A genetically engineered strain with high lacto-n-biose-n-neotetraose generating low lacto-n-biose-n-triose residue and application thereof

Abstract

The application discloses a genetically engineered strain for producing high-lactosyl-N-neotetraose with low lactosyl-N-triose residue and application thereof, and belongs to the field of microbial genetic engineering. The application blocks a competitive pathway of lactosyl-N-neotetraose synthesis, introduces a beta-1, 3-N-acetylglucosaminyltransferase gene lgtA and a beta-1, 4-galactosyltransferase gene lgtB, divides the lactosyl-N-neotetraose synthesis pathway into three modules, optimizes the expression level of each module, balances the synthesis flux of each module systematically, and improves the synthesis of lactosyl-N-neotetraose. Further, the synthesis pathway flux is fine-tuned by adjusting the translation initiation intensity of lgtB. Finally, the yield of lactosyl-N-neotetraose reaches 6.70 g / L in a shake flask culture and 19.40 g / L in a 3-liter bioreactor, and the residual amount of lactosyl-N-triose II is 1.79 g / L, which lays a foundation for the industrial application of lactosyl-N-neotetraose.

Description

Technical Field

[0001] This invention relates to a genetically engineered strain that produces low lactyl-N-trisaccharide residues from high lactyl-N-neotetrasaccharide production and its applications, belonging to the field of genetic engineering technology. Background Technology

[0002] Human milk oligosaccharides (HMOs) consist of three different types of oligosaccharides: fucoidylated oligosaccharides, non-fucosylated neutral oligosaccharides, and sialylated oligosaccharides. Lactoyl-N-neotetrasaccharide is one of the most abundant and important non-fucosylated neutral oligosaccharides, accounting for approximately 6% of the total HMOs (by molar ratio). Lactoyl-N-neotetrasaccharide has probiotic, immunomodulatory, anti-inflammatory, necrotizing enterocolitis prevention, and intestinal epithelial cell maturation-promoting effects. Furthermore, clinical trials in infants and adults have shown that lactoyl-N-neotetrasaccharide is non-toxic, safe, and effectively promotes the proliferation of Bifidobacteria, improving the intestinal microecological environment. Lactoyl-N-neotetrasaccharide has received GRAS approval from the U.S. Food and Drug Administration (FDA). In addition, it has been approved for use as a functional ingredient in infant formula, demonstrating significant commercial value.

[0003] Currently, the production of lactyl-N-neotetrasaccharides using chemical and microbial methods has been approved. Chemical methods suffer from drawbacks such as complex reaction steps, expensive substrates, and environmental hazards. In contrast, microbial synthesis utilizes inexpensive glycerol or glucose as carbon sources to produce lactyl-N-neotetrasaccharides without negative environmental impacts. Therefore, the microbial synthesis of lactyl-N-neotetrasaccharides is attracting increasing attention.

[0004] The reported methods for synthesizing lactyl-N-neotetrasaccharides using microorganisms mainly use Escherichia coli as the production host and employ metabolic engineering strategies to modify the strain to produce lactyl-N-neotetrasaccharides. Although Zhang et al. (Designing a Highly Efficient Biosynthetic Route for Lacto-N-neotetraose Production in Escherichia coli) developed a strain of Escherichia coli BL21(DE3) that can produce LNnT by discovering a novel β-1,4-galactosyltransferase (Aa-β-1,4-GalT), deleting the β-galactosidase gene lacZ, the UDP-N-acetylglucosamine 2-iminotransferase gene wecB, and the glucosamine-6-phosphate deaminase gene nagB, and optimizing the expression levels of the UDP-glucose-4-epimerase gene galE, the β-1,3-N-acetylglucosamine transferase gene lgtA, and the Aa-β-1,4-GalT gene, and obtained 12.10 g / L of lactoyl-N-neotetraose through batch fermentation culture with a production rate of 0.25 g / L / h, 9.36 g / L of lactoyl-N-trisaccharide II remained. Liao et al. (Metabolic Engineering of Escherichia coli forHigh-Level Production of Lacto-N-neotetraose and Lacto-N-tetraose was fermented to obtain 22.07 g / L of lactyl-N-neotetraose with a yield of 0.41 g / L / h. However, a large amount of lactyl-N-trisaccharide II (19.78 g / L) remained. This was achieved by optimizing the expression of three key genes: lgtA, galE, and HpgalT, a β-1,4-galactosyltransferase from Helicobacter pylori, and knocking out UDP-glucose 6-dehydrogenase gene ugd, uridine 5'-bisphosphate hydrolase ushA, glucose-1-phosphatase aggp, UPD-glucose lipotransferase wcaJ, trehalose 6-phosphate synthase otsA, and claylate biosynthesis galactosyltransferase wcaC to block the competitive consumption pathway of UDP-galactose. Currently, there are no reports of genetically engineered bacteria with high lactyl-N-neotetrasaccharide and low lactyl-N-trisaccharide II residues. Summary of the Invention

[0005] [Technical Issues]

[0006] The technical problem to be solved by this invention is that in the prior art, when synthesizing lactyl-N-neotetrasaccharide by microbial method, a large amount of intermediate product lactyl-N-trisaccharide II remains, which causes waste of cell resources and increases production costs.

