Kit for detecting liver cancer in vitro and application thereof

Abstract

The application relates to a kit for detecting liver cancer in vitro, which comprises reagents for detecting the methylation level of biomarkers in a sample, wherein the biomarkers comprise a DNAJC6 gene and / or a BCL3 gene. By detecting the change in the methylation level of any one or any two specific nucleic acid sequences in the above target genes, liver cancer can be diagnosed or assisted in diagnosis, has high sensitivity and specificity, and can effectively improve the detection rate of liver cancer.

Description

Technical Field

[0001] This application relates to the field of molecular biology, and in particular to a kit for the in vitro detection of liver cancer and its application. Background Technology

[0002] Liver cancer is one of the most common malignant tumors, ranking second in mortality among malignant tumors. Early-stage liver cancer generally refers to liver cancer in its early stages of staging. It is localized, without intrahepatic or distant metastasis, and without lymph node metastasis. Specifically, it refers to primary liver cancer where the largest diameter of a single cancerous nodule is less than 3 cm, or the combined largest diameter of up to three cancerous nodules is less than 3 cm. Patients with early-stage liver cancer often do not have obvious clinical symptoms or signs related to liver cancer. Once detected and surgically removed in time, patients with early-stage liver cancer can achieve long-term survival, and the postoperative recurrence rate is low. When patients experience significant discomfort or very obvious clinical symptoms, the disease has mostly progressed to the middle or late stages. Treatment for late-stage liver cancer is not ideal, and the survival period is often only six months to one and a half years. Therefore, establishing methods for liver cancer early warning and early screening is very important for the prevention and control of liver cancer. Early detection, early diagnosis, early treatment, and early surgery are effective means of preventing and controlling liver cancer.

[0003] Existing technologies have disclosed some biomarkers that can be used to diagnose liver cancer, including DNA methylation markers. However, these biomarkers do not provide detailed staging for liver cancer, nor do they demonstrate high sensitivity and specificity for early-stage liver cancer. Therefore, it is necessary to develop biomarkers for diagnosing early-stage liver cancer, improve the early detection rate of liver cancer, promote early intervention in treatment, and reduce liver cancer mortality. Summary of the Invention

[0004] Based on this, this application provides a kit for in vitro detection of liver cancer, which uses the DNAJC6 gene and / or BCL3 gene as biomarkers. By detecting their DNA methylation level, the kit assesses whether the subject has the risk of developing liver cancer, and also has high sensitivity and specificity for early-stage liver cancer.

[0005] The specific technical solution is as follows:

[0006] This application provides a kit for in vitro detection of liver cancer, the kit comprising reagents for detecting the methylation level of biomarkers in a sample, the biomarkers including the DNAJC6 gene and / or the BCL3 gene.

[0007] In one embodiment, the biomarker includes at least one of the nucleic acid sequences shown in SEQ ID NO: 1 to 4, wherein SEQ ID NO: 1 to 2 are derived from the DNAJC6 gene and SEQ ID NO: 3 to 4 are derived from the BCL3 gene.

[0008] In one embodiment, the biomarker comprises a combination of any two of the nucleic acid sequences shown in SEQ ID NO: 1 to 4.

[0009] In one embodiment, the reagent includes a primer pair for detecting the methylation level of the biomarker.

[0010] Further, the primer pairs include primer pairs for detecting the methylation level of at least one of the nucleic acid sequences shown in SEQ ID NO: 1 to 4, primer pairs for detecting the methylation level of SEQ ID NO: 1 are shown in SEQ ID NO: 9 to 10; primer pairs for detecting the methylation level of SEQ ID NO: 2 are shown in SEQ ID NO: 12 to 13; primer pairs for detecting the methylation level of SEQ ID NO: 3 are shown in SEQ ID NO: 15 to 16; and / or, primer pairs for detecting the methylation level of SEQ ID NO: 4 are shown in SEQ ID NO: 18 to 19.

