SPANXB1 gene inhibitors, their preparation methods and uses

Abstract

This invention relates to the field of molecular biology, and particularly to a SPANXB1 gene inhibitor, its preparation method, and its uses. This invention provides the use of the SPANXB1 gene inhibitor in the preparation of tumor therapeutic products. The SPANXB1 gene inhibitor provided by this invention has a suitable RNAi target sequence and an oligo DNA double-stranded sequence designed for the target gene, and a lentiviral vector plasmid containing the above-mentioned oligo DNA double-stranded sequence and the final lentivirus are constructed. The resistance gene carried in the lentivirus can effectively reduce the mRNA expression level of the target gene SPANXB1, with a very significant knockdown effect. It has a high inhibitory efficiency on the cell proliferation and migration of cholangiocarcinoma cells and can be used in drugs for the treatment of cholangiocarcinoma. Furthermore, this invention is high-throughput and highly reproducible.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to SPANXB1 gene inhibitors, their preparation methods, and uses. Background Technology

[0002] Cholangiocarcinoma is one of the most common malignant tumors with high morbidity and mortality rates, posing a serious threat to patients' health. In my country, the incidence of cholangiocarcinoma has been rising year by year over the past decade. Although the level of early diagnosis and treatment of cholangiocarcinoma has greatly improved, patients with advanced cholangiocarcinoma still face the risk of recurrence after prognosis. Therefore, the treatment of cholangiocarcinoma has always been a focus of medical research. Currently, the SPANX family member B1 gene (SPANXB1, NCBI Reference Sequence: NM-032461.4) has been confirmed to be closely related to the development of cholangiocarcinoma cells. Identifying the specific gene for cholangiocarcinoma, clarifying its expression status, and developing drug formulations targeting this gene are of great significance for effectively improving the treatment efficiency of cholangiocarcinoma and reducing the toxic side effects of drugs. Summary of the Invention

[0003] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a SPANXB1 gene inhibitor, its preparation method and uses, in order to solve the problem of the limited development of drug formulations targeting the SPANXB1 gene in the prior art.

[0004] To achieve the above and other related objectives, the present invention provides the use of SPANXB1 gene inhibitors in the preparation of tumor therapeutic products.

[0005] Preferably, the tumor is cholangiocarcinoma.

[0006] The present invention also provides a nucleic acid molecule that reduces the expression of the SPANXB1 gene in cholangiocarcinoma cells, wherein the nucleic acid molecule is a double-stranded RNA containing a nucleotide sequence as shown in any of SEQ ID NO: 4-6; or, a DNA encoding the shRNA containing a nucleotide sequence as shown in any of SEQ ID NO: 7-12.

[0007] The present invention also provides a SPANXB1 gene interference nucleic acid construct, wherein the nucleic acid construct contains a gene fragment encoding a double-stranded RNA in the aforementioned nucleic acid molecule or a gene fragment encoding a DNA nucleotide sequence such as any one of SEQ ID NO. 7-12 that encodes the shRNA.

[0008] The present invention also provides a SPANXB1 gene interference lentivirus, which is prepared by viral packaging of the aforementioned SPANXB1 gene interference nucleic acid construct with the assistance of lentivirus packaging plasmids and cell lines.

[0009] The present invention also provides a cell line, wherein the cell line is a cell line infected with the aforementioned gene-interference lentivirus.

[0010] The present invention provides a composition for treating cholangiocarcinoma, the active ingredient of which comprises: the aforementioned nucleic acid molecule; and / or, the aforementioned SPANXB1 gene interference nucleic acid construct; and / or, the aforementioned SPANXB1 gene interference lentivirus; and / or, the aforementioned cell line; and / or, a cholangiocarcinoma chemotherapeutic agent and a pharmaceutically acceptable carrier or excipient.

[0011] As described above, the SPANXB1 gene inhibitor, its preparation method, and its uses of the present invention have the following beneficial effects:

[0012] This invention provides a SPANXB1 gene inhibitor for cholangiocarcinoma. A suitable RNAi target sequence and oligo DNA double-stranded sequence were designed for the target gene, and a lentiviral vector plasmid containing the aforementioned oligo DNA double-stranded sequence and the resulting lentivirus were constructed. The resistance gene carried in the lentivirus can effectively reduce the mRNA expression level of the target gene SPANXB1, with a very significant knockdown effect. It has a high inhibitory efficiency on the cell proliferation and migration of cholangiocarcinoma cells and can be used in drugs for the treatment of cholangiocarcinoma. Furthermore, this invention can simultaneously or in batches infect different renal cell carcinoma lines, all of which can achieve good knockdown and therapeutic effects, with high reproducibility. Attached Figure Description

[0013] Figure 1 The image shows the background expression level of the SPANXB1 gene in different cells (HIBEC, HUCCT1, HCCC-9810, RBE) detected by the RT-PCR method in this invention.

[0014] Figure 2 The image shows the expression level of the SPANXB1 gene in HCCC-9810 cells infected with the lentiviruses of Examples 1-3, as detected by the RT-PCR method of this invention.

[0015] Figure 3 The figure shows the fold change in cell growth of HCCC-9810 cells after lentivirus infection in Example 2 of this invention, measured by the cell counting method.

