A QTL qCTES12 for cold tolerance in the early seedling stage of rice DWR Molecular markers and applications of candidate gene LOC_Os12g18729
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-11
- Publication Date
- 2026-08-11
AI Technical Summary
[0024]1、本发明获得的水稻早苗期耐冷基因在不同的遗传世代能够稳定表达,可靠性强。
Smart Images

Figure CN117344050B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, and in particular to a QTLqCTES12 method for promoting cold tolerance in the early seedling stage of rice. DWR Molecular markers and applications of candidate gene LOC_Os12g18729. Background Technology
[0002] Asian cultivated rice (Oryza sativa L.) is a staple food crop for about half the world's population, and its yield impacts global food security. Originating in tropical and subtropical regions, Asian cultivated rice is a warm-climate crop, with an optimal growth temperature of 25-35℃, and is sensitive to low-temperature stress. Low temperatures severely affect the geographical distribution, growth and development, yield, and quality of rice, as well as the sowing season. Furthermore, the northern limit of rice cultivation has shifted by 39.15m and 24.93km to higher altitudes and latitudes, respectively, leading to a gradual increase in the likelihood of low-temperature damage. Indica and japonica rice will experience low-temperature damage below 18℃ and 15℃, respectively. Low-temperature damage can occur at any growth stage of rice, ultimately leading to a decline in yield and quality, with the seedling stage being one of the most sensitive. When the ambient temperature is below 15℃, the physiological metabolism of rice seedlings is affected. Especially in the double-cropping rice areas of the middle and lower reaches of the Yangtze River, "late spring frosts" and low temperatures in the soil and water caused stunted growth, seedling rot, and seedling death. Due to rising labor costs, direct-seeded rice in southern rice-growing areas is highly favored by rice farmers and its popularity has grown rapidly. However, late spring frosts cause seed rot, bud rot, and seedling death in direct-seeded early rice, leading to uneven emergence, low seedling survival rate, delayed development, and weed infestation (Liu et al., 2018), seriously affecting the safe production of direct-seeded early rice. Therefore, improving the cold tolerance of rice seedlings is of great theoretical and practical significance for reducing cold damage losses during the seedling stage, promoting the transformation of early rice from transplanting to direct seeding (saving costs and reducing white pollution), and achieving green, low-carbon, high-quality, and high-efficiency rice production.
[0003] Cold tolerance in rice is a quantitative trait controlled by multiple genes. Traditional breeding methods based on phenotypic identification cannot clearly define the genetic structure of cold tolerance, making accurate selection difficult, and resulting in low selection efficiency and slow progress. QTL (Quantitative Traits Loci) analysis can effectively elucidate quantitative traits and promote efficient breeding of cold tolerance in rice. More than 270 cold tolerance QTLs have been reported (Li JH, Zhang ZY, Chong K, et al. Chilling tolerance in rice: Past and present. J Plant Physiol, 2022, 268:153576 https: / / doi.org / 10.1016 / j.jplph.2021.153576; Lv Y, Hussain M Az, Luo D, et al. Current understanding of genetic and molecular basis of cold tolerance in rice Mol Breeding, 2019, 39:159, https: / / doi.org / 10.1007 / s11032-019-1073-5), of which 10 seedling cold-resistant QTLs / genes (bZIP73, COG1, COG2, COLD1, COLD11, HAN1, OsLTPL159, OsWRKY115, qPSR10 and qCTS-9) were cloned (Feng JL, Li ZT, Luo W, et al. COG2 negatively regulates chilling tolerance through cell wall components altered in rice. Theor Appl Genet, 2023, 136:1–11; Natural variation of codon repeats in COLD11 endows rice with chillingresilience. Sci Adv, 2023, 9(1):eabq5506; Liu HL, Yang LM, Xu SB, et al. al.OsWRKY115on qCT7 links to cold tolerance in rice.TheorAppl Genet,2022,135:2353–2367;Mao DH,XinYY,TanY J,et al.Natural variation in the HAN1 gene confers cold tolerance in rice and allows adaptation to a temperate climate. (ProcNatlAcad Sci, 2019, 116:3494-3501; Zhao J, Wang SS, Qin JJ, et al. The lipid transfer protein OsLTPL159 is involved in cold tolerance at the early seeding stage in rice. Plant Biotechnol J, 2020, 18:756–769). This lays the foundation for molecular breeding of cold-tolerant rice. Therefore, using cold-tolerant genes and their closely linked molecular markers to conduct marker-assisted selection breeding allows for precise and stable selection in early generations and early growth stages, thereby accelerating the breeding process and improving breeding efficiency. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides a QTL qCTES12 for cold tolerance in the early seedling stage of rice. DWR Molecular markers and applications of candidate gene LOC_Os12g18729 can be used for the identification and molecular breeding of cold-resistant varieties of rice in the early seedling stage.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] This invention provides a QTL qCTES12 for cold tolerance in the early seedling stage of rice. DWR The gene is located on rice chromosome 12 within the interval RM5939-RM27947, with an interval size of 195kb and a physical distance of 10,066,394 to 10,266,442bp. Its candidate gene, Loc_Os12g18729, was identified.