[0011] In one embodiment, the reagent further includes a detection probe for detecting the methylation level of at least one sequence in the biomarker.

[0012] Further, the detection probe includes a detection probe for detecting the methylation level of at least one of the nucleic acid sequences shown in SEQ ID NO: 1 to 4, wherein the detection probe for detecting the methylation level of SEQ ID NO: 1 is shown in SEQ ID NO: 11; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 2 is shown in SEQ ID NO: 14; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 3 is shown in SEQ ID NO: 17; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 4 is shown in SEQ ID NO: 20.

[0013] In one embodiment, the kit further includes one or more of PCR reaction reagents, methylation conversion reagents, DNA extraction reagents, and DNA purification reagents.

[0014] This application also provides the application of the aforementioned reagent kit in the preparation of liver cancer diagnostic products.

[0015] In one embodiment, the liver cancer includes stages 0 and A of the Barcelona Clinical Stages of Liver Cancer.

[0016] Compared with the prior art, this application has the following beneficial effects:

[0017] This application utilizes alterations in the methylation levels of at least one nucleic acid sequence in the DNAJC6 and BCL3 genes to diagnose or assist in the diagnosis of liver cancer, especially early-stage liver cancer. It exhibits high sensitivity and specificity, effectively improving the early detection rate of liver cancer. Furthermore, reagents for detecting these methylation sequences can be developed into diagnostic products for liver cancer, such as kits, diagnostic systems, and chips. This application provides novel biomarkers and diagnostic strategies for the early diagnosis of liver cancer. Detailed Implementation

[0018] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, a detailed description of specific embodiments of this application is provided below. Many specific details are set forth in the following description to provide a thorough understanding of this application. However, this application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of this application. Therefore, this application is not limited to the specific embodiments disclosed below.

[0019] Unless otherwise defined, all technical and scientific terms used herein are consistent with those of the art to which this application pertains.

[0020] The terms used herein are the same as those commonly understood by those skilled in the art. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0021] Terminology Explanation

[0022] The term “and / or” includes any and all combinations of one or more of the related listed items.

[0023] The term "diagnosis" includes determining or assisting in determining the presence or absence of a disease, assessing the risk of recurrence, evaluating the risk and degree of cancer, and predicting prognosis.

[0024] The terms "oligonucleotide," "polynucleotide," "nucleotide," or "nucleic acid" refer to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the final function or use of the oligonucleotide. Oligonucleotides can be produced in any way, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. Typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.

[0025] The term "methylation" is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in a CpG dinucleotide of the genome, under the action of DNA methyltransferases. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

[0026] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides within a DNA sequence is methylated, or the frequency / proportion / percentage of methylation. It represents both a qualitative and quantitative concept. In practical applications, different detection indicators can be used to compare DNA methylation levels depending on the specific circumstances. For example, in some cases, comparisons can be made based on the Ct values ​​of the samples; in others, the proportion of gene methylation in the sample can be calculated as (number of methylated molecules / (number of methylated molecules + number of unmethylated molecules)) × 100, and then compared; in still others, statistical analysis and integration of various indicators are necessary to arrive at a final judgment criterion.

[0027] The term "primer" refers to an oligonucleotide that can be used in amplification methods (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a portion thereof. Typically, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific to that polynucleotide sequence. The exact length of a primer depends on many factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least 10, 15, 20, 25, or more nucleotides, depending on the complexity of the target sequence, but may also contain fewer nucleotides. In this disclosure, the term "primer" refers to a pair of primers capable of hybridizing to the double strand of a target DNA molecule or to sequences flanking the nucleotide sequence to be amplified within the target DNA molecule.

