Pyrazolopyrimidinone compounds

By developing pyrazolopyrimidinone compounds as SF-1 antagonists, the problem of lacking effective regulation of SF-1-dependent tissue growth and function in existing technologies has been solved, enabling effective treatment of related cancers and endocrine diseases.

CN117396480BActive Publication Date: 2026-07-31ORPHAGEN PHARMA INC
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ORPHAGEN PHARMA INC
Filing Date
2022-03-25
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

The lack of effective SF-1 antagonists in current technologies to regulate the growth and function of SF-1-dependent tissues leads to treatment challenges for related diseases such as adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer, melanoma, pituitary gonadotropin-secreting cell adenoma, and sex cord-stromal tumor.

Method used

Pyrazolopyrimidinone compounds were developed as SF-1 antagonists to block the release of pituitary gonadotropins or inhibit the production of adrenal steroids by regulating the transcriptional activity of SF-1, and are used to treat the aforementioned cancers and endocrine disorders.

Benefits of technology

Effectively inhibiting SF-1 activity and blocking the pathological processes of related cancers and endocrine diseases provides new treatment options, especially for tumors with high SF-1 expression such as adrenocortical carcinoma, sex cord-stromal tumors, and endometriosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure QLYQS_2
    Figure QLYQS_2
  • Figure QLYQS_3
    Figure QLYQS_3
Patent Text Reader

Abstract

Provided herein are pyrazolopyrimidinone compounds and pharmaceutical compositions comprising the same.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-referencing

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 166,739, filed March 26, 2021, which is incorporated herein by reference in its entirety. Background Technology

[0003] Steroid-producing factor 1 (SF-1, NR5A1) is a transcriptional regulator of genes involved in the development and function of steroid-producing tissues. SF-1 regulators offer opportunities for novel therapeutic compounds that regulate the growth and function of SF-1-dependent tissues. Summary of the Invention

[0004] This disclosure provides, for example, pyrazolopyrimidine compounds, their use as medicaments for treating cancer, methods of their preparation, and pharmaceutical compositions comprising the disclosed compounds as at least one active ingredient. This disclosure also provides the use of the compounds described herein as medicaments and / or in the manufacture of medicaments for treating cancer, endocrine disorders, and endometriosis.

[0005] One aspect is the compound of formula (I):

[0006]

[0007] in:

[0008] X is a bond or a C1-C6 alkylene group;

[0009] R 1 Selected from C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, -CH2C 6-10 Aryl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, -CH2C 6-10 Aryl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally surrounded by one, two, three, four or five R groups. 4 replace;

[0010] R 2 Selected from C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9The heteroaryl group is optionally surrounded by one, two, three, four or five R groups. 5 replace;

[0011] R 3 It is hydrogen, C1-C6 alkyl, C1-C6 haloalkyl or C 3-8 cycloalkyl;

[0012] Each R 4 and each R 5 Each is independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl, C 1-9 Mixed aromatics, -OR 6 -SR 6 -C(O)OR 6 -OC(O)N(R) 6 (R) 7 ), -N(R 8 )C(O)N(R 6 (R) 7 ), -N(R 8 )C(O)R 9 -N(R) 8 )C(O)OR 9 -N(R) 8 )S(O)2R 9 -C(O)R 9 -OC(O)R 9 -C(O)N(R) 6 (R) 7 -C(O)C(O)N(R) 6 (R) 7 ), -S(O)R 9 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 ), where C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group may optionally be substituted by one, two, or three groups selected from the following: halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl, C 1-9 Mixed aromatics, -OR 10 -SR 10 -C(O)OR 10 -OC(O)N(R) 10 (R) 11 ), -N(R 12 )C(O)N(R 10 (R) 11 ), -N(R 12 )C(O)R 13 -N(R) 12 )C(O)OR 13 -N(R) 12 )S(O)2R 13 -C(O)R 13 -OC(O)R 13 -C(O)N(R) 10 (R) 11 -C(O)C(O)N(R) 10 (R) 11 ), -S(O)R 13 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 );

[0013] Each R 6 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, hydroxyl, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C6-10 Aryl and C 1-9 Mixed aromatics;

[0014] Each R 7 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0015] Each R 8 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0016] Each R 9 Selected independently from C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0017] Each R 10 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0018] Each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0019] Each R 12 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups; and

[0020] Each R 13 Selected independently from C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0021] Or its pharmaceutically acceptable salts or solvates.

