Use of miR-22 and its complex with DNA tetrahedron for the preparation of a medicament for the treatment of depression

CN117357550BActive Publication Date: 2026-08-07SICHUAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SICHUAN UNIV
Filing Date
2022-07-07
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

此外,中国专利CN112156104B还公开了DNA四面体本身对于抑郁症的治疗作用,不过,DNA与其他活性成分的复合物对其药理活性的影响尚不明确,还有待进一步探究

Benefits of technology

[0020]The beneficial effects of this invention are as follows: This invention confirms the antidepressant effect of miR-22. Furthermore, after miR-22 and DNA tetrahedrons are combined, the complex TDNs-miR-22-3p can effectively cross the blood-brain barrier, allowing the active substance to reach the brain. It synergistically reduces the immobility time of mice in the forced swimming experiment, restores the normal preference of mice for sucrose water, and alleviates the depressive-like behavior of mice, showing potential for application in drugs for treating depression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117357550B_ABST
    Figure CN117357550B_ABST
Patent Text Reader

Abstract

The application provides use of miR-22 and a compound of miR-22 and a DNA tetrahedron in preparation of a drug for treating depression. The application proves the anti-depression effect of miR-22, and further, after the miR-22 and the DNA tetrahedron are compounded, the compound TDNs-miR-22-3p can effectively pass through a blood-brain barrier, so that effective substances reach the brain, the compound TDNs-miR-22-3p can synergistically reduce the immobile time of mice in a forced swimming test, restore the normal preference of the mice to sucrose water, relieve the depression-like behavior of the mice, and has application potential in the drug for treating depression.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the use of miR-22 and its complex with DNA tetrahedrons in the preparation of drugs for treating depression. Background Technology

[0002] Depression is a common illness with a lifetime prevalence exceeding 15% and is a leading cause of disability. The global economic costs associated with depression are projected to nearly double by 2030. Drug therapy and psychotherapy are the two main pillars of depression treatment. Second-generation antidepressants, including selective serotonin reuptake inhibitors (SSRIs), are in particular, and are the first-line treatment for depression. However, existing treatments for depression are slow to take effect, often requiring weeks to months, and approximately 30% of patients still do not respond to current antidepressants. One of the main reasons for these two drawbacks is the presence of the blood-brain barrier (BBB), which prevents drugs from being delivered to the central nervous system. Additionally, due to the broad spectrum of action of these drugs, patients often experience side effects such as dry mouth, tremors, dizziness, and gastrointestinal discomfort while taking them.

[0003] MicroRNAs (miRNAs) are 19-24 nucleotide non-coding RNAs that function as negative regulators of post-transcriptional gene expression. A single miRNA can target many mRNAs simultaneously, including potential pathways that alter the activity of multiple pathways. If suitable endogenous or exogenous sequences can be found, miRNAs could become a novel approach to treating complex diseases, including mental illnesses. Different miRNA profiles, such as miR-124, miR-221, and miR-335, have been identified in prefrontal cortex or peripheral blood samples from patients with depression. Furthermore, previous studies have determined that antidepressant treatment can alter the expression of several miRNAs in patients with depression, including miR-1202, miR-16, and miR-135a. These studies suggest that miRNAs may be a promising treatment option for depression.

[0004] Currently, research has confirmed that microRNA-22-3p (miR-22-3p) has anti-inflammatory capabilities and is associated with neuroplasticity. Some studies have also reported that applephenolic extracts can improve depression through miR-22-3p / SIRT1 (Applephenolic extracts ameliorate lead-induced cognitive impairment and depression-and anxiety-like behavior in mice by abating oxidative stress, inflammation and apoptosis via the miR-22-3p / SIRT1 axis[J].Food & Function.); however, no reports have been published on the therapeutic effect of miR-22 on depression.

