centrifuge tube, which is the Phage supernatant.

[0049] 2.2 Phage ELISA Detection

[0050] 1) Coating: Coat DDR1 protein, 0.1 μg / mL, at 4°C overnight.

[0051] 2) Sealing: 2% skim milk powder, 200μL / well, 37℃ for 1h.

[0052] 3) Primary antibody: Phage supernatant, 100 μL / well, 37℃ for 1 h.

[0053] 4) Secondary antibody: anti-M13 antibody (HRP), 1:20000, 100μL well, 37℃ for 1h.

[0054] 5) Color development: 100 μL of color development solution per well, 37℃, 15 min.

[0055] 6) Termination: 100 μL of termination solution per well.

[0056] 7) Reading board: Antibody titer.

[0057] 3. Single-stranded DNA extraction and sequencing

[0058] 3.1 Single-stranded DNA extraction and sequencing

[0059] 1) Dilute ER2738 cultured overnight at a ratio of 1:100 and dispense 1 mL into centrifuge tubes.

[0060] 2) Pick a single clone into a centrifuge tube.

[0061] Plaques on the plates should not be kept for more than 3 days and should be stored at 4°C. Each plate should contain no more than 100 single clones to ensure that only single clones are picked.

[0062] 3) Incubate at 37℃ and 220rpm for 4.5-5 hours.

[0063] Note: The incubation time should not exceed 5 hours.

[0064] 4) Centrifuge at 14000 rpm for 30 seconds, and transfer the supernatant to a new centrifuge tube; centrifuge at 14000 rpm for 30 seconds, and transfer 500 μL of supernatant to a new centrifuge tube.

[0065] 5) Add 200 μL of 20% PEG / 2.5M NaCl, mix by inverting the container, and let stand at room temperature for 20 min.

[0066] 6) Centrifuge at 4℃ and 14000rpm for 10min, then discard the supernatant (you may not see the phage precipitate).

[0067] 7) Instantly centrifuge, discarding all the pure essence.

[0068] 8) Add 100 μL of Iodide Buffer and resuspend and mix well. Add 250 μL of ethanol and incubate at room temperature for 20 min.

[0069] Note: Short-term room temperature incubation can effectively precipitate single-stranded phage DNA, allowing most of the phage proteins to remain in the solution.

[0070] 9) Centrifuge at 4℃ and 14000rpm for 10min, and discard the supernatant. Wash twice with 0.5mL of 70% ice-cold ethanol, centrifuge at 4℃ and 14000rpm for 10min, and discard the supernatant. Dry for 3-5min.

[0071] 10) Resuspend in 30 μL of TE and store at -20°C.

[0072] 11) Use a 96 sequencing primer to sequence and verify single-stranded DNA.

[0073] 3.2 Sequencing Results

[0074] A total of 11 positive clones were sequenced, and 4 sequences showed bimodal distributions (Ph.D.-12), with 2 sequences successfully sequenced. Of the 2 successfully sequenced sequences, 2 contained peptides that met the screening criteria, as shown below. Figure 1 As shown.

[0075] Results and Discussion: After screening and ELISA detection in steps 1 and 2, phages that could target and bind to DDR1 were obtained. Phages that could not bind to DDR1 were washed out. The phages that bound to DDR1 were further extracted and sequenced in step 3 using the Ph.D.-12 Phage Display Peptide Library Kit (#E8110S). In step 4, the amino acid sequence was constructed based on the base sequence obtained from the bound phage DNA, thus obtaining two linear polypeptide structures.

[0076] 4. Based on the sequencing results, the base and amino acid sequences of the two linear polypeptides are shown in Table 1.

[0077] Table 1. Peptide sequences obtained through screening

[0078] ATTCATTTGCAGGGTGGGGTTGGGTGGCAGAAGTAT IHLQGGVGWQKY TATGTTTATGATATTTTTCCTGAGCGTTGGAATGTG YVYDIFPERWNV

[0079] 5. Chemical synthesis of peptides: Using a solid-phase synthesis process, linear peptides were synthesized sequentially from the C-terminus to the N-terminus of the peptide chain, yielding three linear peptides, Z1 and Z2, as shown in the figure. The synthesized linear peptides are as follows: The chemical structure of Z1 is: C 71 H 105 N 21 O 19 Molecular structural formula as follows Figure 3 The amino acid sequence is SEQ ID No: 1IHLQGGVGWQKYGGG; the chemical structural formula of Z2 is: C 84 H 114 N20 O 23 Molecular structural formula as follows Figure 4 The amino acid sequence is SEQ ID No: 2YVYDIFPERWNVGGG. High-performance liquid chromatography (HPLC) analysis showed that the molecular weights of the two linear polypeptide main peaks were consistent with theoretical values. Figure 5 , 6 As shown.