[0007] Preferred,
[0008] 1) The nucleotide sequence of the upstream primer in the primer pair CTES12 is the nucleotide sequence shown in SEQ ID NO.1 in the sequence listing, and the nucleotide sequence of the downstream primer in the primer pair CTES12 is the nucleotide sequence shown in SEQ ID NO.2 in the sequence listing;
[0009] 2) A nucleotide sequence that can hybridize with the DNA sequence defined by SEQ ID NO.1 or SEQ ID NO.2 in the sequence listing under highly stringent conditions;
[0010] 3) It has more than 90% homology with the DNA sequence defined in 1) or 2) and can amplify the sequence of cold resistance-related genes in early rice seedling stage;
[0011] CTES12-F: 5'-TTCCTTGCTTGAACTCGAGC-3'(SEQ ID NO.1)
[0012] CTES12-R: 5'-CATCTGTGTTGCTCATGAGG-3' (SEQ ID NO. 2).
[0013] This invention also provides the QTL qCTES12 for cold resistance in the early seedling stage of rice as described in the above technical solution. DWR Application of genes in the identification or breeding of cold-resistant rice varieties in the early seedling stage.
[0014] This invention also provides a method for identifying cold-resistant rice varieties in the early seedling stage, comprising the following steps:
[0015] 1) Extract genomic DNA from the rice samples to be tested;
[0016] 2) Using the genomic DNA obtained in step 1) as a template, CTES12 is amplified by PCR using the primers described in the above technical solution to obtain the amplification product;
[0017] 3) Perform agarose gel electrophoresis on the amplification product obtained in step 2). When a band of 230 bp is obtained, the rice to be tested is a cold-resistant rice variety in the early seedling stage.
[0018] Preferably, the PCR amplification system in step 2) is as follows: 5.0 μL of 2×Tolo FastTaqPremix, 1 μL each of the upstream and downstream primers in the above technical solution at 10 pmol / μL, 1 μL of rice genomic DNA at 300-500 ng / μL, and sterilized ultrapure water to 10 μL.
[0019] Preferably, the PCR amplification program in step 2) is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 45 s, for 35 cycles; final extension at 72℃ for 10 min; and storage of the amplification product at 4℃.
[0020] The present invention also provides a kit for identifying cold-resistant rice varieties in the early seedling stage, comprising the primer pair CTES12 described in the above technical solution.