[0007] [Technical Solution]

[0008] To address the aforementioned technical problems, this invention knocks out pathway genes in the host bacteria that compete with the precursor for lactyl-N-neotetrasaccharide synthesis. Furthermore, the lactyl-N-neotetrasaccharide synthesis pathway is divided into three modules. The expression levels of each module are optimized by altering plasmid copy numbers to balance metabolic flux. The synthesis flux is further finely controlled by regulating the RBS pathway, thereby promoting lactyl-N-neotetrasaccharide synthesis and reducing lactyl-N-trisaccharide II residue. A genetically engineered strain with high lactyl-N-neotetrasaccharide production and low residual lactyl-N-trisaccharide II, along with its construction method, is provided.

[0009] The first objective of this invention is to provide a genetically engineered bacterium that knocks out the pathway gene competing for the precursor of lactyl-N-neotetrasaccharide synthesis and overexpresses the genes of the following modules a)-c):

[0010] a) Upstream lactyl-N-trisaccharide II synthesis module: β-1,3-acetylglucosamine transferase gene lgtA, phosphoglucosamine mutase gene glmM, fusion N-acetylglucosamine-1-phosphouresyltransferase / glucosamine-1-phosphoacetyltransferase gene glmU, L-glutamine-D-fructose-6-phosphoaminotransferase gene glmS;

[0011] b) Downstream lactyl-N-neotetrasaccharide synthesis module: β-1,4-galactosyltransferase gene lgtB, glucose-phosphotransferase gene pgm, UTP-glucose-1-phosphouridine-transferase gene galU, UDP-glucose 4-episomerase gene galE.

[0012] c) Coordination supply module: ribose-phospho-bisphosphate kinase gene prs, lactose permease gene lacY;

[0013] The genetically engineered strains include Escherichia coli.

[0014] In one embodiment of the present invention, the pathway genes competing for the lactoyl-N-neotetrasaccharide synthesis precursor include β-galactosidase gene lacZ, galactosidase O-acetyltransferase gene lacA, glucosamine-6-phosphate deaminase gene nagB, UDP-N-acetylglucosamine 2-imidease gene wecB, UDP-glucose 6-dehydrogenase gene ugd, quinone protein glucose dehydrogenase gene gcd, and glucose export protein gene setA.

[0015] In one embodiment of the present invention, the NCBI accession number for the nucleotide sequence of the β-galactosidase gene lacZ is CP053602.1 (334064-337138); the NCBI accession number for the nucleotide sequence of the galactosidase O-acetyltransferase gene lacA is CP053602.1 (332082-332693); the NCBI accession number for the nucleotide sequence of the glucosamine-6-phosphate deaminase gene nagB is CP053602.1 (663983-664783); and the NCBI accession number for the UDP-N-acetylglucosamine 2-imidease gene we... The NCBI accession number for the nucleotide sequence of cB is CP053602.1 (3861671-3862801); the NCBI accession number for the nucleotide sequence of the UDP-glucose 6-dehydrogenase gene ugd is CP053602.1 (1995548-1996714); the NCBI accession number for the nucleotide sequence of the quinone protein glucose dehydrogenase gene gcd is CP053602.1 (141640-144030); and the NCBI accession number for the nucleotide sequence of the sugar export protein setA is CP053602.1 (80426-81604).

[0016] In one embodiment of the present invention, the NCBI sequence number of the amino acid sequence of the β-1,3-acetylglucosamine transferase LgtA is WP_002257440.1, or the β-1,3-acetylglucosamine transferase is derived from the Neisseria meningitidis gene lgtA, and its nucleotide sequence is shown in SEQ ID NO.1; the NCBI sequence number of the amino acid sequence of the β-1,4-galactosyltransferase LgtB is WP_002225824.1, or the β-1,4-galactosyltransferase gene lgtB is derived from Neisseria meningitidis, and its nucleotide sequence is shown in SEQ ID NO.1. As shown in NO.2; the NCBI accession number for the nucleotide sequence of the glucose-1-phosphate mutase gene pgm is ECK0676; the NCBI accession number for the nucleotide sequence of the UTP-glucose-1-phosphate uridine transferase gene galU is ECK1231; the NCBI accession number for the nucleotide sequence of the UDP-glucose 4-epiosomease gene galE is ECK0748; the NCBI accession number for the nucleotide sequence of the phosphoglucosamine mutase gene glmM is ECK3165; the L-glutamine- The NCBI accession number for the nucleotide sequence of the D-fructose-6-phosphate aminotransferase gene glmS is ECK3722; the NCBI accession number for the nucleotide sequence of the fusion N-acetylglucosamine-1-phosphate ureosyltransferase / glucosamine-1-phosphate acetyltransferase gene glmU is ECK3723; the NCBI accession number for the nucleotide sequence of the ribose-6-phosphate diphosphate kinase gene prs is ECK1195; and the NCBI accession number for the nucleotide sequence of the lactose permease gene lacY is ECK0340.