[0028] The term "liver cancer" refers to hepatocellular carcinoma, primarily primary hepatocellular carcinoma. "Early-stage liver cancer" refers to liver cancer staged as 0 or A according to the 2021 Barcelona Clinical Liver Cancer (BCLC) staging system. The Barcelona Clinical Liver Cancer (BCLC) system is the most widely accepted staging system in the field of liver cancer, classifying patients into five categories:

[0029] Stage 0 (very early stage): Solitary tumor less than or equal to 2 cm, without vascular invasion or extrahepatic metastasis, good liver reserve function and no tumor-related symptoms.

[0030] Stage A (early stage): Solitary tumor, regardless of size, or multifocal hepatocellular carcinoma with up to 3 nodules (all ≤3cm), without major vascular invasion, extrahepatic metastasis, or tumor-related symptoms, and a performance status score (PS) of 0.

[0031] Stage B (intermediate): Multifocal hepatocellular carcinoma (exceeding the criteria for Stage A), with good liver reserve function, no tumor-related symptoms, PS of 0, and no vascular invasion or extrahepatic metastasis;

[0032] Stage C (advanced): Symptomatic tumors and invasive and / or metastatic hepatocellular carcinoma, with vascular invasion or extrahepatic spread, PS 1-2, and good liver reserve function;

[0033] Stage D (End-Stage Disease): End-stage patients with poor liver function due to a large tumor burden, or those whose poor liver function is not due to non-tumor factors and who are not eligible for liver transplantation, with a PS greater than 2.

[0034] The term "chronic liver disease" includes chronic hepatitis, fatty liver, and compensated cirrhosis (Child-Pugh score of A), with hepatitis B being the most common type of chronic hepatitis.

[0035] This application study found that specific nucleic acid sequences of the DNAJC6 and BCL3 genes exhibit significantly different methylation levels in liver cancer and normal samples, which can serve as biomarkers for the diagnosis or auxiliary diagnosis of early-stage liver cancer. Therefore, this application provides a kit for in vitro detection of liver cancer, comprising reagents for detecting the methylation levels of biomarkers in a sample, including the DNAJC6 and / or BCL3 genes. This kit demonstrates good sensitivity and specificity for liver cancer, including early-stage liver cancer.

[0036] In one embodiment, the biomarker includes at least one of the nucleic acid sequences shown in SEQ ID NO: 1 to 4, wherein SEQ ID NO: 1 to 2 are derived from the DNAJC6 gene and SEQ ID NO: 3 to 4 are derived from the BCL3 gene.

[0037] In one embodiment, the biomarker comprises a combination of any two of the nucleic acid sequences shown in SEQ ID NO: 1 to 4.

[0038] In some embodiments, the biomarkers include the DNAJC6 gene and the BCL3 gene. It is understood that the kit can be a kit for detecting two target genes. As a specific example, the biomarker detected by the kit can be a combination of SEQ ID NO: 1 or SEQ ID NO: 2 and any one of SEQ ID NO: 3 to 4; for example, detecting SEQ ID NO: 1 and SEQ ID NO: 3, or detecting SEQ ID NO: 1 and SEQ ID NO: 4, or detecting SEQ ID NO: 2 and SEQ ID NO: 3, or detecting SEQ ID NO: 2 and SEQ ID NO: 4.

[0039] In one embodiment, the reagent further includes primer pairs for detecting the methylation level of at least one sequence in the specific nucleic acid sequence. The primer pairs can be designed according to the nucleic acid sequence of the biomarker to be detected; therefore, the primer pairs contained in the reagent correspond to the biomarker to be detected. As specific examples, the detection primer pairs for detecting the methylation level of SEQ ID NO: 1 are shown in SEQ ID NO: 9–10; and / or, the detection primer pairs for detecting the methylation level of SEQ ID NO: 2 are shown in SEQ ID NO: 12–13; and / or, the detection primer pairs for detecting the methylation level of SEQ ID NO: 3 are shown in SEQ ID NO: 15–16; and / or, the detection primer pairs for detecting the methylation level of SEQ ID NO: 4 are shown in SEQ ID NO: 18–19.