[0022] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 Selected from C 6-10 Aryl and C 1-9 heteroaryl, of which C 6-10 Aryl and C 1-9 The heteroaryl group is optionally surrounded by one, two, three, four or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C6-10 aryl groups, which are optionally composed of one, two, three, four, or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is optionally surrounded by one, two, three, four, or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 1-9 Heteroaryl groups, which are optionally surrounded by one, two, three, four, or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a pyridyl group, which is optionally surrounded by one, two, three, four or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R... 4 Independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 3-8 Cycloalkyl groups, optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is optionally divided by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 6-10 aryl groups, which are optionally composed of one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a tetrahydropyranyl group, which is optionally surrounded by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R... 5 Independently selected from halogens, -CN, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 -S(O)2N(R) 6 (R) 7 ) and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from the following: -OR 10 -C(O)OR 10 -C(O)R 13 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogens, C 1-6 Halogenated alkyl groups, -OR6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R 6 Independently selected from hydrogen and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from halogens and hydroxyl groups. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R... 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 3 It is a C1-C6 alkyl group. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 It is hydrogen. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is a bond. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is a C1-C6 alkylene group.

[0023] In another embodiment, a pharmaceutical composition comprises a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, and at least one pharmaceutically acceptable excipient.

[0024] In another embodiment, a method of treating cancer in a mammal in need includes administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In another embodiment, a method of treating cancer in a mammal in need includes administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotropin-secreting cell adenoma, and sex cord-stromal tumor. In another embodiment, a method of treating cancer in a mammal in need includes administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is adrenocortical carcinoma.

[0025] In another embodiment, a method for treating an endocrine disorder in a mammal in need includes administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In another embodiment, a method for treating an endocrine disorder in a mammal in need includes administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the endocrine disorder is selected from endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome.

[0026] In another embodiment, there is a method for treating endometriosis in mammals in need, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. Detailed Implementation

[0027] Steroid-producing factor 1 (SF-1, NR5A1) is a transcriptional regulator of genes involved in the development and function of steroid-producing tissues. After birth, SF-1 is expressed in the adrenal cortex and gonads, pituitary gonadotropin cells, the ventromedial hypothalamus (VMH), and the splenic vascular system.

[0028] In mice, targeted deletion of the SF-1 gene leads to adrenal and gonadal dysgenesis and postnatal death due to severe adrenal insufficiency. In humans, partial loss-of-function mutations in SF-1 are associated with sexual development disorders and severe adrenal insufficiency.

[0029] SF-1 plays a crucial role in steroid hormone synthesis by regulating the transcription of steroid-producing genes, including StAR, Cyp11a1, Cyp17, CYP21, Cyp11b1, Cyp11b2, and 3β-Hsd. The transcriptional activity of SF-1 can be stimulated by the binding of adrenocorticotropic hormone (ACTH) to the melanocortin 2 receptor (MC2R) in the adrenal cortex.

[0030] The SF-1 protein possesses a modular domain structure comprising an N-terminal zinc finger DNA-binding domain (DBD), a ligand-binding domain (LBD), a C-terminal AF-2 activation domain, and an intermediate hinge region. SF-1 also contains a 30-amino acid extension of the DBD, which mediates binding to specific DNA recognition motifs. Unlike most other nuclear receptor transcription factors, SF-1 interacts with its DNA recognition motif as a monomer. SF-1 activity is regulated by phosphoinositol and other phospholipids that bind to a large hydrophobic pocket within the SF-1 LBD.

[0031] Compared with normal endometrium, SF-1 is highly expressed in ectopic endometrial lesions, at least 1,000-fold at the mRNA level and approximately 5-fold at the protein level. Furthermore, SF-1 expression is closely correlated with aromatase expression in ectopic endometrial tissue, indicating that SF-1 is an important regulator of intracellular estrogen biosynthesis.

[0032] Genomic, clinical, and pathological studies have shown that SF-1 is a key transcription factor in the pathogenesis of adrenocortical carcinoma (ACC). In adult ACC, higher tumor SF-1 expression levels are associated with a higher risk of death. In pediatric ACC, SF-1 is overexpressed at the protein and / or chromosomal levels in approximately 90% of cases. SF-1 is also highly expressed in sex cord-stromal tumors (e.g., Sertoli cell carcinoma) and ectopically expressed in subgroups of ovarian serous carcinoma and head and neck cancer, and widely expressed in endometriosis.

[0033] Postpartum loss of SF-1 in VMH leads to obesity induced by a high-fat diet due to impaired thermogenesis and sluggish leptin signaling, indicating that SF-1 is an important regulator of energy metabolism.

