The application discloses a grape transcription factor VvMYB108, a coding gene thereof and a recombinant vector and application of the grape transcription factor VvMYB108 in improving cold resistance of plants

CN117384264BActive Publication Date: 2026-09-25QINGDAO AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311100091.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-29
Publication Date
2026-09-25
Estimated Expiration
2043-08-29

AI Technical Summary

Technical Problem

但近年来寒潮、倒春寒和霜冻等极端低温天气出现频繁,很大程度限制了葡萄产业的发展

Benefits of technology

[0031]1、本发明首次提供一种葡萄转录因子VvMYB108,发现其参与植物对低温胁迫的应答,正向调控植物的抗寒性性能,可通过上调植物体内该基因的表达水平从而提高其抗寒性能。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117384264B_ABST
    Figure CN117384264B_ABST
Patent Text Reader

Abstract

The application discloses a grape transcription factor VvMYB108, a coding gene thereof, and application of a recombinant carrier in improving plant cold resistance, wherein a protein sequence of the grape transcription factor VvMYB108 is shown as SEQ ID NO. 2, and the recombinant carrier carries the grape transcription factor VvMYB108 or the coding gene. Based on the fact that the grape transcription factor VvMYB108 positively regulates plant cold resistance, the cold resistance of the plant can be improved by up-regulating the expression level of the gene in the plant. The application further provides a preparation method of a cold-resistant transgenic plant, which comprises the following steps: promoting the expression of the VvMYB108 gene in a target plant, and obtaining a plant with cold resistance superior to the target plant. The VvMYB108 gene provides a new gene resource for improvement of cold resistance of grape cultivars and selection of germplasm resources, and provides a new application value for promoting grape industry upgrading and transformation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of a grape transcription factor VvMYB108, its encoding gene, and recombinant vector in improving the cold resistance of plants. Background Technology

[0002] Low temperature stress, as one of the most significant abiotic stresses, affects plant growth and development and the geographical distribution of plant species. Damage caused by low temperatures can be divided into chilling injury and frost damage. Damage caused by temperatures above 0°C is called chilling injury, while damage caused by temperatures below 0°C is called frost damage. When plants suffer chilling injury, the fluidity of cell membranes decreases, plasma membrane permeability increases, metabolic enzyme activity weakens, and metabolic disorders occur, ultimately affecting physiological processes such as photosynthesis and respiration, thus hindering plant growth and development. Frost damage is even more severe, ranging from mild damage to plant tissue structure, causing yellowing and wilting of leaves, to severe damage leading to plant death.

[0003] Grapes (Vitis vinifera L.) belong to the genus Vitis in the family Vitaceae. They possess high nutritional, medicinal, and economic value, and have promising economic prospects and development potential worldwide. Grapes thrive in warm, well-ventilated, and sunny environments and are sensitive to low temperatures. However, in recent years, extreme cold weather events such as cold waves, late spring frosts, and freezing temperatures have become frequent, significantly limiting the development of the grape industry. Therefore, researching grape genes related to low-temperature responses and cultivating cold-resistant varieties through genetic engineering is of great significance for solving the problems facing my country's grape industry.

[0004] Therefore, existing technologies need further improvement. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a grape transcription factor VvMYB108, its encoding gene, and a recombinant vector. It was found that transgenic grapes obtained by overexpressing this gene in grapes exhibit significantly increased cold resistance, and this gene can be used to improve the cold resistance of plants.

[0006] To achieve the above objectives, this application provides the following technical solution:

[0007] In a first aspect, this application provides the application of grape transcription factor VvMYB108 in improving the cold resistance of plants, the protein sequence of which is shown in SEQ ID NO.2.

[0008] The aforementioned amino acid sequences include those shown in SEQ ID NO: 2, as well as homologous sequences with 95% or more homology to the protein sequence. These sequences can be obtained by mutating the sequence shown in SEQ ID NO: 2 using existing techniques. The protein activity of these homologous sequences is the same as that of the protein with the sequence SEQ ID NO: 2.

[0009] To facilitate the purification or detection of the above proteins, a tag protein can be attached to the amino or carboxyl terminus of the protein composed of the amino acid sequence shown in SEQ ID No. 2.