[0005] Furthermore, the crossing of the blood-brain barrier by therapeutic active ingredients presents numerous challenges. DNA tetrahedra (TDNs), as novel 3D nucleic acid nanomaterials, offer significant advantages, including biocompatibility, structural stability, and programmability. As a carrier, they have demonstrated immense potential in drug delivery and biomedical therapy. Self-assembled TDNs consist of four single-stranded DNA (ssDNA) molecules linked by highly specific base pairing. Unlike virgin DNA, which cannot be absorbed by cells without the aid of other auxiliary agents, TDNs enter and exit cells via endocytosis and exocytosis, independent of drug efflux pumps, without the need for any transfection reagents. Their stability and nanoscale size also enable them to successfully cross the blood-brain barrier. Studies have successfully utilized TDNs in several areas: introducing antisense peptide nucleic acids (asPNAs) into methicillin-resistant Staphylococcus aureus; successfully loading paclitaxel for the treatment of small cell lung cancer; and loading target genes to cross the blood-brain barrier for the treatment of brain tumors. In addition, Chinese patent CN112156104B also discloses the therapeutic effect of DNA tetrahedron itself on depression. However, the effect of DNA complexes with other active ingredients on its pharmacological activity is still unclear and needs further investigation. Summary of the Invention

[0006] The purpose of this invention is to provide a new use for microRNA miR-22, and a new use for its tetrahedral complex with DNA.

[0007] This invention provides the use of miR-22 in the preparation of medicaments for treating depression.

[0008] The present invention also provides a drug for treating depression, which is a formulation prepared with miR-22 as the active ingredient and pharmaceutically acceptable excipients.

[0009] Furthermore, the sequences of the miR-22 described above are all as shown in SEQ ID NO.6.

[0010] This invention provides the use of a complex in the preparation of a medicament for treating depression, the complex being composed of DNA tetrahedra and miR-22 in a molar ratio of 1:(1 to 4).

[0011] Furthermore, the aforementioned DNA tetrahedron is formed by base pairing of four single-stranded DNA molecules; the sequences of the four single-stranded DNA molecules are selected one-to-one from the sequences described in SEQ ID NO. 1 to 4; the sequence of miR-22 is the sequence described in SEQ ID NO. 5.

[0012] Furthermore, the miR-22 mentioned above is chemically linked to 1 to 4 of the 4 single-stranded DNA strands that make up the tetrahedral structure of DNA.

[0013] Furthermore, the miR-22 and the single-stranded DNA also contain a linker sequence, which is a nucleotide sequence.

[0014] Furthermore, the above nucleotide sequence is a deoxyribonucleotide sequence.

[0015] Furthermore, the above deoxyribonucleotide sequence is -TTTTT-.

[0016] Furthermore, the above complex is prepared by the following method: placing four single-stranded DNA strands of a DNA tetrahedron at a temperature sufficient to denature them for at least 10 minutes, and then lowering the temperature to 2–8°C and maintaining it for at least 20 minutes.

[0017] At least one of the four single-stranded DNA strands is linked to miR-22.

[0018] Preferably, the sequences of the four single-stranded DNAs are as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0019] Furthermore, the above complex was prepared by placing four single strands of a DNA tetrahedron at 95°C for 10 min, and then lowering the temperature to 4°C for 20 min.

[0020] The beneficial effects of this invention are as follows: This invention confirms the antidepressant effect of miR-22. Furthermore, after miR-22 and DNA tetrahedrons are combined, the complex TDNs-miR-22-3p can effectively cross the blood-brain barrier, allowing the active substance to reach the brain. It synergistically reduces the immobility time of mice in the forced swimming experiment, restores the normal preference of mice for sucrose water, and alleviates the depressive-like behavior of mice, showing potential for application in drugs for treating depression.

[0021] The miR-22 of this invention is microRNA-22, more specifically, microRNA-22-3p, with the sequence aagcugccaguugaagaacugu.

[0022] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0023] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0024] Figure 1 The results are the identification results of the complex of the present invention.

[0025] Figure 2 The result showed improvement in depressive-like behavior in mice.