[0034] In addition, SF-1 antagonists may block the release of pituitary gonadotropins from cells or inhibit the production of adrenal steroids, including cortisol or adrenal androgens. Potential indications include hormone-dependent prostate cancer, endogenous Cushing's syndrome, congenital adrenal hyperplasia, polycystic ovary syndrome, and other endocrine disorders.

[0035] SF-1 antagonists may be a promising avenue for the development of new therapeutic compounds.

[0036] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly specifies otherwise. Thus, for example, a reference to “pharmaceutical” includes a plurality of such pharmaceuticals, and a reference to “cell” includes a reference to one or more cells (or cells) and their equivalents. When scope is used herein to refer to physical properties, such as molecular weight, or chemical properties, such as chemical formulas, it is intended to include all combinations and sub-combinations of that scope, as well as specific embodiments thereof. When referring to a number or numerical range, the term “about” means that the referenced number or numerical range is an approximation within experimental variability (or statistical experimental error), and therefore the number or numerical range varies between 1% and 15% of said number or numerical range. The term “comprising” (and related terms such as “containing,” “including,” “having,” or “covering”) is not intended to exclude, in some other embodiments, for example, embodiments of compositions, methods, or processes of any substance described herein, that may “consist of the described features” or “consist substantially of the described features.”

[0037] definition

[0038] As used in the specification and appended claims, unless otherwise specified, the following terms shall have the meanings indicated below.

[0039] As used in this article, C1-C x Including C1-C2, C1-C3...C1-C x C1-C x It refers to the number of carbon atoms that make up its specified part (excluding optional substituents).

[0040] "Amino" refers to the –NH2 group.

[0041] "Cyano" refers to the -CN group.

[0042] "Nitro" refers to the -NO2 group.

[0043] "O-" refers to the -O- group.

[0044] "Oxo" refers to the =O group.

[0045] "Thio" refers to the =S group.

[0046] "Imine" refers to the =NH group.

[0047] "Oxime group" refers to the =N-OH group.

[0048] "Alkyl" or "alkylene" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, which is unsaturated and has one to eighteen carbon atoms (e.g., C1-C1). 18Alkyl groups. In some embodiments, the alkyl group comprises three to eighteen carbon atoms (e.g., C3-C4). 18 Alkyl groups. In some embodiments, the alkyl group comprises one to fifteen carbon atoms (e.g., C1-C1). 15 Alkyl groups. In some embodiments, the alkyl group comprises one to twelve carbon atoms (e.g., C1-C1). 12 Alkyl group. In some embodiments, the alkyl group comprises one to eight carbon atoms (e.g., C1-C8 alkyl). In other embodiments, the alkyl group comprises one to six carbon atoms (e.g., C1-C6 alkyl). In other embodiments, the alkyl group comprises one to five carbon atoms (e.g., C1-C5 alkyl). In other embodiments, the alkyl group comprises one to four carbon atoms (e.g., C1-C4 alkyl). In other embodiments, the alkyl group comprises one to three carbon atoms (e.g., C1-C3 alkyl). In other embodiments, the alkyl group comprises one to two carbon atoms (e.g., C1-C2 alkyl). In other embodiments, the alkyl group comprises one carbon atom (e.g., C1 alkyl). In other embodiments, the alkyl group comprises five to fifteen carbon atoms (e.g., C5-C6 alkyl). 15 Alkyl group. In some embodiments, the alkyl group comprises five to eight carbon atoms (e.g., C5-C8 alkyl). In some embodiments, the alkyl group comprises two to five carbon atoms (e.g., C2-C5 alkyl). In some embodiments, the alkyl group comprises three to five carbon atoms (e.g., C3-C5 alkyl). In some embodiments, the alkyl group is selected from methyl, ethyl, 1-propyl (n-propyl), 1-methylethyl (isopropyl), 1-butyl (n-butyl), 1-methylpropyl (sec-butyl), 2-methylpropyl (isobutyl), 1,1-dimethylethyl (tert-butyl), and 1-pentyl (n-pentyl). The alkyl group is linked to the remainder of the molecule by a single bond. Unless otherwise expressly stated in this specification, the alkyl group is optionally substituted with one or more of the following substituents: halogroup, cyanogroup, nitrogroup, oxogroup, thiogroup, iminogroup, oximegroup, trimethylsilyl group, -OR group. a -SR a -OC(O)-R f -N(R) a )2、-C(O)R a -C(O)OR a -C(O)N(R) a )2、-N(R a )C(O)OR f -OC(O)-NR a R f -N(R) a )C(O)R f -N(R) a S(O)t R f (where t is 1 or 2), -S(O) t OR a (where t is 1 or 2), -S(O) t R f (where t is 1 or 2) and -S(O) t N(R a )2 (where t is 1 or 2) where each R a Independently, it is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f It is independently an alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.