[0017] In one embodiment of the present invention, the L-glutamine-D-fructose-6-phosphate aminotransferase gene glmS includes glmS*, which encodes the GlmS mutant GlmS*. The mutation sites of the mutant GlmS* are counted starting from the second amino acid of GlmS (NP_418185) and the following mutations are performed: E14K, D386V, S449P, E524G, where E14K represents the mutation of amino acid E at position 14 to K, D386V represents the mutation of amino acid D at position 386 to V, S449P represents the mutation of amino acid S at position 449 to P, and E524G represents the mutation of amino acid E at position 524 to G.

[0018] In one embodiment of the invention, the deletion is knocked out using a CRISPR / Cas9 system.

[0019] In one embodiment of the present invention, the phosphoglucose mutase gene pgm, the UTP-glucose-1-phosphouridine transferase gene galU, the UDP-glucose 4-epiisomerase gene galE, the phosphoglucosamine mutase gene glmM, the L-glutamine-D-fructose-6-phosphoaminotransferase gene glmS, the gene glmU that fuses N-acetylglucosamine-1-phosphouridine transferase and glucosamine-1-phosphoacetyltransferase, the ribose-phosphobisphosphate kinase gene prs, and the lactose permease gene lacY are all derived from Escherichia coli K-12.

[0020] In one embodiment of the present invention, the gene of module a) is expressed with a low-copy plasmid; the gene of module b) is expressed with a high-copy plasmid; and the gene of module c) is expressed with a medium-copy plasmid. Preferably, the high-copy plasmid includes pRSFDuet-1; the medium-copy plasmid includes pETDuet-1; and the low-copy plasmid includes pCDFDuet-1.

[0021] In one embodiment of the present invention, an RBS with the sequence AATAGGAGA is used as the starting RBS, and the expression of the lgtB gene is performed using an RBS with a relative starting RBS intensity of 0.49-8.04; the relative starting RBS intensity is preferably 1.4-1.5.

[0022] Preferably, the RBS for expressing the IgTB gene has a relative initial RBS intensity of 1.49 and the sequence is TCATTAAGTAAGTAAAGGAGGAGGACA.

[0023] In one embodiment of the present invention, the genetically engineered bacteria includes Escherichia coli BL21(DE3).

[0024] The present invention also provides a method for producing lactyl-N-neotetrasaccharide by fermentation culture using the above-mentioned genetically engineered bacteria, the method comprising the following steps.

[0025] (1) Inoculate the bacterial strain into a culture medium and culture it to obtain bacterial solution;

[0026] (2) Transfer the above bacterial culture to the fermentation medium to ferment and produce lactyl-N-neotetrasaccharide.

[0027] In one embodiment of the present invention, the culture medium in step (1) includes LB culture medium.

[0028] In one embodiment of the present invention, the culture conditions in step (1) are 8h to 12h, 30 to 40℃, and 200 to 220rpm.

[0029] Preferably, the culture conditions are: culture at 37°C for 12 hours.

[0030] In one embodiment of the present invention, the bacterial OD during transfer in step (2) 600 The range is 1 to 3.

[0031] In one embodiment of the present invention, the fermentation culture medium in step (2) comprises: 40-50 g / L carbon source, 3-4 g / L yeast extract, 0.25-1 g / L peptone, 10-15 g / L potassium dihydrogen phosphate, 2-6 g / L diammonium hydrogen phosphate, 1-2 g / L citric acid, 1-2 g / L magnesium sulfate heptahydrate, and 8-12 mL / L trace element solution. The trace element solution comprises 8-12 g / L ferric citrate (III), 1-3 g / L zinc sulfate heptahydrate, 0.5-1.5 g / L copper sulfate pentahydrate, 0.1-0.5 g / L manganese sulfate monohydrate, 0.1-0.3 g / L sodium tetraborate decahydrate, 0.05-0.2 g / L ammonium heptamolybdate, and 1-3 g / L calcium chloride.

[0032] Preferably, the fermentation medium comprises: 30.00 g / L carbon source, 5.00 g / L yeast extract, 0.50 g / L peptone, 13.50 g / L potassium dihydrogen phosphate, 4.00 g / L diammonium hydrogen phosphate, 1.70 g / L citric acid, 1.40 g / L magnesium sulfate heptahydrate, and 10 mL / L trace element solution. The trace element solution comprises 10.00 g / L ferric citrate (III), 2.25 g / L zinc sulfate heptahydrate, 1.00 g / L copper sulfate pentahydrate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium tetraborate decahydrate, 0.11 g / L ammonium heptamolybdate, and 2.00 g / L calcium chloride.

[0033] In one embodiment of the present invention, the fermentation culture temperature in step (2) is 20-30°C, preferably 25°C.

[0034] In one embodiment of the present invention, step (2) involves controlling the cell OD before fermentation production. 600 The preferred value is 15-25, with an OD value of [missing value]. 600 It is 25.

[0035] In one embodiment of the present invention, an inducer is added to the fermentation process in step (2), preferably IPTG.