[0016] Figure 4 The figure shows the cell migration rate of HCCC-9810 cells infected with lentivirus in Example 2, as detected by the scratch assay in this invention.

[0017] Figure 5The figure shows the number of migrating cells in HCCC-9810 cells infected with lentivirus in Example 2 after 16 hours of culture, as measured by the Transwell assay in this invention. Detailed Implementation

[0018] This invention provides the use of SPANXB1 gene inhibitors in the preparation of tumor treatment products.

[0019] In some specific embodiments, the tumor is cholangiocarcinoma.

[0020] In this invention, gene inhibitors refer to molecules that have an inhibitory effect on genes. Inhibitory effects on genes include, but are not limited to, inhibiting gene expression or activity. Taking the SPANXB1 gene as an example, a SPANXB1 gene inhibitor refers to a molecule that has an inhibitory effect on SPANXB1, meaning that the target gene of a SPANXB1 gene inhibitor is SPANXB1. Inhibitory effects on SPANXB1 include, but are not limited to, inhibiting SPANXB1 expression or activity.

[0021] Inhibiting gene activity refers to reducing gene activity and thus decreasing the gene's biological function. Preferably, the gene activity is reduced by at least 10% compared to before inhibition, for example, at least 30%, 50%, 70%, or 90%.

[0022] Suppressing gene expression can be done by suppressing gene transcription or translation. Specifically, it can mean preventing gene transcription, reducing gene transcriptional activity, preventing gene translation, or reducing gene translation level.

[0023] Those skilled in the art can use conventional methods to regulate gene expression, such as gene knockout, homologous recombination, and interfering RNA.

[0024] The inhibition of gene expression can be verified by detecting expression levels using PCR and Western blotting.

[0025] Preferably, compared with the wild type, gene expression is reduced by at least 10%, more preferably by at least 30%, even more preferably by at least 50%, even better by at least 70%, even better by at least 90%, and most preferably by no gene expression at all.

[0026] The tumor treatment product must include gene inhibitors, and use gene inhibitors as the effective ingredient for the aforementioned effects.

[0027] In the product, the effective ingredient that performs the aforementioned function may be only a gene inhibitor, or it may contain other molecules that can perform the aforementioned function.

[0028] That is, the gene inhibitor is the only active ingredient or one of the active ingredients in the product.

[0029] The product can be a single-component substance or a multi-component substance.

[0030] The product is primarily targeted at mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.

[0031] The tumor treatment product is a tumor treatment drug or an enhancer of a tumor chemotherapy drug. The product is a pharmaceutical product. The dosage form of the pharmaceutical product is not specifically limited; for example, it may be an oral preparation or an injection. The pharmaceutical product may be a sustained-release preparation.

[0032] The gene inhibitor can be a nucleic acid molecule, polypeptide, protein, small molecule, or virus.

[0033] In one embodiment, the gene inhibitor may be a nucleic acid molecule that reduces gene expression in cholangiocarcinoma cells.

[0034] The nucleic acid molecule is selected from one or more of the following: antisense oligonucleotides, RNA aptamers, ribozymes targeting genes or their receptor polypeptides, nucleic acid constructs, double-stranded RNA (dsRNA), or short hairpin RNA (shRNA).

[0035] The double-stranded RNA contains nucleotide sequences that can hybridize with genes.

[0036] The shRNA contains nucleotide sequences that can hybridize with genes.

[0037] Furthermore, the double-stranded RNA comprises a first strand and a second strand, which are complementary to form an RNA dimer, and the sequence of the first strand is substantially the same as the target sequence in the target gene (e.g., the SPANXB1 gene).

[0038] The target sequence in the target gene is the segment in the target gene corresponding to the mRNA segment that is recognized and silenced by the nucleic acid molecule.

[0039] Furthermore, the double-stranded RNA is a small interfering RNA (siRNA).

[0040] Furthermore, the target sequence of the double-stranded RNA as a SPANXB1 gene inhibitor is shown in any of SEQ ID NO: 1-3, specifically: SEQ ID NO: 1: AATGGGCCAACAATCCAGTGT, SEQ ID NO: 2: CAATGAGGCCAACAAGACGAT, SEQ ID NO: 3: AATACGACTGAAAGACCTAA. Even further, the double-stranded RNA comprises RNA with nucleotide sequences shown in any of SEQ ID NO: 4-6, specifically: SEQ ID NO: 4: AAUGGCCAACAAUCCAGUGU, SEQ ID NO: CAAUGAGGCCAACAAGACGAU, SEQ ID NO: 6: AAUAACGACUGAAAGACCUAA. Even further, the nucleotide sequence encoding the shRNA is shown in any of SEQ ID NO: 7-12.

[0041] The shRNA includes a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand and the antisense strand. The sequences of the sense strand and the antisense strand are complementary, and the sequence of the sense strand is substantially the same as the target sequence in the target gene (e.g., the SPANXB1 gene).

[0042] Furthermore, the target sequence of the shRNA that serves as a SPANXB1 inhibitor is shown in SEQ ID NO: 1-3.

[0043] The shRNA, after being processed by enzyme digestion, can become siRNA, which can then specifically silence the expression of endogenous target genes in bile duct cancer cells.

[0044] Furthermore, the stem-loop sequence of the shRNA can be selected from any of the following: UUCAAGAGA, UUCG, CCACC, CTCGAG, AAGCUU, or CCACACC.