[0049] "Alkoxy" refers to a group of the formula –O-alkyl that is bonded by an oxygen atom, wherein the alkyl group is an alkyl chain as defined above.

[0050] "Alkenyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing at least one carbon-carbon double bond and having two to eighteen carbon atoms. In some embodiments, the alkenyl group contains three to eighteen carbon atoms. In some embodiments, the alkenyl group contains three to twelve carbon atoms. In some embodiments, the alkenyl group contains six to twelve carbon atoms. In some embodiments, the alkenyl group contains six to ten carbon atoms. In some embodiments, the alkenyl group contains eight to ten carbon atoms. In some embodiments, the alkenyl group contains two to eight carbon atoms. In other embodiments, the alkenyl group contains two to four carbon atoms. The alkenyl group is connected to the rest of the molecule by a single bond, for example, vinyl (i.e., vinyl), prop-1-enyl (i.e., allyl), but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. Unless otherwise expressly stated in this specification, the alkenyl group may optionally be substituted with one or more of the following substituents: halo, cyano, nitro, oxo, thio, imino, oxime, trimethylsilyl, -OR a -SR a -OC(O)-R f -N(R) a )2、-C(O)R a -C(O)OR a -C(O)N(R) a )2、-N(R a )C(O)OR f -OC(O)-NR a R f -N(R) a )C(O)R f -N(R) a S(O)t R f (where t is 1 or 2), -S(O) t OR a (where t is 1 or 2), -S(O) t R f (where t is 1 or 2) and -S(O) t N(R a )2 (where t is 1 or 2) where each R a Independently, it is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f It is independently an alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.

[0051] "Alynyl" refers to a straight-chain or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing at least one carbon-carbon triple bond and having two to eighteen carbon atoms. In some embodiments, the alkynyl group contains three to eighteen carbon atoms. In some embodiments, the alkynyl group contains three to twelve carbon atoms. In some embodiments, the alkynyl group contains six to twelve carbon atoms. In some embodiments, the alkynyl group contains six to ten carbon atoms. In some embodiments, the alkynyl group contains eight to ten carbon atoms. In some embodiments, the alkynyl group contains two to eight carbon atoms. In other embodiments, the alkynyl group has two to four carbon atoms. The alkynyl group is connected to the rest of the molecule by a single bond, such as ethynyl, propynyl, butynyl, pentyynyl, hexynyl, etc. Unless otherwise expressly stated in this specification, the alkynyl group is optionally substituted by one or more of the following substituents: halogen, cyano, nitro, oxo, thio, imino, oxime, trimethylsilyl, -OR a -SR a -OC(O)-R f -N(R) a )2、-C(O)R a -C(O)OR a -C(O)N(R) a )2、-N(R a )C(O)OR f -OC(O)-NR a R f -N(R) a )C(O)R f -N(R) a S(O) t R f (where t is 1 or 2), -S(O) t OR a (where t is 1 or 2), -S(O) tR f (where t is 1 or 2) and -S(O) t N(R a )2 (where t is 1 or 2) where each R a Independently, it is hydrogen, alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl, and each R f It is independently an alkyl, haloalkyl, cycloalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl.

[0052] "Aryl" refers to a group derived from an aromatic monocyclic or polycyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. An aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and six to eighteen carbon atoms, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2)π–electron system according to Hückel's theory. Ring systems from which aryl groups are derived include, but are not limited to, benzene, fluorene, indene, indene, tetrahydronaphthalene, and naphthyl groups. Unless otherwise expressly stated in this specification, the term "aryl" or the prefix "aromatic" (such as in "arylalkyl") is intended to include an aryl group optionally substituted with one or more substituents selected from alkyl, alkenyl, ynyl, halogen, haloalkyl, cyano, nitro, aryl, aralkyl, arylene, arylynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a -R b -OC(O)-R a -R b -OC(O)-OR a -R b -OC(O)-N(R a )2、-R b -N(R a )2、-R b -C(O)R a -R b -C(O)OR a -R b -C(O)N(R a )2、-R b -OR c -C(O)N(R a )2、-R b -N(R a )C(O)OR a -R b -N(R a )C(O)R a -R b -N(R a S(O) tR a (where t is 1 or 2), -R b -S(O) t OR a (where t is 1 or 2), -R b -S(O) t R a (where t is 1 or 2) and -R b -S(O) t N(R a )2 (where t is 1 or 2), where each R a Independently, each R is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl. b Independently, it is a direct bond or a straight-chain or branched alkylene or alkenylene chain, and R c It is a straight-chain or branched alkylene or alkenylene chain.