[0010] The tag proteins include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein, etc.

[0011] Secondly, this application provides the application of the gene encoding the grape transcription factor VvMYB108 in improving the cold resistance of plants, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0012] The aforementioned gene sequence includes not only the sequence shown in SEQ ID NO: 1, but also homologous sequences with 95% or more homology to the gene sequence. These sequences can be obtained by mutating the sequence shown in SEQ ID NO: 1 using existing techniques. The proteins expressed by these homologous sequences have the same activity as the proteins expressed by the sequence SEQ ID NO: 1.

[0013] Furthermore, any nucleotides that have been artificially modified and have 95% or more of the same encoding nucleotide sequence as the protein VvMYB108 isolated in this invention, as long as the encoded protein function and activity are substantially the same, are all derived from the nucleotide sequence of this invention and are equivalent to the sequence of this invention.

[0014] The applicant cloned the aforementioned new gene VvMYB108 from grapes using plant gene cloning technology. Sequencing revealed that its nucleotide sequence is shown in SEQ ID NO.1, and the protein sequence it encodes is shown in SEQ ID NO.2.

[0015] The VvMYB108 gene contains a 987 bp open reading frame, encoding 328 amino acids. The molecular formula of VvMYB108 is C0.2956 H 4927 N 987 O 1214 S 223 The predicted molecular weight is 36 kDa, the isoelectric point is 5.07, and the instability coefficient is 47.05.

[0016] The relative expression levels of the VvMYB108 gene in grapes after different low-temperature treatment times and the differences in the relative expression levels of the VvMYB108 gene in different grape tissues and organs were analyzed by qRT-PCR. The results showed that VvMYB108 expression was upregulated by low temperature, with the highest expression level at 12 h, and significant expression levels in grape buds and mature leaves.

[0017] Furthermore, the phenotypes and related cold-resistance physiological indicators of VvMYB108-overexpressing transgenic plants (grape and Arabidopsis) before and after low-temperature treatment were analyzed. The results showed that under low-temperature stress, compared with the wild type, the VvMYB108-overexpressing transgenic plants exhibited a significantly higher low-temperature tolerance phenotype. Under normal conditions, there were no significant differences in physiological indicators between wild-type and VvMYB108-overexpressing transgenic plants; however, under low-temperature stress, the levels of MDA, H2O2, and O2 in the VvMYB108-overexpressing transgenic plants were significantly higher. 2·- The content of proline was significantly lower than that of wild type, while the content of proline was significantly higher than that of wild type. These results indicate that overexpression of VvMYB108 can reduce cell membrane lipid peroxidation in transgenic materials, regulate the accumulation of osmotic substances, and positively regulate the cold resistance of plants, thereby improving their cold resistance performance.

[0018] Thirdly, this application provides an application of a recombinant vector in improving the cold resistance of plants, wherein the recombinant vector carries the aforementioned grape transcription factor VvMYB108 or the aforementioned encoding gene.

[0019] The vectors described herein are known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, granules (i.e., Cosmids), Ti plasmids, or viral vectors. The plasmids are existing expression vectors such as pFGC or existing cloning vectors such as pMD19-T vectors, and are not limited to the specific types described in the embodiments of this application.

[0020] Recombinant expression vectors containing the MsRGP1 gene can be constructed using existing plant expression vectors. When constructing recombinant plant expression vectors using the MsRGP1 gene, any type of enhanced or constitutive promoter can be added before its transcription initiation nucleotide.

[0021] Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The translation control signals and start codons are widely available and can be natural or synthetic.

[0022] Fourthly, this application provides an application of a recombinant bacterium in improving the cold resistance of plants, wherein the recombinant bacterium is transformed with the aforementioned recombinant vector.

[0023] The recombinant bacteria used in this study can be bacteria, fungi, yeast, or algae. Among them, bacteria can be derived from genera such as *Escherichia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, they can be *Escherichia coli* DH5α and / or *Agrobacterium tumefaciens* GV3101.

[0024] Preferably, the plants are grapes and Arabidopsis thaliana. Subsequent embodiments use grapes and Arabidopsis thaliana as examples for experiments, but the plants are not limited to these two typical species.