[0021] This invention utilizes Xieqingzao B / Dongxiang wild rice BC1F 10Backcross recombinant inbred lines (BILs) L5339 were backcrossed three times and self-crossed once with the recurrent parent Xieqingzao B to develop Xieqingzao B / Dongxiang wild rice BC5F2 generation BILs. A high-density genetic map containing 2059 recombinant Bin markers was constructed using high-throughput resequencing. 120 accessions of Xieqingzao B / Dongxiang wild rice BC5F2 BILs were treated at the one-leaf-one-heart stage with 5℃ 10h night / 8℃ 14h day for 5 days. After 7 days of recovery, seedling survival rate was calculated. The results showed that the survival rate of BILs ranged from 0% to 100%, with a mean of 33.7%. Using the Inclusive Composite Interval Mapping (ICIM) method in QTLIciMapping V4.2 software, the novel major-effect QTL qCTES12 controlling early seedling cold tolerance in rice was detected in the interval 12_8617129-12_11651936 on chromosome 12. DWR ( Figure 1 The QTL has a LOD value of 5.34 and a phenotypic contribution rate of 19.38%. Its enhancing allele originates from wild rice in Dongxiang and is different from the 10 previously cloned seedling-stage cold-resistant genes, providing a new source of cold-resistant genes for breeding and improving cold-resistant cultivated rice. Further research will utilize the target QTL qCTES12... DWR Four BC5F3 fine mapping populations were developed, and the cold-tolerant introgression line 19H19 was screened by combining cold-tolerant phenotype and genotype. Subsequently, using the residual heterozygous lines (RHL) method, the qCTES12 line was selected from the RHL-F2 secondary mapping population developed from 19H19. DWR The range has been narrowed down to RM5939-RM27927, with a physical location of 10,066,394~10,266,442bp, approximately within 195kb. Figure 2 ).
[0022] Further cold tolerance assessments were conducted on the BC5F2 population constructed by backcrossing 19H19 with Xieqingzao B and its parents, based on BSA-seq ( Figure 3 ) and transcriptome analysis, qCTES12 DWR Seventy-six candidate genes related to cold tolerance in early seedling stage were identified, among which 26 genes had frameshift or nonsynonymous mutations in their coding regions. Transcriptome analysis revealed that four genes showed differential expression under cold stress. Sequencing analysis of these four genes showed that the third coding region of the Loc_Os12g18729 gene of Xieqingzao B had a deletion of 42 bases compared to 19H19. Figure 4Furthermore, the cold-sensitive strains also lacked 42 base pairs compared to the cold-resistant strains, and a corresponding molecular marker, CTES12, was developed. The practical and economical PCR-based molecular marker CTES12 of this invention can be used for the identification and molecular breeding of cold-resistant rice varieties in the early seedling stage.
[0023] Compared with the prior art, the present invention has the following advantages and effects:
[0024] 1. The cold-resistant gene for early seedling stage of rice obtained by this invention can be stably expressed in different genetic generations, and has high reliability.
[0025] 2. By screening molecular markers that are closely linked to early seedling cold-resistant genes, rice materials or varieties with strong early seedling cold resistance can be identified and obtained.
[0026] 3. The molecular markers of the present invention can be used for the identification and selection of rice seedling genotypes, to obtain individuals carrying superior natural allelic variations of early seedling cold-resistant genes, which can overcome the disadvantages of conventional breeding methods such as long time cycle, difficulty in phenotypic identification and poor reproducibility, and cultivate new rice varieties with strong cold resistance.
[0027] This invention uses 120 BC5F2 segregating populations developed from backcross recombinant self-pollinated single plants (19H19) of Xieqingzao B / Dongxiang wild rice BC4F2 as the research population, and constructs a high-density genetic map containing 2059 recombinant Bin markers. BILs were treated with 5℃ 10h night / 8℃ 14h day for 5 days at the 1-leaf-1-heart stage, and seedling survival rate was counted 7 days after recovery. The results showed that the survival rate of BILs ranged from 0-100%, with a mean of 33.7%. The ICIM method using QTLIciMappingV4.2 software detected a new major-effect QTLqCTES12 controlling early seedling cold tolerance in rice, located in the region 12_8617129-12_11651936 on chromosome 12. DWR ( Figure 1 The QTL has a LOD value of 5.34 and a phenotypic contribution rate of 19.38%, and its enhancing allele is derived from wild rice from Dongxiang.
[0028] The study investigated and decomposed the stable expression of the early seedling cold-resistant gene locus qCTES12. DWRAnd its closely linked molecular markers. After four sets of BC5F3 generation near-isogenic lines reached the one-leaf-one-heart stage, they were treated with 5℃ 10h night / 8℃ 14h day for 5 days. After 7 days of recovery, seedling survival rate was calculated. One-way ANOVA was used to detect phenotypic variation between two homozygous genotypes within the same near-isogenic line. If there were significant differences in phenotype between different genotypes (P<0.05), their additive effects and phenotypic contribution rates were estimated, and QTL effect decomposition was performed. This analysis was performed using the general linear model (Proc GLM) of SAS software (SAS Institute Inc., 1999), ultimately narrowing the target QTL interval to RM5939-RM27947, with a physical location of 10,066,394–10,266,442 bp, a physical interval of approximately 195 kb (see [link to analysis]). Figure 2 ).