[0045] Furthermore, the SPANXB1 gene is derived from humans.

[0046] In some specific embodiments, the virus is selected from lentiviruses, adenoviruses, or adeno-associated viruses.

[0047] The lentivirus is prepared by viral packaging of various gene interference nucleic acid constructs with the assistance of lentiviral packaging plasmids and cell lines. This lentivirus can infect cholangiocarcinoma cells and produce small interfering RNAs targeting corresponding genes (e.g., SPANXB1), thereby inhibiting the proliferation of cholangiocarcinoma cells.

[0048] The tumor treatment product of the present invention treats tumors by inhibiting the proliferation rate of bile duct cancer cells and / or inhibiting the migration of bile duct cancer cells.

[0049] Cell experiments have confirmed that gene inhibitors can significantly slow down the proliferation rate of bile duct cancer cells within 24 hours, and this trend becomes more pronounced over time.

[0050] This invention also provides a nucleic acid molecule for reducing the expression of a target gene in tumor cells, wherein the nucleic acid molecule is a double-stranded RNA with a nucleotide sequence as shown in any one of SEQ ID NO: 4-6; or, the nucleic acid molecule is shRNA, and the nucleotide sequence encoding the shRNA is as shown in any one of SEQ ID NO: 7-12. The target gene is selected from the SPANXB1 gene.

[0051] In some specific embodiments, the tumor cells are bile duct cancer cells.

[0052] The present invention also provides a SPANXB1 gene interference nucleic acid construct containing a gene fragment encoding a double-stranded RNA, shRNA, or DNA encoding shRNA in the aforementioned nucleic acid molecule, and capable of expressing the double-stranded RNA, shRNA, or DNA encoding shRNA.

[0053] The SPANXB1 gene interference nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human target gene double-stranded RNA, shRNA, or DNA encoding shRNA into a known vector. Taking the SPANXB1 gene interference nucleic acid construct as an example, the SPANXB1 gene interference nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human SPANXB1 gene double-stranded RNA, shRNA, or DNA encoding shRNA into a known vector.

[0054] Furthermore, the SPANXB1 gene interference nucleic acid construct is a SPANXB1 gene interference lentiviral vector.

[0055] Furthermore, the SPANXB1 gene-interfering lentiviral vector also contains a promoter sequence and / or a nucleotide sequence encoding a detectable marker in cholangiocarcinoma cells; preferably, the detectable marker is green fluorescent protein (GFP).

[0056] Furthermore, the lentiviral vector can be selected from: BR-V108, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pL KO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, Any of pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, and pGCSIL-GFP.

[0057] The siRNA of this invention can be used alone or in combination with other drugs to inhibit the proliferation of cholangiocarcinoma cells, and can further be used as a drug or preparation for treating cholangiocarcinoma. When used as a drug or preparation for treating cholangiocarcinoma, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skill of a skilled physician.

[0058] This invention also provides a SPANXB1 gene-interfering lentivirus, which is prepared by viral packaging of the aforementioned SPANXB1 gene-interfering nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line. This lentivirus can infect cholangiocarcinoma cells and produce small interfering RNA targeting the target gene, thereby inhibiting the proliferation of cholangiocarcinoma cells.

[0059] In some specific embodiments, the lentiviral packaging plasmid is selected from psPAX2 vector plasmid and pMD2.G vector plasmid; the cell line is 293 cells or 293T cells.

[0060] Furthermore, the mass ratio of the SPANXB1 gene interference lentiviral vector: psPAX2 vector plasmid: pMD2.G vector plasmid is (7-13): (5-10): (2:8).

[0061] The present invention also provides a cell line, which is a cell line infected with the SPANXB1 gene-interfering lentivirus.

[0062] In some specific embodiments, the cell line is selected from one or more of 293, 293T, HUCCT1, HCCC-9810, and RBE.

[0063] The present invention also provides a composition for treating tumors, wherein the active ingredient comprises:

[0064] The aforementioned nucleic acid molecules; and / or, the aforementioned SPANXB1 gene-interfering nucleic acid constructs; and / or, the aforementioned SPANXB1 gene-interfering lentiviruses; and / or, the aforementioned cell lines; and / or tumor chemotherapy drugs and pharmaceutically acceptable carriers or excipients.

[0065] The composition for treating tumors is a composition for treating cholangiocarcinoma.

[0066] The composition may be a pharmaceutical composition.

[0067] When the composition is used for the prevention or treatment of cholangiocarcinoma in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the cholangiocarcinoma are inhibited. Furthermore, at least 10%–30%, 30%–50%, 50%–70%, 70%–90%, and 90%–100% of the growth, proliferation, recurrence, and / or metastasis of the cholangiocarcinoma are inhibited.

[0068] The composition is not particularly limited in form and can be in various forms such as solid, liquid, gel, semi-fluid, or aerosol.

[0069] The composition is primarily intended for use with mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.

[0070] The present invention also provides a method for treating cholangiocarcinoma, comprising administering an effective dose of the tumor treatment product to a subject.