[0025] Preferably, the cold resistance of plants is improved by upregulating the expression level of the VvMYB108 gene.

[0026] The upregulation of VvMYB108 gene expression is achieved by using gene overexpression technology (such as introducing an expression vector carrying the encoding gene into the target plant) to increase the expression level of VvMYB108 in the plant.

[0027] Based on the aforementioned function of grape transcription factors in positively regulating plant drought resistance, the grape cold-resistance gene VvMYB108 can be overexpressed in plants, thereby significantly improving the cold resistance of the resulting transgenic plants. The grape transcription factors, encoding genes, recombinant vectors, and recombinant bacterial construction described above can all be used to prepare the aforementioned VvMYB108 overexpressing transgenic plants.

[0028] Specifically, a plant overexpression vector for the VvMYB108 gene can be constructed, and the gene can be introduced into plants using Agrobacterium-mediated genetic transformation to obtain transgenic plants with VvMYB108. Biological functional verification shows that the VvMYB108 gene cloned in this invention has the function of improving plant cold resistance.

[0029] Fifthly, this application provides a method for cultivating a cold-resistant transgenic plant, wherein the method involves promoting the expression of the VvMYB108 gene in the target plant to obtain a plant with superior cold resistance compared to the target plant. Preferably, the cold-resistant transgenic plant is grape or Arabidopsis thaliana.

[0030] The present invention has the following beneficial effects:

[0031] 1. This invention provides a grape transcription factor VvMYB108 for the first time, which is found to participate in the plant's response to low temperature stress and positively regulate the plant's cold resistance. It can improve the plant's cold resistance by upregulating the expression level of this gene in the plant.

[0032] 2. This gene provides new genetic resources for improving the cold resistance of grape cultivars and breeding germplasm resources, and provides new application value for promoting the quality improvement, efficiency enhancement and transformation and upgrading of the grape industry. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. Attached Figure Description

[0033] Figure 1 This is a technical flowchart of the present invention;

[0034] Figure 2 This is a schematic diagram of the VvMYB108 expression characteristics analysis of the present invention; A is the relative expression level of the VvMYB108 gene under low temperature (4℃) treatment for different times (0h, 3h, 6h, 9h, 12h, 24h); B is the relative expression level of the VvMYB108 gene in different tissues and organs of grape (roots, stems, buds, tendrils, young leaves, mature leaves, old leaves, fruits);

[0035] Figure 3 A is a schematic diagram of the subcellular localization and transcriptional activation activity detection of VvMYB108 in this invention; B is a schematic diagram of the subcellular localization of the VvMYB108 gene; C is a schematic diagram of the VvMYB108 gene transcriptional activation activity detection.

[0036] Figure 4 This is a schematic diagram of the phenotype and growth of VvMYB108 overexpressing grape callus after low-temperature treatment according to the present invention; A is the phenotype of VvMYB108 overexpressing grape callus and wild-type grape callus before and after low-temperature treatment; B is the change in relative expression level of VvMYB108 overexpressing grape callus; C is an image of GFP green fluorescence detected in the overexpressing callus.

[0037] Figure 5This is a schematic diagram illustrating the determination of physiological indicators in grape callus treated with VvMYB108 overexpression under low-temperature conditions according to the present invention; A represents the malondialdehyde content in grape callus before and after low-temperature treatment; B represents the proline content in grape callus before and after low-temperature treatment; C represents the hydrogen peroxide content in grape callus before and after low-temperature treatment; D represents the superoxide anion content in grape callus before and after low-temperature treatment; E and J represent the expression levels of cold-related genes CBF1, CBF2, CBF3, COR15A, KIN2, and RD29A in grape callus before and after low-temperature treatment, respectively.

[0038] Figure 6 This is a schematic diagram of the phenotype and survival rate of Arabidopsis thaliana plants heterologously overexpressing VvMYB108 under low temperature treatment; A shows the phenotype and survival rate of Arabidopsis thaliana seedlings heterologously overexpressing and wild-type Arabidopsis thaliana seedlings before and after low temperature treatment; B shows the phenotype and survival rate of Arabidopsis thaliana seedlings heterologously overexpressing and wild-type Arabidopsis thaliana seedlings before and after low temperature treatment.