[0029] Simultaneously, BC5F2 populations were developed by backcrossing 19H19 with Xieqing Early B. During the early seedling stage (1 leaf, 1 heart stage), the population was treated with 8℃ for 14 hours daytime and 5℃ for 10 hours nighttime for 4 days. After 7 days of recovery, 30 lines with survival rates greater than 80% and 30 lines with survival rates less than 20% were selected to construct cold-tolerant and cold-intolerant mixed breeding pools. BSA-seq analysis was performed on the two extreme mixed breeding pools and both parents, yielding a total of 215,572 single nucleotide polymorphism (SNP) sites and 131,456 insertion or deletion (InDel) sites for subsequent gene mapping. At a 95% confidence level, SNP-index and InDel-index analyses showed that the 9Mb-13Mb window on chromosome 12 was greater than the threshold, which could be used as candidate intervals. Figure 3 Based on the annotation results of ANNOVAR, 76 candidate genes with promoter and coding region insertions or substitutions, as well as non-synonymous mutations, were selected.
[0030] Combined transcriptome sequencing and BSA sequencing analysis ( Figure 3 and Figure 4 Candidate genes related to cold tolerance in early seedling stage were identified within the target range.
[0031] Seventy-six candidate genes were identified in the candidate QTL region, of which 26 genes had frameshift or nonsynonymous mutations in their coding regions. Transcriptome analysis revealed that four genes showed differential expression under cold stress. Sequencing analysis of these four genes showed that the third coding region of the LOC_Os12g18729 gene in the cold-intolerant parent, Xieqingzao B, was missing 42 bases compared to the cold-tolerant parent, 19H19. Furthermore, the cold-intolerant strain also had a 42-base-sounding deletion compared to the cold-tolerant strain. Figure 4The sequencing primers for this study were: Forward (SEQ ID No. 3): 5'-CAACTTAGTTCAGATGCTG-3'; Reverse (SEQ ID No. 4): 5'-TCAAGAGATACAACACGCG-3'. Based on the sequence differences, the cold-resistant linked molecular marker CTES12 was developed, with the sequences: Forward (SEQ ID No. 1): 5'-TTCCTTGCTTGAACTCGAGC-3'; Reverse (SEQ ID No. 2): 5'-CATCTGTGTTGCTCATGAGG-3', providing a theoretical basis for marker-assisted selection breeding in rice.
[0032] Further WGCNA analysis of differentially expressed genes in the transcriptome revealed similar gene expression patterns across 18 modules. qCTES12... DWR The expression level of the candidate gene LOC_Os12g18729 (marked in red) was significantly downregulated in cold treatment 19H19, while the expression level in Xieqingzao B remained largely unchanged, indicating that it responds to cold stress in 19H19. Further GO enrichment showed that this gene module is associated with redox reactions, stress response, and protein repair, suggesting that the LOC_Os12g18729 gene may regulate rice cold tolerance mechanisms through co-expression with these functional genes. Figure 5 ).