[0071] In one embodiment, the tumor is cholangiocarcinoma. The tumor treatment product is a cholangiocarcinoma treatment product. Further, when the drug is used to prevent or treat cholangiocarcinoma in a subject, an effective dose of the drug needs to be administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the cholangiocarcinoma are inhibited. Further, at least 10%–30%, 30%–50%, 50%–70%, 70%–90%, and 90%–100% of the growth, proliferation, recurrence, and / or metastasis of the cholangiocarcinoma are inhibited.

[0072] The object of the method can be a person.

[0073] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0074] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0075] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0076] Example 1: Preparation of Lentiviral shSPANXB1-1

[0077] This embodiment provides a lentivirus for cholangiocarcinoma, wherein the RNAi target sequence of the lentivirus has a fragment coding sequence of SEQ ID NO.1: AATGGGCCAACAATCCAGTGT.

[0078] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:

[0079] (1) Select a tool vector to obtain the target gene fragment;

[0080] BR-V108 was selected as the tool vector (purchased from Shanghai Yibeirui Biomedical Technology Co., Ltd.), and the core sequence of the target gene fragment is SEQ ID NO.1: AATGGGCCAACAATCCAGTGT.

[0081] (2) Synthesize single-stranded primers and oligo DNA;

[0082] In step (2), the single-stranded primer contains the following sequence:

[0083] SEQ ID NO.7:

[0084] 5'-ccggAATGGGCCAACAATCCAGTGTctcgagACACTGGATTGTTGGCCCATTtttttg-3' and

[0085] SEQ ID NO.8:

[0086] 5'-aattcaaaaaAATGGGCCAACAATCCAGTGTctcgagACACTGGATTGTTGGCCCATT-3'.

[0087] The primers are annealed to form oligo DNA, which contains the following sequence:

[0088] Upstream chain: SEQ ID NO.7:

[0089] 5'-ccggAATGGGCCAACAATCCAGTGTctcgagACACTGGATTGTTGGCCCATTtttttg-3';

[0090] Downstream chain: SEQ ID NO:

[0091] 5'-aattcaaaaaAATGGGCCAACAATCCAGTGTctcgagACACTGGATTGTTGGCCCATT-3'.

[0092] The annealing system was: 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water; the annealing temperature was: 95℃ for 5 min in a PCR instrument; 95℃ for 40 s; decrease by 0.7℃ every 40 s, for 99 cycles; 25℃ for 3 min; and store at 8℃.

[0093] (3) The oligo DNA was ligated into a linearized tool vector and then transformed;

[0094] The tool vector was first digested with EcoRI and AgeI. The digestion system consisted of 16 μL ultrapure water + 30 μL 10×CutSmart Buffer (manufacturer: NEB component catalog number: B6004SVIAL) + 12 μL purified plasmid DNA, i.e., BR-V108 vector (1 μg / μL) + 1 μL AgeI (10 U / μL) + 1 μL EcoRI (10 U / μL). The reaction was carried out at 37℃ for 3 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0095] The enzyme-digested tool vector was reacted with oligo DNA in a reaction system at 22°C for 1 hour. The reaction system was as follows:

[0096] 1. 50 ng of enzyme-digested tool vector

[0097] 2.2ul oligo DNA

[0098] 3. 0.5μL T4 DNA ligase (EL0011, ThermoFisher)

[0099] 4. 2μL 10×T4 DNAligase Buffer (EL0011, ThermoFisher)

[0100] 5. Ultrapure water (to a total volume of 20 μL).

[0101] 10 μL of ligation product was added to 100 μL of competent cells (GTC-BC-G001) and thawed on ice. The cells were then placed on ice for 1 min. The cells were then heat-shocked in a 42°C water bath for 40 s and placed on ice for 2 min. 200 μL of antibiotic-free LB liquid medium was added and the cells were shaken at 37°C at 200 rpm for 1 h. 150 μL of the bacterial culture was evenly spread on LB solid medium containing ampicillin (Amp) resistance and incubated at 37°C for 14 h.

[0102] (4) Colony PCR identification, sequencing, and plasmid extraction;

[0103] In the colony PCR identification, the sequence of primer-F is SEQ ID NO.13:

[0104] The primer-R sequence for identification is SEQ ID NO. 14: CCTATTTCCCATGATTCCTTCATA.

[0105] GTAATACGGTTATCCACGCG; The PCR reaction system is: 10ul 2×Hieff HotStart PCRMaster Mix (With Dye) (Manufacturer: Yisheng, Product No.: 10732ES03) + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a final volume of 20 μL). PCR amplification conditions: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, take 5 μL of product and detect the bands by 1% agarose gel electrophoresis (electrophoresis loading: blank control uses ultrapure water as template; negative control uses an empty vector without the target gene inserted as template).

[0106] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.

[0107] The correctly sequenced bacterial culture was transferred to 150 ml of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.

[0108] 1. Cell enrichment: Take 10 mL of bacterial suspension, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells; 2. Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube; 3. Termination of lysis: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000 rpm for 1 min; Remove the waste liquid in the collection tube; 4. Washing: Add 0.5 mL of GPW Buffer, centrifuge at 12000 rpm for 1 min; 5. Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; 6. Stabilization: Place the centrifuge tube containing the recovery solution in a 37℃ incubator for 15 min.

[0109] The lentivirus was prepared by co-transfecting 293T cells with the aforementioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid.