[0080] Example 2: Results and Discussion of In Vitro Binding Assay

[0081] In vitro binding assays were performed using screened and synthesized linear peptides capable of binding to DDR1 and coated DDR1 protein. The results showed that both peptides could bind to DDR1 protein in vitro, and the absorbance of both peptides after binding was detected at A450 nm. Moreover, the binding gradually decreased with increasing sample dilution. The results are shown in Table 2.

[0082] ELISA testing

[0083] 1) Coating: Coat DDR1 protein, 0.1 μg / mL, at 4°C overnight.

[0084] 2) Sealing: 2% skim milk powder, 200μL / well, 37℃ for 1h.

[0085] 3) Primary antibody: 100 μL / well, 37℃ for 1 h.

[0086] 4) Secondary antibody: anti-M13 antibody (HRP), 1:20000, 100μL well, 37℃ for 1h.

[0087] 5) Color development: 100 μL of color development solution per well, 37℃, 15 min.

[0088] 6) Termination: 100 μL of termination solution per well.

[0089] 7) Reading board: Antibody titer

[0090] Table 22 shows the ELISA validation of the binding of 22 linear peptides to DDR1.

[0091]

[0092]

[0093] (Note: The first column is the sample dilution rate, and the last two columns are the absorbance of the two linear polypeptides, respectively.)

[0094] Example 3: Cell fluorescence binding assay

[0095] After cells reached 80% confluency on a glass slide, they were incubated, washed, fixed, and then subjected to a blocking process. Two polypeptides, FITC-Z1 and FITC-Z2, were first labeled with fluorescein-5-aminothiourea (FITC) to obtain two fluorescent polypeptide probes. These two fluorescent polypeptides were then used to treat cells (HARA lung cancer cells and MCF7 breast cancer cells) for approximately 1 hour, followed by DAPI staining, overnight incubation, and washing to detect the binding of the two linear polypeptides to the cells.

[0096] Analysis of experimental results: Both FITC-Z1 and FITC-Z2 fluorescent peptide probes were able to bind to cells (HARA cells for lung cancer; MCF7 cells for breast cancer), such as... Figure 7-10 As shown, green fluorescence was detected after FITC-peptides bound to cells, mainly due to binding to the cell membrane and cytoplasm. The blue sphere in the middle of the cell in the figure is the cell nucleus. Figure 7 , Figure 8 This enables FITC-Z1 to bind to HARA cells in lung cancer and MCF7 cells in breast cancer. Figure 9 , Figure 10 This study demonstrated the binding of FITC-Z2 to HARA cells in lung cancer and MCF7 cells in breast cancer.

[0097] It should be understood that the specific embodiments described above are merely illustrative of the invention or for explaining the principles of the invention, and do not constitute a limitation thereof. Therefore, any modifications, equivalent substitutions, improvements, etc., made without departing from the spirit and scope of the invention should be included within the protection scope of the invention. Furthermore, the appended claims are intended to cover all variations and modifications falling within the scope and boundaries of the appended claims, or equivalent forms of such scope and boundaries.

Claims

1. A linear polypeptide targeting DDR1, characterized in that, The linear polypeptide is Z1 or Z2; The amino acid sequence of Z1 is shown in SEQ ID No:1, and its molecular structure is as follows: ； The amino acid sequence of Z2 is SEQ ID No:2, and its molecular structure is: 。 2. An application of the linear polypeptide targeting DDR1 according to claim 1, wherein the application is for the preparation of an antitumor drug, wherein the drug is an anti-lung cancer or anti-breast cancer drug.

3. The application according to claim 2, characterized in that, The lung cancer is non-small cell lung cancer, and the breast cancer is invasive ductal carcinoma.

Images