[0026] Figure 3 The results are fluorescence imaging results in mice. Detailed Implementation

[0027] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0028] Example 1: Synthesis of the complex of the present invention

[0029] 1. Synthesis

[0030] Four single-stranded DNA molecules (S1, S2, S3-miR22, S4) were dissolved in TM Buffer (10mM Tris-HCl, 50M mMgCl2, pH=8.0) to a final concentration of 1000nM. The mixture was thoroughly mixed, rapidly heated to 95°C and held for 10 minutes, then rapidly cooled to 4°C and held for at least 20 minutes to obtain TDNs-miR-22-3p.

[0031] The sequence of the four single strands (5'→3') is as follows:

[0032] S1 (SEQ ID NO.1):

[0033] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA

[0034] S2 (SEQ ID NO.2):

[0035] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG

[0036] S3-miR22-3p (SEQ ID NO.5):

[0037] AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0038] S4 (SEQ ID NO.4):

[0039] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG

[0040] Optionally, a Cy5 fluorescent labeling group is attached to the 5' end of S1 for tracking TDNs-22, forming Cy5-labeled TDNs-miR-22-3p:

[0041] S1-Cy5:

[0042] Cy5-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA.

[0043] In addition, single strands of S1, S2, S4 and S3 with the following sequence were prepared using the same method to obtain DNA tetrahedral TDNs that do not combine with miR-22, which served as controls.

[0044] S3 (SEQ ID NO.3):

[0045] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0046] The sequence of MiR-22 (SEQ ID NO.6): AAGUGCCAGUUGAAGAACUGU

[0047] 2. Identification

[0048] Capillary electrophoresis and PAGE electrophoresis were used to detect single-stranded DNA and synthesized TDNs-miR-22-3p; transmission electron microscopy was used to detect the morphology of TDNs and TDNs-miR-22-3p; dynamic light scattering was used to detect the zeta potential and particle size of TDNs and TDNs-miR-22-3p.

[0049] 3. Appraisal Results

[0050] like Figure 1 As shown, Figure 1 a is a schematic diagram of the self-assembly of the composite of the present invention. Figure 1 Electrophoresis results showed that the molecular weight of the TDNs-miR-22-3p band was significantly higher than that of single-stranded DNA and DNA tetrahedron, indicating that single-stranded DNA was assembled together.

[0051] from Figure 1 c and 1d show that tetrahedral particles were detected by transmission electron microscopy. The zeta potential of TDNs detected by dynamic optical dispersion was -8.59 mV and the particle size was 21.04 nm; the zeta potential of TDNs-miR-22-3p was -9.83 mV and the particle size was 24.36 nm, indicating that TDNs-miR-22-3p was successfully synthesized and is stable.

[0052] The beneficial effects of the present invention will be further described below by way of experimental examples. The TDNs involved in the experimental examples were all prepared by the method of Example 1.

[0053] Experimental Example 1: The effect of the compound of the present invention on depression.

[0054] 1. Experimental Methods

[0055] 1.1 Animal Model

[0056] This study used male C57BL / 6 mice aged 7 to 9 weeks. All animals lived in the same environment for at least one week prior to injection, with a light:dark cycle of 12:12. Animals were housed in polypropylene cages in groups of 4–5, with adequate water and food provided, and the room temperature maintained at 21 ± 1°C and humidity at 50% ± 10%.

[0057] Mice were randomly divided into five groups of 15 each, and administered the drugs as follows:

[0058] Control group: TM buffer solution was administered via the tail vein after injection of raw saline as a treatment method;

[0059] LPS group: TM buffer was administered via the tail vein as a treatment after LPS injection;

[0060] TDNs group: TDNs were administered via the tail vein after LPS injection as a treatment method;

[0061] miR-22-3p group: miR-22 was administered via the tail vein after LPS injection as a treatment method;

[0062] TDNs-miR-22-3p group: TDNs-miR-22-3p was administered via the tail vein after LPS injection as a treatment method.