[0110] The preparation steps of the lentivirus are as follows: (1) 16 hours before transfection, 293T cells (ATCC ACS-4500) in logarithmic growth phase are digested with trypsin, and the cell density is adjusted to about 5×10⁻⁶ cells with medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%–80%.

[0111] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;

[0112] (3) Add DNA solution (10 μg lentiviral vector plasmid, 7.5 μg pMD2.G vector plasmid, and 5 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of transfection reagent Polybrene (manufacturer: Santa Cruz Biotechnology, catalog number: sc-134220A) to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.

[0113] (4) Add the mixture dropwise to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for culture; after 6 hours, replace with 10 mL of 10% FBS medium and continue to culture in a 37℃, 5% CO2 incubator for 60 hours.

[0114] (5) Collect cell supernatant 48h and 72h after transfection.

[0115] Example 2: Preparation of lentivirus shSPANXB1-2

[0116] This embodiment provides a lentivirus for cholangiocarcinoma, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence: SEQ ID NO.2: CAATGAGGCCAACAAGACGAT.

[0117] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:

[0118] (1) Select a tool vector to obtain the target gene fragment;

[0119] BR-V108 was selected as the tool vector, and the core sequence of the target gene fragment is CAATGAGGCCAACAAGACGAT.

[0120] (2) Synthesize single-stranded primers and oligo DNA;

[0121] In step (2), the single-stranded primer contains the following sequence:

[0122] SEQ ID NO.9:

[0123] 5'-ccggCAATGAGGCCAACAAGACGATctcgagATCGTCTTGTTGGCCTCATTGtttttg-3' and SEQID NO.10:

[0124] 5'-aattcaaaaaCAATGAGGCCAACAAGACGATctcgagATCGTCTTGTTGGCCTCATTG-3'.

[0125] The primers are annealed to form oligo DNA, which contains the following sequence:

[0126] Upstream chain: SEQ ID NO:

[0127] 5'-ccggCAATGAGGCCAACAAGACGATctcgagATCGTCTTGTTGGCCTCATTGtttttg-3';

[0128] Downstream chain: SEQ ID NO.10:

[0129] 5'-aattcaaaaaCAATGAGGCCAACAAGACGATctcgagATCGTCTTGTTGGCCTCATTG-3'.

[0130] The annealing system was: 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water; the annealing temperature was: 95℃ for 5 min in a PCR instrument; 95℃ for 50 s, 25℃ for 3 min, for 99 cycles; and stored at 8℃.

[0131] (3) The oligo DNA was ligated into a linearized tool vector and then transformed;

[0132] The tool vector was first digested with enzymes at EcoRI and AgeI. The digestion system consisted of 255 μL ultrapure water, 30 μL 10×CutSmart Buffer, 12 μL purified plasmid DNA (1 μg / μL), 1 μL AgeI (10 U / μL), and 1 μL EcoRI (10 U / μL). The reaction was carried out at 37 °C for 2 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0133] The enzyme-digested vector and oligo DNA were reacted in a reaction system at 16°C for 3 hours. The reaction system was the same as in Example 1: 1 μL Linearized Vector (100 ng / μL) + 1 μL Insert (100 ng / μL) + 2 μL 10×T4 DNA ligase Buffer + 1 μL T4 DNA ligase + ultrapure water (to a total volume of 20 μL).

[0134] Thaw TOP10 competent cells on ice, add 20 μL of ligation product to 200 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 5 min; add 200 μL of antibiotic-free LB liquid medium, and shake in a shaker at 37℃ at 200 rpm for 1 h; take 150 μL of bacterial culture and spread it evenly on LB solid medium containing Amp resistance, and incubate in a 37℃ incubator for 16 h.

[0135] (4) Colony PCR identification, sequencing, and plasmid extraction;

[0136] In the colony PCR identification, the sequence of primer-F is SEQ ID NO.13:

[0137] The primer-R sequence for identification is SEQ ID NO. 14: CCTATTTCCCATGATTCCTTCATA.

[0138] GTAATACGGTTATCCACGCG; The PCR reaction system was the same as in Example 1: 0.2 μL Taq Plus DNA Polymerase + 2 μL 10× Buffer + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a total volume of 20 μL). The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, 5 μL of the product was taken and the bands were detected by 1% agarose gel electrophoresis (electrophoresis loading: blank control: ultrapure water as template; negative control: empty vector without inserted target gene as template).

[0139] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.

[0140] The correctly sequenced bacterial culture was transferred to 150 mL of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.

[0141] 1. Cell enrichment: Take 10 mL of bacterial suspension, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells; 2. Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube; 3. Termination of lysis: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000 rpm for 1 min; Remove the waste liquid in the collection tube; 4. Washing: Add 0.5 mL of GPW Buffer, centrifuge at 12000 rpm for 1 min; 5. Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; 6. Stabilization: Place the centrifuge tube containing the recovery solution in a 37℃ incubator for 15 min.

[0142] The lentivirus was prepared by co-transfecting 293T cells with the above-mentioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid, as in Example 1.

[0143] The preparation steps of the lentivirus are as follows: (1) 18 hours before transfection, 293T cells in logarithmic growth phase are digested with trypsin and the cell density is adjusted to about 4.5 × 10⁻⁶ cells with medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 80%.