[0053] "Aryloxy group" refers to a group of the formula –O-aryl that is bonded by an oxygen atom, wherein the aryl group is as defined above.

[0054] "Aryl group" refers to the formula -R c -aryl groups, where R c It is an alkylene chain as defined above, such as methylene, ethylene, etc. The alkylene chain portion of the aralkyl group is optionally substituted as described above for alkylene chains. The aryl portion of the aralkyl group is optionally substituted as described above for aryl groups.

[0055] "Araneoxy group" refers to a group of the formula –O-aranealkyl group bonded by an oxygen atom, wherein the aranealkyl group is as defined above.

[0056] "Aryl" refers to the formula –R d -aryl groups, where R d It is an alkenyl chain as defined above. The aryl portion of the aryl group is optionally substituted as described above for the aryl group. The alkenyl chain portion of the aryl group is optionally substituted as defined above for the alkenyl group.

[0057] "Arotyne group" refers to the formula -R e -aryl groups, where R e It is an alkynyl chain as defined above. The aryl portion of the aryl group is optionally substituted as described above for the aryl group. The alkynyl chain portion of the aryl group is optionally substituted as defined above for the alkynyl chain.

[0058] "Cycloalkyl" refers to a stable, non-aromatic monocyclic or polycyclic hydrocarbon group consisting only of carbon and hydrogen atoms, including fused or bridged ring systems having three to fifteen carbon atoms. In some embodiments, the cycloalkyl group contains three to ten carbon atoms. In other embodiments, the cycloalkyl group contains five to seven carbon atoms. The cycloalkyl group is attached to the rest of the molecule by a single bond. The cycloalkyl group is saturated (i.e., containing only C-C single bonds) or partially unsaturated (i.e., containing one or more double or triple bonds). Examples of monocyclic cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In some embodiments, the cycloalkyl group contains three to eight carbon atoms (e.g., C3-C8 cycloalkyl). In other embodiments, the cycloalkyl group contains three to seven carbon atoms (e.g., C3-C7 cycloalkyl). In still other embodiments, the cycloalkyl group contains three to six carbon atoms (e.g., C3-C6 cycloalkyl). In some embodiments, the cycloalkyl group comprises three to five carbon atoms (e.g., C3-C5 cycloalkyl). In other embodiments, the cycloalkyl group comprises three to four carbon atoms (e.g., C3-C4 cycloalkyl). Partially unsaturated cycloalkyl groups are also referred to as "cycloalkenyl". Examples of monocyclic cycloalkenyl groups include, for example, cyclopentenyl, cyclohexenyl, cycloheptenyl, and cyclooctenyl. Polycyclic cycloalkyl groups include, for example, adamantyl, norbornyl (i.e., bicyclo[2.2.1]heptyl), norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, etc. Unless otherwise expressly stated in this specification, the term "cycloalkyl" is intended to include a cycloalkyl group optionally substituted with one or more substituents selected from alkyl, alkenyl, ynyl, haloyl, haloalkyl, oxo, thio, cyano, nitro, aryl, aralkyl, aryl-alkenyl, arylynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a -R b -OC(O)-R a -R b -OC(O)-OR a -R b -OC(O)-N(R a )2、-R b -N(R a )2、-R b -C(O)R a -R b -C(O)OR a -R b -C(O)N(R a )2、-R b -OR c -C(O)N(R a )2、-R b-N(R a )C(O)OR a -R b -N(R a )C(O)R a -R b -N(R a S(O) t R a (where t is 1 or 2), -R b -S(O) t OR a (where t is 1 or 2), -R b -S(O) t R a (where t is 1 or 2) and -R b -S(O) t N(R a )2 (where t is 1 or 2), where each R a Independently, each R is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl or heteroarylalkyl. b Independently, it is a direct bond or a straight-chain or branched alkylene or alkenylene chain, and R c It is a straight-chain or branched alkylene or alkenylene chain.

[0059] "Halogen" or "halogen" refers to a substituent of bromine, chlorine, fluorine, or iodine.

[0060] "Halogenated alkyl" refers to an alkyl group as defined above that is substituted with one or more halogenated groups as defined above.