[0033] Figure 5 Differential gene expression patterns in the transcriptomes of Xieqingzao B and 19H19 (the darker the color, the higher the expression level). Attached Figure Description
[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0035] Figure 1 For qCTES12 DWR Location on rice chromosomes;
[0036] Figure 2 QTL qCTES12 is a key ingredient for cold tolerance in the early seedling stage. DWR Decomposition of genetic effects verification;
[0037] Figure 3 Analysis of candidate genomic regions for cold tolerance in early rice seedlings;
[0038] Figure 4 Gene sequences of cold-tolerant and cold-intolerant strains LOC_Os12g18729 in Xieqingzao B, 19H19 and their BC5F2 populations;
[0039] Figure 5Differential gene expression patterns in the transcriptomes of Xieqingzao B and 19H19 (the darker the color, the higher the expression level);
[0040] Figure 6 qCTES12 DWR qRT-PCR and transcriptome analysis of candidate gene Loc_Os12g18729;
[0041] Figure 7 qCTES12 DWR Molecular marker assays using the candidate gene Loc_Os12g18729 were used to detect the genotypes of cold-tolerant and cold-intolerant BC5F2 lines. DWR, Xieqingzao B, 19H19, 3, 37, 42, 43, 71, 88, 91, and 102 were used to identify 11 rice materials, including the Dongxiang wild rice Anjiashan group 194 and the Xieqingzao B / Dongxiang wild rice BC5F2 backcross line, for cold tolerance assessment. Detailed Implementation
[0042] This invention provides a QTL qCTES12 for cold tolerance in the early seedling stage of rice. DWR The gene, located on rice chromosome 12 within the interval RM5939-RM27947, has a size of 195 kb and a physical distance of 10,066,394–10,266,442 bp. Its candidate gene, Loc_Os12g18729, has the nucleotide sequence shown in SEQ ID No. 5. In this invention, the major cold-resistant QTL qCTES12 for early seedling stage rice is described. DWR The upstream nucleotide sequence of the molecular marker for the candidate gene Loc_Os12g18729 is shown in SEQ ID No. 1, and the downstream nucleotide sequence of the molecular marker is shown in SEQ ID No. 2.
[0043] SEQ ID No. 5:
[0044] GCCACCACTGCTTTCCCTCCTCCTCATCCTCATCTTCATCTCTAGACCTCATCTTCTCCAGCCACCACCGCCTCCCTTCCCACCGGTGGTGGCAGCGGGAAGACAGCGGCTCGGTTGAGCCCGGCGGGGAGGGCACGATTTGGTATGGGAGGAGCAGCGGCGACTCCATCCGGCGGTGGATCCGCCGCCTCCTAGTCCCAGCTCTCTCTCCCCCGATCCTCCTCCTCCCCTTCCTCCACCGCCACCACCCACCCCTCTCCCTCTCTCAGATCTGGTGCGCGGGGAGCGGTGGAGGCTACGGCGGCGGCGGCGGCGAGATCGGTAGCAGTGATGGTGGAGAGGACGGATCCGATGGCGGTGGTTCTCGTCAACCAGTTCAAGGACGACGACAGCAGCGGC
[0045] TGCTGCAACGATGGATAGGCTCTGGGCGGCTCCTCCACTCTCCTCCCCTCT
[0046] CTCATATCCAGTGGCTCGGGGTGGTGGGGCGTGGCCGACGCATCCGGCGG
[0047] CGGAGCTCGGGTATCGATCCGGCATGTTTTTTTTTCTCCAAAATCAATTTTT
[0048] CTTGGTGGTCGGGAAACGGATTTTCAATTTTCTTTTTTTCGCTCGAATATCT
[0049] TTTTCGCTGGCGGTCAACGTAACTTAACCGCTTGTGAAAACAAGCTTTAAA
[0050] GTTTCGCTAGTGAAGATTGTTATTTTCACTTGCCATTTGTTTGCGGGCGGCT
[0051] GACAGTGCCACCAGCGAAAAACTCTTTTGCTAGTAGTGATTGCTAGATGGT
[0052] CAGCAGAGAACTTGTGGAGCATATGACTATCAACTAACAGTACACTTCAGC
[0053] AGAAAGAGGATGGTTCTAGCTCTCCGATGGTTTAATATTGAAACGTACAGC
[0054] CCACCCACCACCACCCCAGTCGTCCCCAGCTAAGCGCTCCCTTGCTTGCCT
[0055] CAGTAGACGAGCTGCCAACTAGTAGCACTCCAGCAAGCAGCGGGTCAGCG
[0056] GAGTCCGGAGGGCGCACGTGCGCCGCAGCGAGGTATCAGCATGGCCAGGC
[0057] GGCGGCTGGCTGGCCGGCCGGGTTCGGCAAGCGGCTAAGCAGGTAATTAA