[0144] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;

[0145] (3) Add DNA solution (12 μg lentiviral vector plasmid, 9 μg pMD2.G vector plasmid, and 7 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of Eberspächer transfection reagent DYB3893 to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.

[0146] (4) Add the mixture dropwise to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for culture; after 6 hours, replace with 10 mL of 10% FBS medium and continue to culture in a 37℃, 5% CO2 incubator for 60 hours.

[0147] (5) Collect cell supernatant 48h and 72h after transfection.

[0148] Example 3: Preparation of lentivirus shSPANXB1-3

[0149] This embodiment provides a lentivirus for cholangiocarcinoma, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence: SEQ ID NO.3: AATACGACTGAAAGACCTAA.

[0150] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:

[0151] (1) Select a tool vector to obtain the target gene fragment;

[0152] BR-V108 was selected as the tool vector, and the core sequence of the target gene fragment is AATACGACTGAAAGACCTAA.

[0153] (2) Synthesize single-stranded primers and oligo DNA;

[0154] In step (2), the single-stranded primer contains the following sequence:

[0155] SEQ ID NO.11:

[0156] 5'-ccggAATAACGACTGAAAGACCTAActcgagTTAGGTCTTTCAGTCGTTATTtttttg-3' and SEQID NO.12:

[0157] 5'-aattcaaaaaAATAACGACTGAAAGACCTAActcgagTTAGGTCTTTCAGTCGTTATT-3'.

[0158] The primers are annealed to form oligo DNA, which contains the following sequence:

[0159] Upstream chain: SEQ ID NO.11:

[0160] 5'-ccggAATAACGACTGAAAGACCTAActcgagTTAGGTCTTTCAGTCGTTATTtttttg-3';

[0161] Downstream chain: SEQ ID NO.12:

[0162] 5'-aattcaaaaaAATAACGACTGAAAGACCTAActcgagTTAGGTCTTTCAGTCGTTATT-3'.

[0163] The annealing system was: 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water; the annealing temperature was: 95℃ for 5 min in a PCR instrument; 95℃ for 50 s, 25℃ for 3 min, for 99 cycles; and stored at 8℃.

[0164] (3) The oligo DNA was ligated into a linearized tool vector and then transformed;

[0165] The tool vector was first digested with enzymes at EcoRI and AgeI sites. The digestion system was the same as in Example 1: 255 μL ultrapure water + 30 μL 10×CutSmart Buffer + 12 μL purified plasmid DNA (1 μg / μL) + 1 μL AgeI (10 U / μL) + 1 μL EcoRI (10 U / μL). The reaction was carried out at 37°C for 2 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0166] The enzyme-digested vector plasmid and oligo DNA were reacted in a reaction system at 16°C for 1 h. The reaction system was the same as in Example 1: 1 μL Linearized Vector (100 ng / μL) + 1 μL Insert (100 ng / μL) + 2 μL 10×T4 DNA ligase Buffer + 1 μL T4 DNA ligase + ultrapure water (to a total volume of 20 μL).

[0167] Thaw TOP10 competent cells on ice, add 20 μL of ligation product to 200 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 2 min; add 200 μL of antibiotic-free LB liquid medium, and shake in a 37℃ incubator at 200 rpm for 45 min; take 150 μL of bacterial culture and spread it evenly on LB solid medium containing Amp resistance, and incubate in a 37℃ incubator for 12 h.

[0168] (4) Colony PCR identification, sequencing, and plasmid extraction;

[0169] In the colony PCR identification, the sequence of primer-F is SEQ ID NO.13:

[0170] The primer-R sequence for identification is SEQ ID NO. 14: CCTATTTCCCATGATTCCTTCATA.

[0171] GTAATACGGTTATCCACGCG; The PCR reaction system was the same as in Example 1: 0.2 μL Taq Plus DNA Polymerase + 2 μL 10× Buffer + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a total volume of 20 μL). The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, 5 μL of the product was taken and the bands were detected by 1% agarose gel electrophoresis (electrophoresis loading: blank control: ultrapure water as template; negative control: empty vector without inserted target gene as template).

[0172] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.

[0173] The correctly sequenced bacterial culture was transferred to 150 ml of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.

[0174] 1. Cell enrichment: Take 10 mL of bacterial suspension, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells; 2. Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube; 3. Termination of lysis: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000 rpm for 1 min; Remove the waste liquid in the collection tube; 4. Washing: Add 0.5 mL of GPW Buffer, centrifuge at 12000 rpm for 1 min; 5. Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; 6. Stabilization: Place the centrifuge tube containing the recovery solution in a 37℃ incubator for 15 min.

[0175] The lentivirus was prepared by co-transfecting 293T cells with the aforementioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid.

[0176] The preparation steps of the lentivirus are as follows: (1) 12 hours before transfection, 293T cells in logarithmic growth phase are digested with trypsin and the cell density is adjusted to about 6×10⁻⁶ cells with medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%.

[0177] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;

[0178] (3) Add DNA solution (10 μg lentiviral vector plasmid, 8 μg pMD2.G vector plasmid, and 6 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of Eberspächer transfection reagent DYB3893 to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.

[0179] (4) Add the mixture dropwise to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for culture; after 6 hours, replace with 10 mL of 10% FBS medium and continue to culture in a 37℃, 5% CO2 incubator for 48 hours.