[0040] In one embodiment, the reagent further includes a detection probe for detecting the methylation level of at least one sequence in the specific nucleic acid sequence, wherein the detection probe for detecting the methylation level of SEQ ID NO: 1 is shown in SEQ ID NO: 11; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 2 is shown in SEQ ID NO: 14; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 3 is shown in SEQ ID NO: 17; and / or, the detection probe for detecting the methylation level of SEQ ID NO: 4 is shown in SEQ ID NO: 20.

[0041] There are no special restrictions on the nucleotide sequences of the primer pairs or probes in this application. As long as the primer pairs and probes can detect the methylation level of the target sequence, they are all within the scope of protection of this application.

[0042] In one embodiment, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

[0043] Specifically, the fluorescent reporter group can be selected from HEX, FAM, TET, CF532, JOE, TAMRA, ROX, CY3, CY5, Texas Red, NED, Alexa Flour, or VIC, and the quencher group can be selected from MGB, TAMRA, BHQ1, BHQ2, BHQ3, or QSY.

[0044] The kit described in this application also includes one or more of the following: PCR reaction reagents, methylation conversion reagents, DNA extraction reagents, and DNA purification reagents. PCR reaction reagents are essential reagents required to complete PCR reactions in the art, such as DNA polymerase, dNTPs, and necessary buffers. Methylation conversion reagents are reagents that convert unmethylated cytosine bases in nucleic acid sequences to uracil, and can be selected from bisulfite. DNA extraction reagents and DNA purification reagents can be selected from reagents in the art according to sample type, etc.

[0045] In some implementations, the kit may also include quality control materials, amplification primers and probes for internal reference genes, etc.

[0046] In some implementations, the kit detects the methylation of the above-mentioned nucleic acid sequences through one or more of the following methods:

[0047] Methylation-specific PCR, methylation-specific quantitative PCR, bisulfite sequencing, methylation-specific microarray, whole-genome methylation sequencing, pyrosequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, and methylation-sensitive restriction endonuclease method.

[0048] The types of samples that can be tested by the kit in this application include blood samples and tissue samples.

[0049] This application also provides the application of the kit in the preparation of early liver cancer diagnostic products.

[0050] In some implementations, the aforementioned early liver cancer diagnosis includes distinguishing early liver cancer from healthy individuals, and also distinguishing early liver cancer from patients with chronic liver disease.

[0051] Example

[0052] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0053] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0054] Example 1: Detection of methylation level using methylation-specific quantitative fluorescence method (qMSP)

[0055] Using GRCh38.p14 as the reference genome, and the positive / negative strand nucleic acid sequences of the four regions as templates, methylation primer pairs and detection probes suitable for real-time PCR amplification were designed. Specific experimental steps included:

[0056] 1. Sample collection

[0057] The samples include tissue samples and plasma samples.

[0058] A total of 45 patients with early-stage liver cancer (stages 0-A) and 45 corresponding adjacent normal tissue samples were collected; 79 patients with mid-to-late-stage liver cancer (stages B-D) and 79 corresponding adjacent normal tissue samples were also collected. All samples were formalin-soaked and paraffin-embedded tissue samples.

[0059] Blood samples were collected from 36 patients with early-stage hepatocellular carcinoma (stages 0-A), 57 patients with intermediate-to-late-stage hepatocellular carcinoma, 73 patients with chronic liver disease (33 with hepatitis B, 20 with fatty liver, and 20 with compensated cirrhosis), and 50 healthy individuals. Each blood sample consisted of 10 mL collected venously before enrollment.

[0060] All human samples and clinical data were collected in accordance with the principles of the Declaration of Helsinki, and all participants signed written informed consent forms for the use of their plasma samples. Inclusion criteria for liver cancer patients: age ≥18 years, clinically diagnosed with liver cancer, and no prior surgery or chemotherapy, excluding patients with other malignancies. The control group consisted of high-risk chronic liver disease patients who underwent liver cancer screening but were not found to have liver cancer. Healthy individuals were defined as having no clinical symptoms of liver disease or a history of cancer at enrollment.