[0039] Figure 7 This is a schematic diagram illustrating the determination of physiological indicators of Arabidopsis seedlings subjected to low-temperature treatment using VvMYB108 heterologous overexpression according to this invention; A represents the chlorophyll leaching amount of Arabidopsis before and after low-temperature treatment; B represents the leaf water loss rate of Arabidopsis before and after low-temperature treatment; C represents the cell membrane permeability of Arabidopsis before and after low-temperature treatment; D represents the malondialdehyde content of Arabidopsis before and after low-temperature treatment; E represents the hydrogen peroxide content of Arabidopsis before and after low-temperature treatment; and F represents the superoxide anion content of Arabidopsis before and after low-temperature treatment.

[0040] Figure 8 This is the identification result of Arabidopsis thaliana overexpressing VvMYB108.

[0041] In this experiment, three strains with different relative expression levels of VvMYB108 (low, medium, and high) were selected (5, 16, and 34) for subsequent experiments. Detailed Implementation

[0042] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0043] Example 1: Cloning of the full-length cDNA of the grape VvMYB108 gene

[0044] 1.1 Experimental Methods:

[0045] (1) Using cDNA from the wine grape Zuoyouhong as a template, amplification was performed using a high-fidelity enzyme. The primer sequences were as follows:

[0046] Forward primer: 5'-TCTAGAATGTCTACTTTGAGCAAGAGTGC-3'

[0047] Reverse primer: 5'-CTGCAGTTAAAAGAGCCTAGGTGCCC-3'

[0048] (2) The amplified products were purified and recovered using a gel extraction kit. Using DNA cloning technology, the purified products were ligated into the pMD19-T Vector, and then the ligation products were transformed into DH5α competent cells. The cells were plated, shaken, and then positive identification was performed. The obtained positive clones were then sent to a biotechnology company for sequencing.

[0049] 1.2 Experimental Results and Analysis

[0050] According to the sequencing results, the full-length gene of VvMYB108 is 987 bp, encoding 328 amino acids, and the nucleotide sequence is shown in SEQ ID NO.1.

[0051] The amino acid sequence of the protein expressed by this gene is shown in SEQ ID NO.2. Based on the sequencing results and analysis from the website (https: / / web.expasy.org / protparam / ), the molecular weight of this protein is 36 kDa, the isoelectric point is 5.07, and the instability coefficient is 47.05.

[0052] Example 2: Expression characteristics analysis of VvMYB108 under low temperature conditions

[0053] 2.1 Experimental Methods

[0054] (1) Take a light intensity of 200 mmol / (m 2 Grape seedlings of the Zuoyouhong variety, cultivated in a culture room with a light / dark cycle of 16 / 8 h and a temperature of 25±1℃, were placed in a low-temperature incubator (PERCIVAL E-36L2, USA) for low-temperature treatment (4℃). Sampling time points were 0h, 3h, 6h, 9h, 12h, and 24h. After leaf samples were collected at each time point, they were immediately frozen in liquid nitrogen and then stored at -80℃ for later use in gene expression pattern analysis.

[0055] (2) Grape tissues and organs (roots, stems, buds, tendrils, young leaves, mature leaves, old leaves, and fruits) were taken from the experimental field of Huadong Baili Winery Scenic Area, Jiushui East Road, Laoshan District, Qingdao City. 0.1g of each was frozen in liquid nitrogen and then stored in a -80℃ refrigerator for later use in the subsequent tissue expression characteristic analysis.

[0056] (3) Total RNA was extracted from all materials prepared in the previous two steps using the CTAB method, and the first strand of cDNA was synthesized using the M-MLV reverse transcription kit as a template. The low-temperature expression and different tissue expression characteristics of the VvMYB108 gene in grape materials were analyzed using real-time quantitative PCR (qRT-PCR). The Real-time PCR program was: 95℃ for 60s, 95℃ for 10s, 58℃ for 20s, 72℃ for 15s, for 40 cycles. Each sample was tested in triplicate, and the reaction was performed using a TaKaRa PCR quantitative analyzer.