[0036] In one embodiment of the present invention, the final concentration of the inducer is 0.05-0.4 mM, preferably 0.1 mM.

[0037] In one embodiment of the present invention, lactose is added to the inducer after a certain induction time.

[0038] In one embodiment of the present invention, the induction time is 2 to 4 hours, preferably 2 hours.

[0039] In one embodiment of the present invention, the lactose concentration is 5 to 7.5 g / L, preferably 5 g / L.

[0040] In one embodiment of the present invention, after the lactose is added, the fermentation culture is carried out for not less than 40 hours, preferably 72 hours.

[0041] In one embodiment of the present invention, in step (2), it is necessary to add feed culture medium and lactose during fermentation to maintain a carbon source concentration of not less than 5 g / L and a lactose concentration of not less than 5 g / L.

[0042] In one embodiment of the present invention, the supplemental culture medium comprises: 400-800 g / L carbon source, 15-30 g / L MgSO4·7H2O, 2-8 g / L yeast extract, and 1-5 g / L peptone.

[0043] Preferably, the fed culture medium consists of: 600 g / L carbon source, 22.02 g / L MgSO4·7H2O, 5.76 g / L yeast extract, and 2.88 g / L peptone.

[0044] In one embodiment of the present invention, the genetically engineered bacteria are cultured in LB medium for 8-12 hours at 30-40°C and 200-220 rpm to obtain a seed culture. The seed culture is then added at 5-10% to a fermentation medium containing a carbon source and cultured until the OD reaches its limit. 600 Add IPTG to the reaction system at a concentration of 0.05–0.4 mM, and incubate for 2–4 hours. Then add lactose to the reaction system at a concentration of 2.5–7.5 g / L, and continue induction for at least 72 hours.

[0045] Preferably, the genetically engineered bacteria are inoculated into LB medium and cultured overnight at 37°C for 12 hours to prepare a fermentation seed culture. Then, the seed culture is inoculated at a rate of 5% into a fermentation medium containing glycerol as a carbon source. When the OD... 600 Once the concentration reaches 2, add IPTG to a final concentration of 0.1 mM as an inducer and continue culturing at 25°C for 2 h; then add lactose to a final concentration of 5.00 g / L as a substrate and continue fermentation at 25°C for 72 h.

[0046] In one embodiment of the present invention, the genetically engineered bacteria are cultured at 30-40°C and 200-220 rpm to obtain a seed culture. The seed culture is then added to a 3L fermentation medium at a concentration of 5-10% and cultured until the OD reaches the specified level. 600Add IPTG to a concentration of 15–25 mM, bringing the final IPTG concentration to 0.05–0.4 mM. After culturing for 2–4 hours, add lactose to a concentration of 5–7.5 g / L in the reaction system. The induction culture time should be no less than 40 hours.

[0047] Preferably, the genetically engineered bacteria are cultured at 37°C and 200 rpm for 12 hours to obtain a seed culture. The seed culture is then added at 10% to a 3L fermentation medium tank and cultured until the OD reaches the specified level. 600 Add IPTG to a concentration of 0.1 mM, and incubate for 2 hours. Then add lactose to a final concentration of 5 g / L. The induction culture time should not be less than 40 hours.

[0048] In one embodiment of the present invention, the carbon source includes glycerol or glucose.

[0049] The present invention also provides the application of the genetically engineered bacteria in the fermentation production of lactyl-N-neotetrasaccharide.

[0050] In one embodiment of the present invention, the application includes the food, chemical, and pharmaceutical fields.

[0051] The beneficial effects of this invention are:

[0052] (1) This invention weakens the extracellular transport pathway of lactyl-N-trisaccharide II, an intermediate in the synthesis of lactyl-N-neotetrasaccharide, by blocking the competitive pathway of lactose, uridine-5′-bisphosphate-galactose (UDP-Gal), and uridine-5′-bisphosphate-N-acetyl-glucosamine (UDP-GlcNAc). The synthesis pathway of lactyl-N-neotetrasaccharide is divided into a lactyl-N-trisaccharide II synthesis module, a lactyl-N-neotetrasaccharide synthesis module, and a co-supply module by using a modular engineering strategy. The expression level of each module is optimized by changing the plasmid copy number. The optimal combination is determined to be: pCDF-lgtA-glmU-S*-glmM, pRSF-lgtB-pgm-galE-galU, pET-lacY-prs. The yield of lactyl-N-neotetrasaccharide reaches 5.96 g / L, and the residual amount of lactyl-N-trisaccharide II is 1.36 g / L, which is 29% lower than the highest residual amount group.

[0053] (2) Further, by designing different ribosome binding sites (RBS), the expression level of IgTB was fine-tuned, and the pathway flux was precisely controlled, achieving a balance in metabolic pathway flux. This resulted in increased lactyl-N-neotetrasaccharide while reducing the residual lactyl-N-trisaccharide. When IgTB expression was regulated by the RBS with the sequence TCATTAAGTAAGTAAAGGAGGAGGACA, the yield of lactyl-N-neotetrasaccharide was 6.70 g / L, an increase of 12.42%, while the residual amount of lactyl-N-trisaccharide was 0.80 g / L, a decrease of 41.18%.