[0061] 2. DNA sample extraction and transformation

[0062] DNA was extracted from liver cancer and adjacent liver tissue using the QIAamp DNAFFPE Tissue Kit (Qiagen, Valencia, CA, USA). Prior to DNA extraction, histopathological evaluation confirmed the presence of tumor cells in the liver cancer tissue samples, while no tumor cells were found in the non-liver cancer tissue samples.

[0063] cfDNA was extracted from 10 mL of plasma using the QIAamp Circulating Nucleic Acid kit (Qiagen, Valencia, CA, USA). DNA was quantified with a Qubit 2.0 fluorimeter (ThermoFisher Scientific, Waltham, MA, USA).

[0064] Conversion:

[0065] Before qPCR amplification, genomic DNA is subjected to sodium bisulfite chemical modification, which converts unmethylated cytosine to uracil while leaving methylated cytosine unchanged. The kit used for conversion and purification of sample DNA is the nucleic acid conversion reagent from Wuhan Ameson Life Technology Co., Ltd. (E Han Xie Bei No. 20200843), and the specific operation steps refer to the instruction manual.

[0066] 3. Methylation-specific quantitative fluorescence PCR

[0067] 1) Design of methylation-specific primer pairs and detection probes:

[0068] Methylation-specific primer pairs and detection probes are designed with the bisulfite-converted sequences of each nucleic acid sequence as templates respectively, to amplify the target sequences. The nucleic acid sequences of the target sequences and the bisulfite-converted sequences thereof are shown in Table 1, and the methylation-specific primer pairs for amplifying different target sequences, the sequences of the detection probes and the detectable methylated cytosine sites are shown in Table 2.

[0069] Table 1 Specific nucleic acid sequences of target genes and sequences thereof after bisulfite conversion

[0070]

[0071]

[0072] Table 2 Nucleic acid sequences of detection primer pairs, detection probes and detectable methylated cytosine sites

[0073]

[0074]

[0075] 2) qPCR amplification:

[0076] The qPCR reaction solution volume was 25 μL, and the enzyme used was 0.5 μL of high-affinity Hotstart Taq polymerase. 5 μL of template DNA, 0.5 μL each of the upstream and downstream primers and probes for the target region, and 0.5 μL each of the upstream and downstream primers and probes for the internal control gene ACTB (upstream primer: AAGGTGGTTGGGTGGTTGTTTTG (SEQ ID NO: 21), downstream primer: AATAACACCCCCACCCTGC (SEQ ID NO: 22), detection probe: GGAGTGGTTTTTGGGTTTG (SEQ ID NO: 23)) were added to each well plate. The internal control gene, positive control, and negative control were tested together. qPCR was performed on an ABI 7500 instrument under the following amplification conditions: 95℃ for 10 min, 95℃ for 15 s, 60℃ for 30 s, for a total of 45 cycles.

[0077] Negative and positive controls: When performing PCR testing on samples, negative and positive controls should also be tested simultaneously. The DNA template for the negative control tube is TE buffer. The DNA template for the positive control tube is prepared as follows: the sequence corresponding to the amplified region of the ACTB gene after complete bisulfite conversion is artificially synthesized and cloned into a vector to form an artificially synthesized plasmid; the target region, such as SEQ ID NO. 5-8, is artificially synthesized and cloned into vectors to form artificially synthesized plasmids. If only the methylation level of a single region is to be detected, the positive control DNA template is 10... 3 Copies / µL of synthetic plasmid containing transformed ACTB, 10 3 A 1:1 mixture of two synthetic plasmids containing the detection region, expressed as copies / µL; if the methylation level of the composition is being measured, the positive control DNA template is 10. 3 Copies / µL of synthetic plasmid containing transformed ACTB, 10 3 Copies / µL of artificially synthesized plasmid containing one target region and 10 3 A 1:1:1 mixture of three artificially synthesized plasmids containing another target region, one copy per microliter.