[0058] GGGACTGCAGATACTGCTTGTGATCATCCCTTAAAATTTCGTCTTTCTTGTC
[0059] TTGGGCCAGGTTTAATTCCTAATTTTTTCTTCAAACTTTCAACTTTTCCATC
[0060] ACATCAAAACTTTTCTACACACACAAACTTTCAACTTAATTTTCCGTCACAT
[0061] CGTTCCAATTTCAATCAAACTTCTAATTTTAGCGTGAACTAAACACACCCTT
[0062] GGTTGTGACTCTGGGAGTCGATACATAGGCCTTAATGCTCGTAGTTTGTGG
[0063] ATTTTGGGGTTAAACTGGCGTGGAACTTTACTTGGATACCACCTGGGAGTT
[0064] GATGTGATTTTAGTGTTTAGTACAGTTTAGAGTTTATTACCTACCGGTTTCTT
[0065] GGTGCCTGGCGCACACTGAGCATGCAAATGCAGTGAGAGCCAGTATCATCT
[0066] AAGACGGCTGGACCTGAAATATTTTACCATGTATATATCAAACTCGACTTGA
[0067] TCAGGTGTTTAGCGGAGGAAGGATCGATGTCCGGCGCCGGACAGAGCCGT
[0068] GGTCATCGCCTTGGATTACACATTGATTCGGATTGGCCAGAGGTCTTGTTGA
[0069] TCAATGACTATGCGGTGTTCATGGGGTACCTGTCGATGGTTGTCACCGGGA
[0070] CGGGGTTCCTGGTGCTCACGTGGTCCACCGTCATCCTCCTCGGTGGATTCG
[0071] TCTCCATGCTATCCAACAAGGACTTCTGGAGTCTCACGGTGATCACGCTCG
[0072] TTCAAACAAGGTGAGCTATCTATAGCCATCTCCACCAGACTTATATTTATTTC
[0073] GCGTTCCCAACATTAACCAGTTCAGCCAAGCATTTGGAGTTTCGCATTGCT
[0074] AGCTAGCTACTAGTTTACTGTCAGATCTAGTGTTGCGAACCGAATATGCTGC
[0075] AAAACGTTGCAATTCCAGAGTGGCTTTATATACTACATTGATATGAAAATATTCAAGTCCCATATTTGCAAAATCAA.
[0076] This invention also provides the QTL qCTES12 for cold resistance in the early seedling stage of rice as described in the above technical solution. DWR Application of candidate gene Loc_Os12g18729 in the identification or breeding of cold-resistant rice varieties in the early seedling stage.
[0077] This invention provides a primer pair for amplifying the molecular marker described in the above-mentioned technical solution. The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID No. 2.
[0078] SEQ ID No.1: CTES12-F:5'-TTCCTTGCTTGAACTCGAGC-3';
[0079] SEQ ID No. 2: CTES12-R: 5'-CATCTGTGTTGCTCATGAGG-3'.
[0080] This invention provides a method for identifying cold-resistant rice varieties in the early seedling stage, comprising the following steps:
[0081] 1) Extract genomic DNA from the rice samples to be tested;
[0082] 2) Using the genomic DNA obtained in step 1) as a template, PCR amplification is performed using the primer pairs described in the above technical solution to obtain the amplification product;
[0083] 3) Perform agarose gel electrophoresis on the amplification product obtained in step 2). When a band of 230 bp is obtained, the rice to be tested is a cold-resistant rice variety in the early seedling stage.
[0084] This invention extracts genomic DNA from rice samples. The method for extracting genomic DNA from rice samples is not specifically limited and can be followed by those skilled in the art.
[0085] This invention uses the obtained genomic DNA as a template and performs PCR amplification using the primer pairs described in the above-mentioned technical solution to obtain the amplification product. In this invention, the preferred PCR amplification system is: 5.0 μL of 2×Tolo FastTaq Premix, 1 μL each of the upstream and downstream primers described in the above-mentioned technical solution (10 pmol / μL), 1 μL of rice genomic DNA (300–500 ng / μL), and sterilized ultrapure water to a final volume of 10 μL. In this invention, the preferred PCR amplification program is: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, repeated 35 times; final extension at 72℃ for 10 min; the amplification product is stored at 4℃.