[0054] (3) In the shake-flask experiment, the yield of lactyl-N-neotetrasaccharide reached 6.70 g / L, and the residue of lactyl-N-trisaccharide II was 0.80 g / L. In the 3L bioreactor, the yield of lactyl-N-neotetrasaccharide reached 19.40 g / L, and the residue of lactyl-N-trisaccharide was 1.79 g / L, showing excellent prospects for industrial application. Attached Figure Description

[0055] Figure 1 This is a metabolic pathway for the synthesis of lactyl-N-neotetrasaccharides.

[0056] Figure 2 The graph shows the yield of lactyl-N-neotetrasaccharide under different module combinations, where AUSM: lactyl-N-trisaccharide II synthesis module; BMEU: lactyl-N-neotetrasaccharide synthesis module; YS: coordinated supply module; H: high copy plasmid; M: medium copy plasmid; L: low copy plasmid.

[0057] Figure 3 The graph shows the yield of lactyl-N-neotetrasaccharide lgtB under different intensities of RBS regulation.

[0058] Figure 4 The figure shows the fermentation yield of lactyl-N-neotetrasaccharide in a 3L bioreactor. Detailed Implementation

[0059] Culture medium formulation:

[0060] LB medium: 5.00 g / L yeast extract, 10.00 g / L peptone and 10.00 g / L sodium chloride.

[0061] LB solid medium: 5.00 g / L yeast extract, 10.00 g / L peptone, 10.00 g / L sodium chloride, and 20 g / L agar powder.

[0062] Fermentation medium: 30.00 g / L glycerol, 5.00 g / L yeast extract, 0.50 g / L peptone, 13.50 g / L potassium dihydrogen phosphate, 4.00 g / L diammonium hydrogen phosphate, 1.70 g / L citric acid, 1.40 g / L magnesium sulfate heptahydrate, and 10 mL / L trace element solution. The trace element solution included 10.00 g / L ferric citrate (III), 2.25 g / L zinc sulfate heptahydrate, 1.00 g / L copper sulfate pentahydrate, 0.35 g / L manganese sulfate monohydrate, 0.23 g / L sodium tetraborate decahydrate, 0.11 g / L ammonium heptamolybdate, and 2.00 g / L calcium chloride.

[0063] Feeding medium: 600 g / L glycerol, 22.02 g / L MgSO4·7H2O, 5.76 g / L yeast extract, 2.88 g / L peptone.

[0064] The fermentation broth treatment method and detection conditions for lactyl-N-neotetrasaccharide described in this embodiment of the invention are as follows: The sample preparation and analysis methods are as follows: The fermentation broth sample was boiled at 100℃ for 15 minutes, and then centrifuged at 12000 rpm for 15 minutes using a high-speed centrifuge. The supernatant after centrifugation was filtered through a 0.22 μm filter membrane as the sample to be tested. High-performance liquid chromatography (HPLC) was used to detect lactyl-N-neotetrasaccharide: differential refractive index detector; Aminex HPX-87H column (300 × 7.8 mm), column temperature 50℃; mobile phase 5 mM H2SO4 aqueous solution, flow rate 0.5 mL / min; injection volume 10 μL.

[0065] Example 1: Construction of gene knockout chassis cells

[0066] 1. Construction of knockout plasmids (using lacZ knockout as an example)

[0067] N20 replacement

[0068] The predicted N20 sequence was selected from the lacZ gene using sgRNAcas9 software. Primers were designed, and the N20 sequence on the template was replaced by PCR using the original pTargetF as a template. The PCR product was transformed into E. coli JM109, and the plasmid was extracted and sequenced for verification. Successfully verified pTarget-lacZ was stored at -20℃ for later use.

[0069] Preparation of lacZ homologous arms

[0070] Using the genome of the strain to be knocked out as a template, the upstream and downstream homologous arms required for knocking out lacZ were amplified using lacZ-up-F / R and lacZ-down-F / R primer pairs, respectively. The two DNA fragments were then purified and recovered. Furthermore, the two fragments of the upstream and downstream homologous arms of lacZ were fused into a single fragment using overlap PCR with the lacZ-up-F / lacZ-down-N-R primer pairs. The DNA fragment was then purified and recovered.

[0071] The lacZ homologous arm was integrated into pTarget-lacZ to construct the complete knockout plasmid pTarget-ΔlacZ.

[0072] Using a seamless cloning kit (Nanjing Novizan Biotechnology Co., Ltd.), the homologous arm of lacZ was ligated to the EcoRI and HiNdIII restriction sites of the vector pTarget-lacZ. The ligation product was then transformed into E. coli JM109, and the plasmid was extracted and sent for sequencing verification. Successfully verified pTarget-ΔlacZ was stored at -20℃ for later use.

[0073] The methods for knocking out plasmids for other genes lacA, nagB, wecB, nagB, ugd, gcd, and setA are the same as above (the primers involved in constructing the knockout plasmids are shown in Table 1).