[0078] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1-2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.

[0079] Quality control: The negative control should show no amplification, the positive control should show a clear exponential growth phase, and the Ct values ​​of each gene in the positive control should be between 26 and 30. The Ct value of the internal reference gene in the sample to be tested should be ≤35. If the negative control, positive control, and internal reference gene all meet the above requirements, the experiment is considered valid, and the next step of sample result determination can proceed. Otherwise, the experiment is invalid and must be repeated.

[0080] Example 2: Performance of qMSP method in detecting methylation levels of single regions and combinations of regions in test samples for diagnosing liver cancer tissue samples

[0081] 1) Sample collection

[0082] See Example 1 for sample collection.

[0083] 2) qMSP detection and result analysis

[0084] The method for detecting methylation using quantitative real-time PCR is the same as in Example 1.

[0085] The methylation level of the sample is determined based on the Ct values ​​detected in each target region. For tissue samples, if the Ct value of amplified region is ≤38, that region is considered methylated positive; if the Ct value of amplified region is >38, that region is considered methylated negative. When detecting a single region, if the sample is methylated positive in that region, it is considered a cancer-positive sample; if it is methylated negative in that region, it is considered a cancer-negative sample. When detecting a combination of regions, if the sample is methylated positive in at least one region of the combination, it is considered a cancer-positive sample; only if the sample is methylated negative in both regions constituting the combination is it considered a cancer-negative sample.

[0086] The sensitivity and specificity of diagnosing early-stage liver cancer tissue samples, intermediate-stage liver cancer tissue samples, and adjacent normal tissue samples at each stage by detecting the methylation level of regions 1-4 are shown in Table 3. The sensitivity and specificity of diagnosing early-stage liver cancer tissue samples, intermediate-stage liver cancer tissue samples, and adjacent normal tissue samples at each stage by detecting the methylation level of a combination of any two regions 1-4 are shown in Table 4.

[0087] Table 3. Methylation status of regions 1-4 in tissue samples and their diagnostic sensitivity and specificity.

[0088]

[0089] Table 4. Methylation status of the composition in tissue samples and its diagnostic sensitivity and specificity.

[0090]

[0091] As shown in Table 3, the sensitivity of any region from Region 1 to Region 4 for detecting intermediate and advanced liver cancer tissue samples is 88.61%–94.94%, and the specificity for detecting adjacent normal tissues of intermediate and advanced liver cancer is 94.94%–98.73%, indicating good sensitivity and specificity. The sensitivity of any region from Region 1 to Region 4 for detecting early liver cancer tissue samples is 71.11%–77.78%, and the specificity for detecting adjacent normal tissues of early liver cancer is 88.89%–95.56%. Although the amount of tumor DNA (ctDNA) contained in early cancer tissue is less than that in intermediate and advanced cancer tissue, making it more difficult to detect, the aforementioned regions still show good sensitivity and specificity for both early and intermediate and advanced cancer tissue.

[0092] As shown in Table 4, when the methylation level of the composition is detected using any combination of regions 1-4, the sensitivity for diagnosing liver cancer tissue samples at various stages is significantly improved compared to single-region detection. The sensitivity for detecting early-stage liver cancer tissue samples reaches 77.78%–84.44%, and the sensitivity for detecting intermediate-to-late-stage liver cancer tissue samples reaches 92.41%–97.47%. Furthermore, the specificity of the composition for detecting adjacent normal tissues in early-stage liver cancer is 82.22%–93.33%, and the specificity for detecting adjacent normal tissues in intermediate-to-late-stage liver cancer is 94.94%–100.00%.

[0093] Example 3: Performance of qMSP method in detecting methylation levels of region combinations in test samples for diagnosing liver cancer in blood samples

[0094] 1) Sample collection

[0095] See Example 1.