[0086] In this invention, the amplified products are subjected to agarose gel electrophoresis. When a 230bp band is obtained, the rice being tested is a cold-resistant rice variety in the early seedling stage. In this invention, if the PCR product size is 230bp, the rice being tested is a rice variety with strong cold resistance in the early seedling stage; if the PCR product size is 188bp, the rice being tested is a rice variety with weak cold resistance. In this invention, the rice variety with strong cold resistance in the early seedling stage is one that, after being treated at 5℃ for 10 hours at night / 8℃ for 14 hours at day for 5 days at the 1-leaf-1-heart stage, has a seedling survival rate higher than 70% after 7 days of recovery. The rice variety with weak cold resistance is one that, after being treated at 5℃ for 10 hours at night / 8℃ for 14 hours at day for 5 days at the 1-leaf-1-heart stage, has a seedling survival rate lower than 15% after 7 days of recovery.
[0087] This invention also provides a kit for identifying early-stage cold-resistant rice varieties, comprising the primer pairs described in the above-mentioned technical solution. In this invention, the kit also includes conventional amplification reagents such as 2×Tolo FastTaq Premix.
[0088] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0089] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The cold resistance tests in the following examples were all performed in triplicate, and the results were averaged.
[0090] Example 1
[0091] Rice early seedling cold tolerance gene qCTES12 DWR Decomposition and Validation and Development of its Molecular Marker CTES12: I. Cold Tolerance QTLqCTES12 in Early Rice Seedling Stage DWR Verification decomposition
[0092] 1. Construction of test materials
[0093] In the early stages, 237 BC1F rice varieties were developed through crossbreeding and backcrossing between the cold-resistant wild Dongxiang rice and the cold-sensitive indica rice variety Xieqingzao B bred by the Rice Research Institute of Anhui Academy of Agricultural Sciences. 10The backcross recombinant inbred line (BIL) population was used to assess early seedling cold tolerance at the one-leaf-one-heart stage. After three backcrosses and one self-cross with the recurrent parent Xieqingzao B and the extremely cold-tolerant line 5339, a high-generation backcross population of BC4F2 was obtained. Based on the cold tolerance phenotype and genotype, the early seedling cold-tolerant introgression line 19H19 was screened. Subsequently, QTL validation was performed using the RHL-F2 secondary mapping population developed from 19H19 using the residual heterozygote (RHL) method. Further BSA-seq analysis was performed on the BC5F2 population constructed by backcrossing 19H19 with Xieqingzao B.
[0094] 2. Genotyping
[0095] The test materials were planted at the Nanchang Experimental Base of the Rice Research Institute of Jiangxi Academy of Agricultural Sciences. Young rice leaves were cut, and whole-genome DNA was extracted using the sodium dodecyl sulfate (SDS) method. 196 SSR markers with good amplification effect, polymorphism among parents, and uniform distribution on the 12 chromosomes of rice were screened for genotyping of 19H19 and 120 BC5F2 mapping populations.
[0096] The PCR reaction system is as follows: 5.0 μl of 2×Tolo FastTaq Premix, 1 μl of 10 pmol / μl primer pair CTES12, 1 μl of 300-500 ng / μl rice genomic template DNA, and 10 μl of sterile ultrapure water.
[0097] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; final extension at 72℃ for 10 min; the amplified products were stored at 4℃.
[0098] The amplified products were separated by denaturation with 6% polyacrylamide or by 3% agarose gel electrophoresis. Electrophoresis at 260V constant voltage was used to detect the amplified band patterns of each molecular marker. The amplified band patterns of individual plants from the 19H19 and its derived BC5F2 populations were compared with those of Dongxiang wild rice and Xieqingzao B. A band pattern identical to the parent Xieqingzao B was marked as 1, identical to the parent Dongxiang wild rice as 2, and a deletion was marked as "-".
[0099] 3. Identification of cold tolerance in the early seedling stage
[0100] The seedling cold tolerance assessment was conducted at the Rice Research Institute of Jiangxi Academy of Agricultural Sciences from November 2021 to April 2022. Each line was planted with 30 seeds. When the seedlings reached the 1-leaf-1-heart stage, they were placed in a GHP-300E intelligent light incubator (Shanghai Sanfa Scientific Instruments Co., Ltd.). The seedlings were subjected to a 5-day low-temperature treatment at 5℃ for 10 hours and 8℃ for 14 hours. After 7 days of recovery, the survival rate was investigated. The average of three replicates was used as the evaluation index for the early seedling cold tolerance of the line.