[0074] Table 1 Primer sequences for gene knockout

[0075]

[0076]

[0077]

[0078]

[0079] 2. Knockout of Escherichia coli BL21(DE3) genome (using lacZ knockout as an example)

[0080] Transform the pcas9 plasmid into the host bacterium BL21(DE3).

[0081] Transform the pcas9 plasmid into BL21(DE3), incubate at 30 degrees Celsius for 16-24 hours, pick single clones, and shake in vials.

[0082] Prepare competent cells containing the pcas9 plasmid and knock out the lacZ gene.

[0083] (1) Pick cells from a culture tube or strewn plate (containing the Cas9 plasmid) stored at -80℃ and transfer them to 10 mL of LB medium (containing kanamycin). Incubate at 30℃ and 200 rpm for approximately 12-16 hours. Transfer to sterile LB medium (containing kanamycin) at an inoculum size of 1%. When cells grow to OD... 600 When the OD value was 0.1, arabinose was added to a final concentration of 10 mmol / L to induce λ-Red-mediated homologous recombination. 600 When the bacterial cell concentration reaches 0.4-0.6, collect the bacterial cells to prepare competent cells.

[0084] (2) The pTarget-ΔlacZ knockout plasmid was added to approximately 100 μL of competent cells containing the pCas9 plasmid and electroporated (1 / 2 mm cuvette, 2.5 kV). Immediately after electroporation, 1 mL of pre-cooled LB liquid medium was added to suspend the cells, and the cells were incubated at 30°C for 1-2 h. The cells were then plated onto LB agar medium containing kanamycin and spectinomycin and cultured overnight at 30°C. The lacZ knockout effect was verified by PCR.

[0085] Elimination of pTarget-ΔlacZ

[0086] Positive clones containing pCas9 and pTarget-ΔlacZ were identified and inoculated into LB medium containing kanamycin and IPTG (0.5 mmol / L) and cultured for 8-16 h to remove pTarget-ΔlacZ, thus obtaining the gene knockout strain BL21(DE3)ΔlacZ.

[0087] 3. Knockout of lacA, nagB, wecB, ugd, gcd, and setA genes.

[0088] Other genes lacA, nagB, wecB, ugd, gcd, and setA were knocked out using the same method as steps 1-2 above, ultimately yielding the gene knockout strain BL21(DE3)ΔlacZΔlacAΔnagBΔwecBΔugdΔgcdΔsetA.

[0089] Example 2: Construction and screening of engineered host bacteria for high-efficiency production of lactyl-N-neotetrasaccharides

[0090] 1. Plasmid construction

[0091] The glmU and glmS genes are located adjacent to each other on the genome, so they are abbreviated as glmU-S (i.e., glmU and glmS genes) below. The construction steps of the overexpression plasmid pRSF-lgtA-glmU-S*-glmM (S* represents the mutant of glmS*) are as follows, and the primer sequences involved are shown in Table 2.

[0092] (1) Using the lgtA gene sequence (nucleotide sequence as shown in SEQ ID NO.1) as a template and pRSF-lgtA-F / R as primers, the lgtA gene fragment was amplified by PCR and the DNA fragment was recovered by gel.

[0093] (2) Using pRSFDuet-1 vector as template and pRSF-F / R as primer, pRSFDuet-1 linearized DNA fragments were amplified by PCR and the DNA fragments were recovered by gel.

[0094] (3) The lgtA fragment and the pRSFDuet-1 linearized DNA fragment were recombined and ligated using a seamless cloning kit (Nanjing Novizan Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli JM109, and the plasmid was extracted and sent for sequencing for verification. The pRSF-lgtA was successfully obtained.

[0095] (4) Using the genome of Escherichia coli K-12 as a template, and pRSF-glmU-SF / R and pRSF-glmM-SF / R as primers, the glmU-S and glmM gene fragments were amplified by PCR, and the DNA fragments were recovered by gel. Furthermore, the DNA fragments of glmU-S and glmM were fused into one fragment by overlapping PCR using the pRSF-glmU-SF / pRSF-glmM-R primer pair, and the DNA fragment was purified and recovered.

[0096] (5) Using pRSF-lgtA vector as a template and pRSF-lgtA-F / R as primers, pRSF-lgtA linearized DNA fragments were amplified by PCR and the DNA fragments were recovered by gel.

[0097] (6) The fusion fragments of glmU-S and glmM and the linearized DNA fragment of pRSF-lgtA were recombined and ligated using a seamless cloning kit (Nanjing Novizan Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli JM109, and the plasmid was extracted and sent for sequencing for verification. The successful verification yielded pRSF-lgtA-glmU-S-glmM.