[0057] Using Actin from grapes as an internal reference gene, 2 -ΔΔCt The algorithm calculates gene expression. The real-time quantitative primers for VvMYB108 and the amplification primers for Actin are as follows:

[0058] VF forward primer: 5'-GAATTCAAGCTCAGAGAACTGC-3';

[0059] VR reverse primer: 5'-TGAAAAGGACTTGTTGGGTAGT-3'.

[0060] Actin forward primer: 5'-ATAGAAGCAGCAAGGGA-3';

[0061] Actin reverse primer: 5'-TGAGGCTCTTACTAATG-3'

[0062] 2.2 Experimental Results and Analysis

[0063] (1) VvMYB108 gene expression level as follows Figure 2 As shown in Figure A, the expression level of this gene gradually increased with the duration of low-temperature treatment, reaching a peak at 12 hours.

[0064] (2) From Figure 2 Analysis of VvMYB108 gene expression levels in various tissues of grapes (B) showed that VvMYB108 expression was significant in buds and mature leaves. These results indicate that VvMYB108 is induced by cold stress and may play a role in grape cold tolerance.

[0065] Example 3: Subcellular localization and transcriptional activation activity analysis of VvMYB108

[0066] 3.1 Subcellular localization of VvMYB108

[0067] (1) Experimental methods

[0068] The CDS fragment of VvMYB108 was amplified using the pMD19-T-VvMYB108 plasmid as a template and fused into the vector pSuper1300-GFP. The recombinant plasmid pSuper1300-VvMYB108-GFP was then transformed into Agrobacterium GV3101, and colony PCR was performed for identification. Positive bacteria were selected for subsequent experiments. The constructed pSuper1300-VvMYB108-GFP and the positive control pSuper1300-GFP were injected into tobacco leaves, respectively. After 3 days of expression, the subcellular localization of VvMYB108 was observed using a laser confocal microscope.

[0069] (2) Experimental Results

[0070] from Figure 3 The results from A show that VvMYB108 is located in the cell nucleus.

[0071] 3.2 Analysis of the transcriptional activation activity of VvMYB108

[0072] (1) Experimental methods

[0073] To detect the transcriptional activation activity of the VvMYB108 transcription factor, the CDS fragment of VvMYB108 was amplified using the pMD19-T-VvMYB108 plasmid as a template and ligated into the pGBKT7 vector. Yeast AH109 competent cells were transformed with plasmid pGBKT7 and recombinant plasmid pGBKT7-VvMYB108 using the PEG / LiAc method. Yeast cells transformed with the pGBKT7 negative control plasmid were plated on SD / -Trp solid medium, and yeast cells transformed with the recombinant plasmid were plated on SD / -His solid medium and cultured at 29°C for 72 h.

[0074] Spread 100 mL of prepared X-α-gal solution evenly on SD / -His solid medium and invert until absorbed. Pick single yeast colonies transformed with pGBKT7-VvMYB108 and pGBKT7 respectively and resuspend them in 100 mL of sterile ddH2O. Streak 2 mL of each resuspension onto SD / -Trp solid medium and SD / -His solid medium containing X-α-gal, respectively. Verify the transcriptional activation activity of VvMYB108 by observing colony growth and whether it turns blue.

[0075] Positive control group setup: The yeast in the positive control of this experiment contained two vectors, AD and BD (becoming the ABD group), which exhibited complete GAL4 transcription factor activity, hydrolyzed the colorless X-α-Gal substrate and finally produced a blue product, which appeared blue on filter paper, and served as the positive control.

[0076] The principle of transcription activation assay: The DNA binding domain (DNA-BD) located at amino acid residues 1-147 of the N-terminus and the activation domain (AD) located at amino acid residues 768-881 of the C-terminus cannot activate the transcription response individually. However, when they are spatially close enough, they exhibit complete GAL4 transcription factor activity and can activate downstream promoters, leading to the transcription of downstream genes. Therefore, yeast samples containing both AD and BD vectors as a positive control exhibit complete GAL4 transcription factor activity.