[0061] "Haloalkoxy" refers to an alkoxy group as defined above that is substituted by one or more halogen groups as defined above.

[0062] "Fluoroalkyl" is an alkyl group as defined above, substituted with one or more fluorine groups as defined above, such as trifluoromethyl, difluoromethyl, fluoromethyl, 2,2,2-trifluoroethyl, 1-fluoromethyl-2-fluoroethyl, etc. The alkyl portion of the fluoroalkyl group may optionally be substituted as defined above for alkyl groups.

[0063] "Heterocyclic alkyl" refers to a stable 3- to 18-membered non-aromatic cyclic group comprising two to twelve carbon atoms and one to six heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise expressly stated in this specification, a heterocyclic alkyl group is a monocyclic, bicyclic, tricyclic, or tetracyclic cyclic system, including fused, spiro, or bridged cyclic systems. The heteroatoms in the heterocyclic alkyl group are optionally oxidized. If present, one or more nitrogen atoms are optionally quaternized. The heterocyclic alkyl group is partially or fully saturated. In some embodiments, the heterocyclic alkyl group is attached to the remainder of the molecule by any atom in the ring. Examples of such heterocyclic alkyl groups include, but are not limited to, dioxolane, thienyl[1,3]dithianyl, decahydroisoquinolinyl, imidazolinyl, imidazoalkyl, isothiazolinyl, isoxazolinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperidinyl, 2-oxopiperidinyl, 2-oxopiperidinyl, 2-oxopiperylalkyl, oxazolinyl, piperidinyl, piperazine, 4-piperidinoneyl, pyrrolylalkyl, pyrazolyl, quininecycloyl, thiazolinyl, tetrahydrofuranyl, trithiazolinyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Unless otherwise expressly stated in this specification, the term "heterocyclic alkyl" is intended to include a heterocyclic alkyl group as defined above, optionally substituted with one or more substituents selected from alkyl, alkenyl, ynyl, haloyl, haloalkyl, oxo, thio, cyano, nitro, aryl, aralkyl, aryl-alkenyl, arylynyl, cycloalkyl, heterocyclic alkyl, heteroaryl, heteroarylalkyl, -R b -OR a -R b -OC(O)-R a -R b -OC(O)-OR a -R b -OC(O)-N(R a )2、-R b -N(R a )2、-R b -C(O)R a -R b -C(O)OR a -R b -C(O)N(R a )2、-R b -OR c -C(O)N(R a )2、-R b -N(R a )C(O)OR a -Rb -N(R a )C(O)R a -R b -N(R a S(O) t R a (where t is 1 or 2), -R b -S(O) t OR a (where t is 1 or 2), -R b -S(O) t R a (where t is 1 or 2) and -R b -S(O) t N(R a )2 (where t is 1 or 2), where each R a Independently, each R is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl. b Independently, it is a direct bond or a straight-chain or branched alkylene or alkenylene chain, and R c It is a straight-chain or branched alkylene or alkenylene chain.

[0064] "Heteroaryl" refers to a group derived from a 3- to 18-membered aromatic ring group, containing one to seventeen carbon atoms and one to six heteroatoms selected from nitrogen, oxygen, and sulfur. As used herein, a heteroaryl group is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2)π– electron system according to Hückel's theory. Heteroaryls include fused or bridged ring systems. The heteroatoms in the heteroaryl group are optionally oxidized. If present, one or more nitrogen atoms are optionally quaternized. The heteroaryl group is attached to the rest of the molecule via any atom in the ring. Unless otherwise expressly stated in this specification, the term "heteroaryl" is intended to include a heteroaryl group as defined above, optionally substituted with one or more substituents selected from alkyl, alkenyl, ynyl, haloyl, haloalkyl, oxo, thio, cyano, nitro, aryl, aralkyl, aryl-alkenyl, arylynyl, cycloalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, -R b -OR a -R b -OC(O)-R a -R b -OC(O)-OR a -R b -OC(O)-N(R a )2、-R b -N(R a )2、-R b-C(O)R a -R b -C(O)OR a -R b -C(O)N(R a )2、-R b -OR c -C(O)N(R a )2、-R b -N(R a )C(O)OR a -R b -N(R a )C(O)R a -R b -N(R a S(O) t R a (where t is 1 or 2), -R b -S(O) t OR a (where t is 1 or 2), -R b -S(O) t R a (where t is 1 or 2) and -R b -S(O) t N(R a )2 (where t is 1 or 2), where each R a Independently, each R is hydrogen, alkyl, haloalkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl, heteroaryl, or heteroarylalkyl. b Independently, it is a direct bond or a straight-chain or branched alkylene or alkenylene chain, and R c It is a straight-chain or branched alkylene or alkenylene chain.