[0180] (5) Collect cell supernatant 48h and 72h after transfection.

[0181] Example 4: SPANXB1 virus knockdown experiment

[0182] shCtrl: Normal target cell group (control group) infected with negative control lentivirus: Lentiviral vector plasmid composed of elements other than the transfected sequence, virus packaged and cell transfected in the same way, resulting in the control transfected group cells;

[0183] shSPANXB1-1, shSPANXB1-2, and shSPANXB1-3 correspond to the normal target cell groups (experimental groups) infected with RNAi lentiviruses in Examples 1-3, respectively.

[0184] Real-time qPCR was used to detect the expression level of the target gene SPANXB1: After total RNA extraction according to the Trizol procedure of Sigma, 4X gDNA wiper mix and 1.0 μg total RNA were added to a PCR tube, and RNase-free H2O was added to 8 μL. After mixing, the mixture was centrifuged and incubated at 42℃ for 2 min. 5X Hiscript QRT supermix for qPCR (+gDNA WIPER) (manufacturer: Vazyme, catalog number: R123-01) was added, and reverse transcription was performed at 55℃ for 15 min and 85℃ for 2 min. The obtained cDNA was stored at -80℃ for later use. The real-time qPCR reaction system was as follows: 5.0 μL 2×AceQ qPCRSYBR Green Master Mix (manufacturer: Vazyme, catalog number: Q111-02) + 0.25 μL upstream primer (10 μmol / L, sequence SEQ ID NO.15: AATGAGGCCAACAAGACGATG) + 0.25 μL downstream primer (10 μmol / L, sequence SEQ ID NO.16: CTCCTCCATTTGGTCGGGG) + 0.2 μL Dye2 (Qihengxing, FS-Q1001) + 2.0 μL cDNA + 2.3 μL L Nase-Free H2O; via 2 －△△ Ct assay was used to analyze mRNA expression levels; the expression results of the SPANXB1 gene in different cells are shown in [the table below]. Figure 1 Compared to HIBEC cells, the expression level of the SPANXB1 gene was higher in HUCCT1, HCCC-9810, and RBE cells. The effects of HCCC-9810 cell infection on SPANXB1 expression in Examples 1-3 are shown below. Figure 2 ,from Figure 2 As can be seen from the results, in HCCC-9810 cells, after infection with lentivirus, compared with the shCtrl group, the SPANXB1 gene knockdown efficiency of Example 1 (shSPANXB1-1 group) reached 51% (p<0.05); the SPANXB1 gene knockdown efficiency of Example 2 (shSPANXB1-2 group) reached 71% (p<0.05); and the expression level of SPANXB1 gene in Example 3 (shSPANXB1-3 group) showed no significant change (p>0.05).

[0185] Example 5: Bile duct cancer cell growth experiment

[0186] After passage, HCCC-9810 cells in the logarithmic growth phase were trypsinized to prepare a cell suspension. The cell suspension (approximately 1500-2500 cells) was then seeded in 96-well incubators at 37°C with 5% [presumably a specific incubation method]. Cells were cultured in a CO2 incubator until the confluence reached approximately 20-30%. Based on the cell MOI value, an appropriate amount of virus was added. After 12 hours, the cell status was observed, and the culture medium was replaced. Two to three days after infection, the expression of the reporter gene GFP on the lentivirus was observed. When the fluorescence rate reached approximately 80%, the cells were cultured further until the confluence reached 70%-90%, and the cells were collected. Cells in the logarithmic growth phase of each experimental group were trypsinized and resuspended in complete culture medium to form a cell suspension, which was then counted. The cell density for plating was determined based on cell size (set to 2000 cells / well). Cells were cultured at 37°C in a 5% CO2 incubator, with three replicates per group and a culture volume of 100 μL / well, ensuring a consistent number of cells in each well. Celigo assays were performed daily for five consecutive days, starting the second day. By adjusting the input parameters in the analysis settings, the number of cells with green fluorescence in each scan was accurately calculated. The data were statistically analyzed and plotted to create a 5-day cell proliferation curve. Five days after lentivirus infection of the target cells, the curves showing the fold change in cell number over time in Example 2 and the control group are as follows: Figure 3 After lentiviral infection, compared with the shCtrl group, the cell proliferation of Example 2, i.e., the shSPANXB1 group, was significantly inhibited, with a fold change of -1.8 (p<0.05).

[0187] Example 6: Bile duct cancer cell migration rate experiment

[0188] After passage, HCCC-9810 cells in the logarithmic growth phase were digested with trypsin to prepare a cell suspension; the cell suspension (approximately 5 × 10⁶ cells) was then further processed. 4 -1×10 5Cells were inoculated into 12-well plates and cultured at 37°C in a 5% CO2 incubator until the cell confluence reached approximately 20-30%. Based on the cell MOI, an appropriate amount of virus was added. Cell status was observed after 8-12 hours, and the culture medium was changed. 2-3 days after infection, the expression of the reporter gene GFP on the lentivirus was observed. When the fluorescence rate reached approximately 80%, the cells were cultured further until the confluence reached 70%-80%, and the cells were collected. Cells in the logarithmic growth phase of each experimental group were trypsinized and resuspended in complete culture medium to form a cell suspension, and the cells were counted. The cell density for plating was determined based on cell size (set to 50,000 cells / well), with a target of over 90% confluence the following day. Cells were cultured at 37°C in a 5% CO2 incubator, with 3 replicates per group and a culture volume of 100 μL / well. On the second day, the medium was changed to a low-concentration serum medium. A scratcher was used to gently push upwards from the center of the bottom of the 96-well plate to form a scratch. The cells were gently rinsed twice with serum-free medium, and then low-concentration serum medium (0.5%) was added. FBS), photographed at 0h; incubated at 37℃ in a 5% CO2 incubator; scanned the plate with Cellomics at an appropriate time according to the degree of healing, and analyzed the migration area with Cellomics. The test results of Example 2 are as follows. Figure 4 Following lentiviral infection, compared to the shCtrl group, the cell migration rate in Example 2, i.e., the shSPANXB1 group, decreased by 56% at 64 hours (p<0.05).