[0077] (2) Experimental Results and Analysis

[0078] Figure 3 The experimental results of group B showed that both pGBKT7-VvMYB108 and the positive control group ABD turned blue on filter paper soaked in X-α-gal, indicating that VvMYB108 has transcriptional activating activity. These experimental results demonstrate that VvMYB108 functions as a transcriptional activator in plants.

[0079] Example 4: Genetic transformation and identification of grape callus overexpression

[0080] 4.1 Experimental Methods

[0081] 4.1.1 Genetic transformation of grape callus

[0082] (1) Preparation of plant materials

[0083] Using the flower buds of the grape variety 'Seedless White' as experimental material, small segments were cut and placed in sterile empty bottles. The bottles were disinfected with 75% alcohol for 30 seconds, then immersed in 15-18% NaClO for 15 minutes, and washed 3-5 times with sterile water. After disinfection, the bottles were placed on MS solid medium and cultured in the dark at 25°C under light. The induced grape embryogenic callus was inoculated onto MS solid medium and cultured in the dark at 25°C under light. This callus was subsequently used to obtain transgenic callus, observe low-temperature phenotypes, and detect stress resistance physiological indicators. During this period, Agrobacterium-mediated transformation was prepared.

[0084] (2) Preparation of Agrobacterium infection solution

[0085] In a clean bench, using a sterilized inoculation loop, pick up *Agrobacterium tumefaciens* pSuper1300-VvMYB108-GFP stored at -80℃, streak it onto LB solid medium containing 50 mg / L Kan and Rif antibiotics, and incubate the LB solid medium in the dark at 28℃ for 2 days. Take a sterile 100 mL Erlenmeyer flask, pour in 50 mL of LB liquid medium containing Kan and Rif antibiotics, scrape off the grown *Agrobacterium* and dissolve it in the LB liquid medium, and shake at 200 rpm for 12 hours at 28℃. Collect the bacterial cells, and adjust the concentration to an OD600 value of 0.6-0.8 by adding MS liquid medium containing 20 mg / L AS (acetosyringone).

[0086] (3) Infection and co-cultivation

[0087] Healthy grape embryogenic callus was placed in a culture dish containing filter paper. The prepared Agrobacterium tumefaciens solution was then added dropwise to the callus using a pipette. After standing for 5 minutes, the remaining Agrobacterium tumefaciens solution was blotted dry with filter paper to complete the infection. The grape callus, now free of residual solution, was then evenly distributed onto a co-culture medium containing Aspergillus oryzae (AS). The callus was subsequently incubated in the dark at 25°C for 3 days.

[0088] (4) Screening, culture and regeneration

[0089] Grape embryogenic callus cultured in the dark for 3 days was removed and transferred to a selection medium containing 50 mg / L Hyp MS (see table below).

[0090] The culture medium formula used in the experiment is shown in Table 1 below. The prepared culture medium should be autoclaved at 115℃ for 20 min. After adding the filtered and sterilized antibiotic in a laminar flow hood, it should be dispensed into petri dishes or Erlenmeyer flasks that have also been autoclaved at 115℃ for 20 min, sealed, and used for later use.

[0091] Table 1 Culture medium formulation

[0092]

[0093] 4.1.2. Identification of positive seedlings

[0094] RNA was extracted from grape callus tissue overexpressing VvMYB108 and reverse-engineered into cDNA, which served as a template for quantitative amplification. Quantitative RT-PCR analysis was performed using a 2×M5 HiPer SYBR Premix EsTap kit on a TaKaRa real-time quantitative PCR instrument. The specific operational steps are as follows: □□

[0095] (1) Add the following reaction solutions to a dedicated plate for real-time PCR, using the product amplified with Actin primers as an internal control. Perform three biological replicates for each cDNA template. All operations should be performed on ice.

[0096]

[0097] Primer F:GAATTCAAGCTCAGAGAACTGC

[0098] Primer R: TGAAAAGGACTTGTTGGGTAGT

[0099] (2) After adding the liquid, use a pipette to mix it thoroughly, cover it and press it flat, and then centrifuge it at 12000 rpm for 1 min.