[0065] "N-Heteroaryl" refers to a heteroaryl group as defined above containing at least one nitrogen atom, wherein the connection point between the heteroaryl group and the rest of the molecule is through a nitrogen atom in the heteroaryl group. The N-heteroaryl group may optionally be substituted as described above for heteroaryl groups.

[0066] "C-heteroaryl" refers to a heteroaryl group as defined above, wherein the connection point between the heteroaryl group and the rest of the molecule is through a carbon atom in the heteroaryl group. The C-heteroaryl group may be optionally substituted as described above for heteroaryl groups.

[0067] "Heteroaryl group" refers to a group of the formula –O-heteroaryl that is bonded by an oxygen atom, wherein the heteroaryl group is as defined above.

[0068] "Heteroarylalkyl" refers to the formula –R c - A heteroaryl group, wherein R cIt is an alkylene chain as defined above. If the heteroaryl group is a nitrogen-containing heteroaryl group, the heteroaryl group is optionally attached to an alkyl group at the nitrogen atom. The alkylene chain of the heteroarylalkyl group is optionally substituted as defined above for alkylene chains. The heteroaryl moiety of the heteroarylalkyl group is optionally substituted as defined above for heteroaryl groups.

[0069] "Heteroarylalkoxy" refers to the formula –OR c - A heteroaryl group bonded by an oxygen atom, wherein R c It is an alkylene chain as defined above. If the heteroaryl group is a nitrogen-containing heteroaryl group, the heteroaryl group is optionally attached to an alkyl group at the nitrogen atom. The alkylene chain of the heteroaryl alkoxy group is optionally substituted as defined above for alkylene chains. The heteroaryl moiety of the heteroaryl alkoxy group is optionally substituted as defined above for heteroaryl groups.

[0070] In some embodiments, the compounds of this disclosure contain one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomers, defined by absolute stereochemistry as (R)- or (S)-. Unless otherwise stated, it is intended that all stereoisomers of the compounds of this disclosure be considered by way of this disclosure. When the compounds described herein contain an alkene double bond, and unless otherwise stated, this disclosure is intended to include E and Z geometric isomers (e.g., cis or trans). Likewise, it is intended to include all possible isomers, as well as their racemic and optically pure forms, and all tautomers. The term “geometric isomer” refers to the E or Z geometric isomer of the alkene double bond (e.g., cis or trans). The term “positional isomer” refers to a structural isomer surrounding a central ring, such as ortho, meta, and para isomers surrounding a benzene ring.

[0071] A "tautomer" is a molecule in which a proton may be transferred from one atom of the molecule to another atom of the same molecule. In some embodiments, the compounds presented herein exist as tautomers. Where tautomerization is possible, a chemical equilibrium of tautomers will exist. The exact proportions of tautomers depend on several factors, including physical state, temperature, solvent, and pH. Some examples of tautomer equilibria include:

[0072]

[0073] "Optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the case where the event or situation occurs and the case where it does not occur. For example, "optionally substituted aryl" means that the aryl group is substituted or not substituted, and the description includes both substituted and unsubstituted aryl groups.

[0074] "Pharmaceutical-acceptable salts" include both acid addition salts and base addition salts.

[0075] "Pharmaceutically acceptable acid addition salts" refer to salts that retain the biological effectiveness and properties of the free base, are not biologically or otherwise undesirable, and are formed from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, hydroiodic acid, hydrofluoric acid, and phosphorous acid. This also includes salts formed from organic acids, such as aliphatic monocarboxylic acids and dicarboxylic acids, phenyl-substituted alkanes, hydroxyalkanes, alkanediacids, aromatic acids, aliphatic and aromatic sulfonic acids, and including, for example, acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Therefore, exemplary salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrophosphates, dihydrophosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, trifluoroacetates, propionates, caprylates, isobutyrates, oxalates, malonates, succinates, caprylates, sebacic acid salts, fumarates, maleates, mandelates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, phthalates, benzenesulfonates, toluenesulfonates, phenylacetates, citrates, lactates, malates, tartrates, methanesulfonates, etc. Salts of amino acids, such as arginine salts, gluconates, and galacturons, are also considered (see, for example, Berge SM et al., "Pharmaceutical Salts," Journal of Pharmaceutical Science, 66:1-19 (1997)). Acid addition salts of basic compounds are prepared by contacting a free base with a sufficient amount of the desired acid to produce a salt.