[0189] Example 7: Transwell Experiment of Bile Duct Cancer Cells

[0190] Cell Transwell Experiment: (1) After infecting 786-O cells with the lentivirus prepared in Example 2, take the required number of chambers into an empty 24-well plate, add 100 μL of serum-free culture medium into the chamber, and incubate for 1-2 hours; (2) Prepare cell suspension: digest each group of HCCC-9810 cells in the logarithmic growth phase with trypsin, resuspend in low serum culture medium to prepare cell suspension; count cells in the cell suspension using a hemocytometer; (3) After completing step (1), carefully remove the culture medium from the chamber, add 600 μL of culture medium containing 30% FBS into the lower chamber, and incubate with serum-free culture medium. Cells were diluted with culture medium at a certain ratio, and 100 μL of the cell suspension (containing 100,000–200,000 cells) was added to each chamber. The chambers were then transferred to the lower chamber containing 30% FBS culture medium using forceps. The chambers were incubated in a tissue culture incubator for 20 hours. The chambers were then inverted onto absorbent paper to remove the culture medium. Non-transferred cells were gently removed with a cotton swab. 400 μL of staining solution was added to the wells of a 24-well plate. The chambers were immersed in the staining solution for 5 minutes to stain the lower surface of the membrane with transferred cells. The chambers were then immersed in a large glass of water, rinsed several times, and air-dried. The membrane was photographed under a microscope. The comparison of the number of transferred cells between the experimental group and the control group after 16 hours of incubation in Transwell chambers in Example 2 is shown below. Figure 5 Following lentivirus infection, compared to the shCtrl group, the Transwell transfer rate in Example 2, i.e., the shSPANXB1 group, was reduced by 73% (p<0.05).

[0191] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. The use of SPANXB1 gene inhibitors in the preparation of products for the treatment of cholangiocarcinoma; The bile duct cancer treatment product is an oncology treatment drug; the SPANXB1 gene inhibitor is a nucleic acid molecule that reduces the expression of the SPANXB1 gene in bile duct cancer cells or a SPANXB1 gene-interfering lentivirus. The SPANXB1 gene-interfering lentivirus contains the nucleic acid molecule that reduces SPANXB1 gene expression in cholangiocarcinoma cells. The nucleic acid molecule is selected from one or more of double-stranded RNA or shRNA; The nucleotide sequence of the double-stranded RNA is shown in any one of SEQ ID NO: 4-5; The nucleotide sequence encoding the shRNA is shown in any of SEQ ID NO.7-10.

2. A nucleic acid molecule that reduces SPANXB1 gene expression in cholangiocarcinoma cells, characterized in that, The nucleic acid molecule is a double-stranded RNA with a nucleotide sequence as shown in any of SEQ ID NO: 4-5; or, the nucleic acid molecule is shRNA, and the nucleotide sequence encoding the shRNA is as shown in any of SEQ ID NO: 7-10.

3. A SPANXB1 gene interference nucleic acid construct, characterized in that, The nucleic acid construct contains a gene fragment encoding a double-stranded RNA in the nucleic acid molecule of claim 2 or a gene fragment encoding a shRNA in the nucleic acid molecule of claim 2.

4. A SPANXB1 gene-interfering lentivirus, characterized in that, The SPANXB1 gene interference nucleic acid construct described in claim 3 is prepared by viral packaging with the assistance of lentiviral packaging plasmids and cell lines.

5. The SPANXB1 gene-interfering lentivirus according to claim 4, characterized in that, The lentiviral packaging plasmid is selected from psPAX2 vector plasmid and pMD2.G vector plasmid; and / or, the cell line is 293 cells or 293T cells.

6. The SPANXB1 gene-interfering lentivirus according to claim 5, characterized in that, The mass ratio of the SPANXB1 gene interference nucleic acid construct according to claim 3: psPAX2 vector plasmid: pMD2.G vector plasmid is (7-13):(5-10):(2:8).

7. A cell line, characterized in that, The cell line is a cell line infected with the SPANXB1 gene-interference lentivirus as described in any one of claims 4-6.

8. A composition for treating cholangiocarcinoma, characterized in that, Its active ingredient contains: the nucleic acid molecule of claim 2; and / or the SPANXB1 gene interference nucleic acid construct of claim 3; and / or the SPANXB1 gene interference lentivirus of any one of claims 4-6; and / or the cell line of claim 7; and a pharmaceutically acceptable carrier or excipient.

Images