[0100] (3) Place the 96-well plate into the TaKaRa real-time fluorescence quantitative PCR instrument for quantitative RT-PCR analysis;

[0101] (4) Using 2 -ΔΔCt The algorithm calculates gene expression.

[0102] 4.2 Experimental Results and Analysis

[0103] Figure 4 The experimental results of B showed that, compared with the wild type, the relative expression level of VvMYB108 in callus tissue was significantly increased, and as... Figure 4 As shown in Figure C, GFP green fluorescence was detected in the overexpressing callus tissue using a microscope. The obtained positive transgenic callus tissue was used for subsequent cold resistance analysis.

[0104] Example 5: Analysis of cold resistance in grape callus overexpression

[0105] 1. Experimental testing methods

[0106] In this embodiment, a two-component spectrophotometer was used to determine the MDA content, proline content, H2O2 content, and superoxide anion content of wild-type and overexpression grape callus. For specific experimental procedures, please refer to "Experimental Guide to Plant Physiology".

[0107] 2. Experimental Results and Analysis

[0108] (1) As Figure 4As shown in Figure A, before low-temperature treatment, there were no significant phenotypic differences between wild-type and overexpression grape callus tissues. However, after acclimatization at 4℃ for 12 hours, followed by a decrease in temperature from 0℃ to -8℃ every hour until 12 hours of treatment at 4℃, most of the wild-type grape callus tissues turned brown or black, and growth was significantly inhibited. In contrast, the overexpression grape callus tissues remained golden yellow, indicating less damage.

[0109] (3) From Figure 5 As shown in B, overexpression of grape callus also resulted in the accumulation of higher proline content, indicating that low-temperature damage to wild-type grape callus was more severe.

[0110] (4) MDA is a commonly used indicator of membrane lipid peroxidation; this parameter decreases significantly when plants are subjected to external stress. For example... Figure 5 As shown in Figure A, compared with wild-type grape callus, the overexpressing grape callus accumulated lower MDA content after low-temperature treatment; and from Figure 5 As shown in C and 5D, the accumulation of H2O2 and superoxide anions in the overexpressing grape callus is relatively small, indicating that the overexpressing grape callus has a better reactive oxygen species scavenging ability.

[0111] (5) Figure 5 As shown in EJ, there was no significant difference in the relative expression levels of cold-related genes in wild-type grape callus and overexpression grape callus before and after low-temperature treatment; however, after low-temperature treatment, the expression of cold-related genes CBF1, CBF2, CBF3, COR15A, KIN2, and RD29A in overexpression grape callus was significantly upregulated compared with wild-type grape callus.

[0112] In summary, the above observations of cold-resistance phenotypes and the determination of physiological indicators show that overexpression of the VvMYB108 gene gives transgenic grape callus tissue a higher cold resistance and frost resistance.

[0113] Example 6: Cultivation and Identification of Positive Seedlings Overexpressing Arabidopsis thaliana

[0114] 1. Experimental Methods

[0115] The method is described in Example 4.

[0116] 2. Experimental Results and Analysis

[0117] Real-time quantitative analysis of the relative expression level of VvMYB108 in overexpressing Arabidopsis thaliana plants revealed that the relative expression level of VvMYB108 was significantly higher in overexpressing Arabidopsis thaliana plants compared with wild type. The obtained positive transgenic Arabidopsis thaliana plants were used for subsequent cold resistance analysis.

[0118] Example 7: Analysis of Cold Resistance of Arabidopsis thaliana Overexpression

[0119] 1. Experimental Methods

[0120] To further verify the biological function of VvMYB108 in the response to low temperature stress, VvMYB108 was heterologously overexpressed in Arabidopsis thaliana. The specific procedure is as follows:

[0121] (1) Wild-type Arabidopsis thaliana seedlings that had germinated and grown for 14 days after being seeded and heterologously overexpressed with VvMYB108 were treated at 4℃ for 36 hours. Then, the temperature was gradually reduced from 0℃ to -6℃ and maintained for 1 hour. After that, the seedlings were treated at 4℃ for 12 hours and then recovered in a 22℃ light incubator for 2-3 days. Phenotypic results and related physiological indicators were observed.