[0096] 2) qMSP Result Analysis

[0097] The method for detecting methylation using quantitative real-time PCR is the same as in Example 1. The methylation level of the sample is determined based on the Ct values ​​detected in each target region. For plasma samples, if the Ct value of amplified region is ≤45, that region is considered methylated positive; if the Ct value of amplified region is >45, that region is considered methylated negative. When detecting a single region, if the sample is methylated positive in that region, it is a cancer-positive sample; if it is methylated negative in that region, it is a cancer-negative sample. When detecting a combination, if the sample is methylated positive in at least one region of the composition, it is a cancer-positive sample; only if the sample is methylated negative in both regions constituting the composition is it a cancer-negative sample.

[0098] As shown in Example 2, the effect of using the methylation level of the composition to detect liver cancer samples is significantly improved compared to using a single region. Therefore, in the detection of plasma samples, only the methylation level of the composition in any two regions of detection areas 1-4 is shown to determine the sensitivity and specificity of plasma samples from early liver cancer, mid-to-late stage liver cancer, chronic liver disease, and healthy individuals, as shown in Table 5.

[0099] Table 5. Methylation status of the composition in plasma samples and its diagnostic sensitivity and specificity.

[0100]

[0101] Table 5 shows that when the combination of any two regions from 1 to 4 is used to detect plasma samples, its sensitivity for early-stage liver cancer plasma samples is 69.44%–77.78%, indicating relatively accurate detection of cancerous samples. Its sensitivity for detecting mid-to-late-stage liver cancer plasma samples is 87.72%–96.49%, which is at a high detection level. Furthermore, the specificity of the combination for detecting plasma samples from patients with chronic liver disease is 91.78%–98.63%, and the specificity for detecting plasma samples from healthy individuals is 92.00%–100.00%. This high specificity demonstrates that the above-mentioned combination can effectively distinguish liver cancer patients from patients with chronic liver disease and healthy individuals, reducing the possibility of misdiagnosis. Among these, combination B shows the best overall performance.

[0102] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0103] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A kit for in vitro detection of liver cancer, the kit comprising reagents for detecting the methylation level of a target region in a sample, the target region being a reference genome of human GRCh38.p14, the target region being one of region 1, region 2, region 3, and region 4 or any combination of two thereof, wherein region 1 is a positive strand of Chr1:65265687-65265866, region 2 is a negative strand of Chr1:65265717-65265859, region 3 is a positive strand of Chr19:44753945-44754120, and region 4 is a positive strand of Chr19:44754765-44754935; the reagents comprising primer pairs and probes, wherein the nucleotide sequences of the primer pairs for detecting the methylation level of region 1 are SEQ ID NO:9 and SEQ ID NO:10, and the nucleotide sequence of the detection probe is SEQ ID NO:11; The nucleotide sequences of the primer pair used to detect the methylation level of region 2 are SEQ ID NO:12 and SEQ ID NO:13, and the nucleotide sequence of the detection probe is SEQ ID NO:14; The nucleotide sequences of the primer pair used to detect the 3-methylation level of the region are SEQ ID NO:15 and SEQ ID NO:16, and the nucleotide sequence of the detection probe is SEQ ID NO:17; The nucleotide sequences of the primer pair used to detect the methylation level in region 4 are SEQ ID NO:18 and SEQ ID NO:19, and the nucleotide sequence of the detection probe is SEQ ID NO:

20.

2. The reagent kit according to claim 1, characterized in that, The kit also includes one or more of the following: PCR reaction reagents, methylation conversion reagents, DNA extraction reagents, and DNA purification reagents.

3. The use of the kit according to any one of claims 1-2 in the preparation of liver cancer diagnostic products.

4. The application according to claim 3, characterized in that, The liver cancer mentioned includes stages 0 and A of the Barcelona Clinical Stages of Liver Cancer.

Images