[0098] (7) Using pRSF-lgtA-glmU-S-glmM as a template, glmS(E14K,S449P)-F / R was added to the reaction system for PCR amplification. After amplification, 7.5 μL of the amplification product was taken, and 1.5 μL of Lpn I rapid digestion enzyme and 1 μL of rapid digestion enzyme buffer were added and mixed. The mixture was then treated in a 37℃ water bath for 2 h to digest the template in the system. The digested PCR product was then transferred into E. coli JM109, and the plasmid was extracted and sent for sequencing verification. The successful verification yielded pRSF-lgtA-glmU-S(E14K,S449P)-glmM. Using pRSF-lgtA-glmU-S(E14K,S449P)-glmM as a template, glmS*-F / R was added to the reaction system for PCR amplification. After amplification, 7.5 μL of the amplification product was taken, and 1.5 μL of Lpn I rapid digestion enzyme and 1 μL of rapid digestion enzyme buffer were added and mixed. The mixture was then treated in a 37℃ water bath for 2 h to digest the template in the system. The digested PCR product was then transferred into E. coli JM109, and the plasmid was extracted and sent for sequencing verification. The successful verification yielded pRSF-lgtA-glmU-S(E14K,S449P)-glmM. Mix 1 μL of rapid digestion enzyme and 1 μL of rapid digestion enzyme buffer, and incubate at 37°C for 2 hours to digest the template in the digestion system. Then, transfer the digested PCR product into E. coli JM109, extract the plasmid and send it for sequencing verification. After successful verification, the final plasmid pRSF-lgtA-glmU-S*-glmM was obtained.

[0099] The construction methods for pCDF-lgtA-glmU-S*-glmM and pET-lgtA-glmU-S*-glmM are the same as above.

[0100] The methods for obtaining lgtB, pgm, galE, and galU gene fragments and constructing plasmids pCDF-lgtB-pgm-galE-galU, pET-lgtB-pgm-galE-galU, and pRSF-lgtB-pgm-galE-galU are the same as above.

[0101] The methods for obtaining lacY and prs gene fragments and constructing plasmids pCDF-lacY-prs, pET-lacY-prs, and pRSF-lacY-prs are the same as above.

[0102] Table 2 Primers for overexpression plasmid construction

[0103]

[0104]

[0105]

[0106] 2. Construction of engineered host bacteria for efficient production of lactyl-N-neotetrasaccharides and optimization screening based on modular combinations of different plasmid copy numbers

[0107] The nine overexpression plasmids constructed in step 1 were combined to obtain six combinations: ① pRSF-lgtA-glmU-S*-glmM, pET-lgtB-pgm-galE-galU, pCDF-lacY-prs; ② pRSF-lgtA-glmU-S*-glmM, pCDF-lgtB-pgm-galE-galU, pET-lacY-prs; ③ pET-lgtA-glmU-S*-glmM, pRSF-lgtB-pgm-galE-gal U, pCDF-lacY-prs; ④pET-lgtA-glmU-S*-glmM, pCDF-lgtB-pgm-galE-galU, pRSF-lacY-prs; ⑤pCDF-lgtA-glmU-S*-glm M, pET-lgtB-pgm-galE-galU, pRSF-lacY-prs; ⑥pCDF-lgtA-glmU-S*-glmM, pRSF-lgtB-pgm-galE-galU, pET-lacY-prs. These six combinations were electroporated into the knockout strain BL21(DE3)ΔlacZΔlacAΔnagBΔwecBΔugdΔgcdΔsetA from Example 1, resulting in six different engineered bacteria, designated as B1, B2, B3, B4, B5, and B6 (see Table 4). The yields of lactoyl-N-neotetrasaccharide and the residual amounts of lactoyl-N-trisaccharide II in these six engineered bacteria were 3.15 g / L and 0.42 g / L; 2 g / L and 0.1 g / L; 4.48 g / L and 0.31 g / L; 4.49 g / L and 0.37 g / L; and 4.88 g / L and 1.91 g / L, respectively.

[0108] 5.96 g / L, 1.36 g / L. Among them, the engineered strain B6 containing plasmids pCDF-lgtA-glmU-S*-glmM, pRSF-lgtB-pgm-galE-galU, pET-lacY-prs obtained the highest lactyl-N-neotetrasaccharide yield of 5.96 g / L, and the residual amount of lactyl-N-trisaccharide II was 1.36 g / L.

[0109] Example 3: Replacing the ribosome binding site of lgtB on the pRSF-lgtB-pgm-galE-galU plasmid

[0110] Using the constructed plasmid pRSF-lgtB-pgm-galE-galU as a template, primers RBS1-lgtB-F / R, RBS2-lgtB-F / R, and RBS3-lgtB-F / R (see Table 2) were used to replace the original lgtB RBS sequence to obtain the corresponding plasmids pRSF-(RBS1)lgtB-pgm-galE-galU, pRSF-(RBS2)lgtB-pgm-galE-galU, and pRSF-(RBS3)lgtB-pgm-galE-galU.