[0101] Example 2
[0102] Four RHL individual plants were selected from the BC5F2 population at the Nanchang experimental base. Four RHL individual plants were then used to generate an F2 population in the Sanya experimental base. Genotyping was performed using nine pairs of SSR markers (RM3246, RM7887, RM7195, RM5359, RM27947, RM27950, RM27955, RM5364, and RM27983) to construct four BC5F3 generation RHL-F2 populations for fine mapping. Once the four BC5F3 generation near-isogenic lines reached the one-leaf-one-heart stage, they were treated with 5℃ 10h night / 8℃ 14h day for 5 days. After 7 days of recovery, seedling survival rate was recorded. One-way ANOVA was used to detect phenotypic variation between two homozygous genotypes within the same near-isogenic line. If significant differences in phenotype were found between different genotypes (P<0.05), their additive effects and phenotypic contribution rates were estimated, and QTL decomposition was performed. This analysis was performed using the ProcGLM generalized linear model in SAS software (SAS Institute Inc., 1999). The target QTL interval was ultimately narrowed down to RM5939-RM27947, with a physical location of 10,066,394–10,266,442 bp, a physical interval of approximately 195 kb (see [link to analysis]). Figure 2 ).
[0103] Example 3
[0104] Expression analysis and validation of cold-resistant candidate genes
[0105] Total RNA was extracted from rice seedlings using the RNeasy Plant Mini Kit (QIAGEN, Germany). The premix Ex TaqTMII (Tli RNase Plus) (Takara) was analyzed by RT-qPCR, with Osactin as an internal control. The instrument used was a ViiA7 real-time quantitative PCR system from Applied Biosystems, USA. Xieqingzao B and 19H19 rice varieties were subjected to 5℃ 10h night / 8℃ 14h day low-temperature treatment and room temperature treatment for 5 days at the one-leaf-one-heart stage. After 7 days of recovery, rice seedling samples were collected at room temperature, low temperature, and after recovery for RT-qPCR and transcriptome analysis. The results showed that qCTES12 under low-temperature treatment... DWR The candidate gene Loc_Os12g18729 was upregulated in 19H19 after growth recovery, while the expression of Xieqingzao B was downregulated. Figure 6 Used for analyzing qCTES12 DWR The primers for RT-qPCR of the candidate gene Loc_Os12g18729 are:
[0106] RT-F(SEQ ID No.6):5'-CCCCTCTCTCATATCCAGTGGCT-3';
[0107] RT-R (SEQ ID No. 7): 5'-TGTAATCCAAGGCGATGACCACG-3'.
[0108] Example 4
[0109] Rice early seedling cold tolerance gene qCTES12 DWR Detection of linked molecular marker CTES12
[0110] Genotypes of cold-tolerant and cold-intolerant lines in the Xieqingzao B, 19H19, Dongxiang wild rice Anjiashanju group 194, and BC5F2 populations were detected using the LOC_Os12g18729-linked marker CTES12. The results showed that the cold-tolerant and cold-intolerant genotypes were consistent with their corresponding cold tolerance, indicating that the molecular marker CTES12 is linked to cold tolerance in the early seedling stage of rice and can accurately assist in the selection of cold tolerance in the early seedling stage of rice. Figure 7 The molecular marker of this gene can be applied to assisted selection breeding for improvement.
[0111] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A method for identifying cold-resistant rice varieties in the early seedling stage, comprising the following steps: 1) Extract genomic DNA from the rice samples to be tested; 2) Using the genomic DNA obtained in step 1) as a template, PCR amplification was performed on CTES12 using primers to obtain the amplification product; The nucleotide sequence of the upstream primer of the primer pair CTES12 is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; 3) Perform agarose gel electrophoresis on the amplification product obtained in step 2). When only a 230bp band is obtained, the rice to be tested is an early seedling cold-resistant rice variety. The PCR amplification system in step 2) is as follows: 5.0 μL of 2×Tolo FastTaq Premix, 1 μL each of 10 pmol / μL upstream and downstream primers, 1 μL of 300-500 ng / μL rice genomic DNA, and sterilized ultrapure water to 10 μL. The PCR amplification procedure for step 2) is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; and finally 72℃ extension for 10 min; the amplification product is stored at 4℃. The rice varieties mentioned are Xieqingzao B and Dongxiang wild rice.