[0122] Survival rate calculation method: Count the number of surviving Arabidopsis thaliana and calculate the ratio. Specifically: 100 seeds are planted at each division point, and the survival rate is calculated by dividing the number of surviving Arabidopsis thaliana seeds by the total number of Arabidopsis thaliana seeds (100).

[0123] (2) Take wild-type Arabidopsis thaliana seedlings that are about 4 weeks old and have not bolted and are heterologously overexpressed with VvMYB108 (light / dark 16 / 8h), treat them at 4℃ for 36h, then treat them at -6℃ in the dark for 12h, then treat them at 4℃ for 12h, and finally restore them in a greenhouse at 22℃ for 2-3 days. Observe the phenotype and detect relevant physiological indicators.

[0124] 2. Experimental Results and Analysis

[0125] (1) As Figure 6 As shown in Figures AB, homozygous plants of wild-type and T3 generation heterologous overexpression Arabidopsis thaliana lines were subjected to low-temperature treatment, and their survival rates were statistically analyzed. Under normal conditions, there were no significant morphological differences between wild-type and heterologous overexpression Arabidopsis thaliana; however, after cold treatment, most wild-type Arabidopsis thaliana leaves showed obvious water-soaked damage, while the heterologous overexpression Arabidopsis thaliana lines showed less damage than wild-type, indicating that the heterologous overexpression Arabidopsis thaliana plants exhibited a significant cold-resistant phenotype.

[0126] The number of surviving Arabidopsis thaliana plants was counted and the percentages were calculated. The results showed that the survival rate of wild-type Arabidopsis was 33.8%, while the survival rates of Arabidopsis lines heterologously overexpressing VvMYB108 were significantly higher than those of the wild type, at 68.5%, 89.7%, and 69.5%, respectively. This indicates that overexpression of VvMYB108 enhances the cold resistance of Arabidopsis, meaning that VvMYB108 participates in the plant's response to cold stress and acts as a positive regulator, enhancing the plant's tolerance to cold stress.

[0127] (2) Figure 7 As shown in AD, after low-temperature treatment, the amount of chlorophyll loss, cell water loss, and cell membrane permeability of heterologously overexpressed Arabidopsis thaliana were lower than those of wild type, and the amount of MDA accumulated was also lower. This indicates that the damage caused by low temperature to wild type Arabidopsis thaliana was more severe.

[0128] like Figure 7 As shown in E, the accumulation of H2O2 and superoxide anions in the heterologous overexpression Arabidopsis plants was lower than that in the wild type, indicating that the heterologous overexpression Arabidopsis plants have a better reactive oxygen species scavenging ability.

[0129] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solutions and concepts of this invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.

Claims

1. The application of a grape transcription factor VvMYB108 in improving the cold resistance of plants, characterized in that, Its protein sequence is shown in SEQ ID NO.2; by upregulating the expression of the VvMYB108 gene in plants, the cold resistance of plants is improved; the plants are grapes or Arabidopsis thaliana.

2. The application of the gene encoding the grape transcription factor VvMYB108 as described in claim 1 in improving plant cold resistance, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.1; the cold resistance of plants is improved by upregulating the expression of the VvMYB108 gene in plants; the plant is grape or Arabidopsis thaliana.

3. The application of a recombinant vector in improving the cold resistance of plants, characterized in that, The plant carries the coding gene as described in claim 2; the plant's cold resistance is improved by upregulating the expression level of the coding gene in the plant; the plant is grape or Arabidopsis thaliana.

4. The application of a recombinant bacterium in improving the cold resistance of plants, characterized in that, The transformation is performed using the recombinant vector as described in claim 3; the cold resistance of the plant is improved by upregulating the expression level of the coding gene in the plant; the plant is grape or Arabidopsis thaliana.

5. A method for cultivating a cold-resistant transgenic plant, characterized in that, The cultivation method is as follows: by promoting the expression of the VvMYB108 gene in the target plant, plants with better cold resistance than the target plant are obtained, and the nucleotide sequence of the VvMYB108 gene is shown in SEQ ID NO.1; the plant is grape or Arabidopsis thaliana.