[0111] Table 3 RBS sequences

[0112]

[0113] RBS1, RBS2, and RBS3 were selected as ribosome binding site sequences for low, medium-high, and high expression intensities, respectively, to fine-tune IgTB. Three strains under different RBS control were obtained: B7-B9 (details of the strains are shown in Table 4). The yields of lactyl-N-neotetrasaccharide and lactyl-N-trisaccharide II were 3.41 g / L and 1.04 g / L; 6.70 g / L and 0.80 g / L; and 3.30 g / L and 0 g / L, respectively. The results indicate that appropriately increasing the expression level of IgTB increases the driving force for the conversion of lactyl-N-trisaccharide II to lactyl-N-neotetrasaccharide, thereby improving the synthesis of lactyl-N-neotetrasaccharide. When the expression level of IgTB is very high, it may disrupt the balance of the lactyl-N-neotetrasaccharide synthesis pathway, leading to improper resource allocation and thus affecting the synthesis of lactyl-N-neotetrasaccharide. High-intensity RBS2 regulation of lgtB resulted in the highest accumulation of lactyl-N-neotetrasaccharide and a reduced residual lactyl-N-trisaccharide II. Specifically, *E. coli* containing the overexpression plasmid pCDF-lgtA-glmU-S*-glmM,prsF-(RBS2)lgtB-pgm-galE-galU,pET-lacY-prs exhibited the highest lactyl-N-neotetrasaccharide production, reaching 6.70 g / L, while the residual lactyl-N-trisaccharide II was 0.80 g / L.

[0114] Example 4: Fermentation of lactyl-N-neotetrasaccharide by a high-efficiency production strain in a 3L bioreactor

[0115] The scale-up production of lactyl-N-neotetrasaccharide was carried out in a 3L bioreactor (Applikon). The seed culture of genetically engineered strain B8 was inoculated at a rate of 10% into a 1L working volume of fermentation medium. The bioreactor parameters were set as follows: culture temperature 37°C, dissolved oxygen maintained at 30%, and pH set to 6.8. When OD... 600When the temperature reached 25°C, the culture temperature was set to 25°C, and IPTG was added to a final concentration of 0.1 mM. After 2 hours of induction, 5.00 g / L lactose was added. The pH was adjusted with 50% ammonia to maintain the pH of the culture medium at 6.8. A fed culture medium and 200 g / L lactose solution were added to a 3 L bioreactor to maintain a lactose concentration of 5.00 g / L and a glycerol concentration of 5-10 g / L. After 41.5 hours of fermentation, the lactyl-N-neotetrasaccharide yield reached its maximum of 19.40 g / L, with a productivity of 0.47 g / L / h and an OD... 600 Reaching a maximum value of 111, lactoyl-N-trisaccharide II residue was only 1.79 g / L ( Figure 4 ).

[0116] Table 4. Detailed information on each genetically engineered strain.

[0117]

[0118]

[0119] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A genetically engineered bacterial strain capable of synthesizing lactosyl-N-neotetraose, characterized in that, The genetically engineered strain used *Escherichia coli* BL21(DE3) as the chassis strain, with the genes involved in the lactyl-N-neotetrasaccharide synthesis precursor competition knocked out. Genes from module a) were expressed using a low-copy plasmid; genes from module b) were expressed using a high-copy plasmid; and genes from module c) were expressed using a medium-copy plasmid. a) an upstream lacto-N-triose II synthesis module: β - a 1,3-acetylglucosamine transferase gene lgtA - a phosphoglucosamine mutase gene glmM - a fused N-acetylglucosamine-1 -phosphate uridyltransferase / glucosamine-1 - phosphate acetyltransferase gene glmU - a L-glutamine-D-fructose-6-phosphate aminotransferase gene glmS ; b) a downstream lactyl-N-neotetraose synthesis module: β - a 1,4-galactosyltransferase gene lgtB - a phosphoglucomutase gene pgm - a UTP-glucose-1 -phosphate uridyltransferase gene galU - a UDP-glucose 4-epimerase gene galE gene; c) Coordination supply module: Ribophosphobisphosphate kinase gene prs Lactose permease gene lacY Gene; The pathway genes competing for the lactyl-N-neotetrasaccharide synthesis precursor include β -Galactosidase gene lacZ galactoside O - Acetyltransferase gene lacA The gene for glucosamine-6-phosphate deaminase nagB UDP-N-acetylglucosamine 2-iminase gene wecB UDP-glucose 6-dehydrogenase gene ugd Quinone protein glucose dehydrogenase gene gcd and glycoprotein export genes setA ; The high-copy plasmid is pRSFDuet-1; the medium-copy plasmid is pETDuet-1; the low-copy plasmid is pCDFDuet-1; the RBS with the sequence AATAGGAGA is used as the starting RBS, and the RBS with a relative strength of 1.4-1.5 to the starting RBS is used in module b). lgtB Gene expression.

2. A method for producing lactyl-N-neotetrasaccharide by fermentation culture using the genetically engineered strain of claim 1, characterized in that, The method includes the following steps: (1) The strain described in claim 1 is inoculated into a culture medium and cultured to obtain a bacterial solution; (2) Transfer the bacterial culture from step (1) to the fermentation medium to ferment and produce lactyl-N-neotetrasaccharide.

3. The method according to claim 2, characterized in that, The carbon source for the fermentation medium includes glycerol or glucose.

4. The method according to claim 2, characterized in that, An inducer was also added during the fermentation process; the inducer included IPTG.

5. The application of the genetically engineered strain of claim 1 in the fermentation production of lactyl-N-neotetrasaccharide.

Images