[0063] LPS was prepared in 0.9% normal saline on the day of injection, with a concentration of 0.083 mg / ml. LPS and normal saline were injected intraperitoneally at a dose of 10 ml / kg, with the LPS dose being 0.83 mg / kg. LPS induction was a classic acute depression model known in the art (DOI: 10.1007 / s00702-019-02084-y). After mice exhibited depressive-like behavior, they were administered TM buffer, TDNs, miR-22-3p, and TDNs-miR-22-3p (100 μL / mouse; TDNs, miR-22-3p, and TDNs-miR-22-3p were solutions prepared with TM buffer at a concentration of 1000 nM) via the tail vein as described above. Treatment via tail vein was repeated 30 minutes and 6 hours after LPS or normal saline injection.

[0064] 1.2 Behavioral Testing

[0065] The temperature in the testing chamber was maintained at 21±1℃, and the humidity at 50%±10%. Mice underwent 30 minutes of acclimatization training before behavioral analysis. All tests were conducted between 2:00 PM and 8:00 PM. The testing area was dimly lit and kept quiet throughout the experiment to avoid causing stress or anxiety in the mice. Data were recorded and analyzed using EthoVision XT11 software. The effects of the drug on depressive-like behavior in mice were assessed using a forced swimming test and a sucrose preference test.

[0066] 1.3 Drug Accumulation Detection

[0067] After injection of Cy5-labeled TDNs-miR-22-3p, the fluorescence signal in mice was observed at different time points using an in vivo imaging fluorescence system.

[0068] 2. Experimental Results

[0069] like Figure 2 As shown, animal behavioral experiments demonstrated that both miR-22 and TDNs themselves can alleviate depressive-like behavior in mice to some extent, exhibiting a certain antidepressant effect. Furthermore, after injection of TDNs-miR-22-3p, the immobility time of depressed model mice was significantly reduced in the forced swimming test, and their normal preference for sucrose water was significantly restored in the sucrose water preference test, proving that the complex of the two exhibits a synergistic antidepressant effect.

[0070] like Figure 3 As shown, and confirmed by fluorescence signals from an in vivo imaging system, TDNs-miR-22-3p can penetrate the blood-brain barrier (BBB) ​​and accumulate primarily in the brain within minutes of tail vein injection. This overcomes the limitation of existing treatments that make it difficult to deliver drugs to the brain.

[0071] In summary, this invention confirms the antidepressant effect of miR-22. Furthermore, after miR-22 and DNA tetrahedrons are combined, the complex TDNs-miR-22-3p can effectively cross the blood-brain barrier, allowing the active ingredient to reach the brain. This synergistic effect reduces the immobility time of mice in the forced swimming experiment, restores mice's normal preference for sucrose water, and alleviates depressive-like behavior in mice, demonstrating its potential application in drugs for treating depression.

Claims

1. The use of a complex in the preparation of a medicament for treating depression, characterized in that, The complex is composed of DNA tetrahedra and miR-22 in a molar ratio of 1:(1-4); The DNA tetrahedron is formed by base pairing of four single-stranded DNA molecules; the sequences of the four single-stranded DNA molecules are selected one-to-one from the sequences in SEQ ID NO. 1 to 4; the sequence of miR-22 is the sequence in SEQ ID NO. 6; The miR-22 is chemically bonded to one to four of the four single-stranded DNA strands that make up the tetrahedral structure of DNA.

2. The use as described in claim 1, characterized in that, The miR-22 and the single-stranded DNA also contain a linker sequence, which is a nucleotide sequence.

3. The use as described in claim 2, characterized in that, The nucleotide sequence is a deoxyribonucleotide sequence.

4. The use as described in claim 3, characterized in that, The deoxyribonucleic acid sequence is -TTTTT-.

5. The use as described in any one of claims 1 to 2, characterized in that, The complex is prepared by placing four single-stranded DNA strands of a DNA tetrahedron at a temperature sufficient to denature them for at least 10 minutes, and then lowering the temperature to 2–8°C and maintaining it for at least 20 minutes; at least one of the four single-stranded DNA strands is attached to miR-22.

Citation Information

Patent Citations

  • A drug for treating depression

    CN112156104B

  • Nanocomposite of DNA tetrahedron and microRNA

    CN110404081A

  • Compound for treating optic nerve diseases as well as preparation method and application thereof

    CN112843085A