[0076] "Pharmaceutically acceptable base addition salts" are those salts that retain the bioavailability and properties of the free acid, and are not biologically or otherwise undesirable. These salts are prepared by adding an inorganic or organic base to the free acid. In some embodiments, pharmaceutically acceptable base addition salts are formed from metals or amines, such as alkali metals and alkaline earth metals or organic amines. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Salts derived from organic bases include, but are not limited to, the following: primary amines, secondary amines, and tertiary amines; substituted amines, including naturally occurring substituted amines; cyclic amines; and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, N,N-dibenzylethylenediamine, chloroprocaine, heparin, choline, betaine, ethylenediamine, ethylenediphenylamine, N-methylglucosamine, glucosamine, methylglucosamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. See Berge et al., ibid.

[0077] The term "object" or "patient" includes mammals. Examples of mammals include, but are not limited to, any member of the mammal class: humans, non-human primates such as chimpanzees and other ape and monkey species; farm animals such as cattle, horses, sheep, goats, and pigs; livestock such as rabbits, dogs, and cats; and laboratory animals including rodents such as rats, mice, and guinea pigs. In one respect, the mammal is human.

[0078] As used herein, the terms “treatment,” “management,” “relief,” or “improvement” are used interchangeably. These terms refer to methods of obtaining a beneficial or desired outcome, including but not limited to, therapeutic benefits and / or preventive benefits. A “therapeutic benefit” means the eradication or improvement of an underlying condition that is being treated. Furthermore, a therapeutic benefit is obtained by eradicating or improving one or more physical symptoms associated with the underlying condition, resulting in an observed improvement in the patient, even if the patient still has the underlying condition. For preventive benefits, the composition is administered to patients at risk of developing a specific disease, or to patients who report one or more physical symptoms of a disease, even if the disease has not yet been diagnosed.

[0079] compound

[0080] The compound of formula (I) described herein is an SF-1 modulator. In some embodiments, the compound of formula (I) described herein is an SF-1 antagonist. In some embodiments, the compound of formula (I) described herein and compositions comprising these compounds are SF-1 antagonists that can be used to treat cancer.

[0081] In some implementations, the compound is of formula (I):

[0082]

[0083] in:

[0084] X is a bond or a C1-C6 alkylene group;

[0085] R 1 Selected from C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, -CH2C 6-10 Aryl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, -CH2C 6-10 Aryl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally surrounded by one, two, three, four or five R groups. 4 replace;

[0086] R 2 Selected from C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 3-8 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally surrounded by one, two, three, four or five R groups. 5 replace;

[0087] R 3 It is hydrogen, C1-C6 alkyl, C1-C6 haloalkyl or C 3-8 cycloalkyl;

[0088] Each R 4 and each R 5 Each is independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl, C 1-9 Mixed aromatics, -OR 6 -SR 6 -C(O)OR 6 -OC(O)N(R)6 (R) 7 ), -N(R 8 )C(O)N(R 6 (R) 7 ), -N(R 8 )C(O)R 9 -N(R) 8 )C(O)OR 9 -N(R) 8 )S(O)2R 9 -C(O)R 9 -OC(O)R 9 -C(O)N(R) 6 (R) 7 -C(O)C(O)N(R) 6 (R) 7 ), -S(O)R 9 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 ), where C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group may optionally be substituted by one, two, or three groups selected from the following: halogen, -CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl, C 1-9 Mixed aromatics, -OR 10 -SR 10 -C(O)OR 10 -OC(O)N(R) 10 (R) 11 ), -N(R 12 )C(O)N(R 10 (R) 11 ), -N(R 12 )C(O)R 13 -N(R) 12 )C(O)OR 13 -N(R) 12 )S(O)2R 13 -C(O)R 13 -OC(O)R 13-C(O)N(R) 10 (R) 11 -C(O)C(O)N(R) 10 (R) 11 ), -S(O)R 13 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 );

[0089] Each R 6 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, hydroxyl, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0090] Each R 7 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0091] Each R 8 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0092] Each R 9 Selected independently from C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0093] Each R 10 Independently selected from hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0094] Each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups;

[0095] Each R 12 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups; and

[0096] Each R 13 Selected independently from C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 heteroaryl, of which C 1-6 Alkyl, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 The heteroaryl group is optionally substituted by one, two, or three groups selected from the following: halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 3-6 cycloalkyl, C 2-9 Heterocyclic alkyl, C 6-10 Aryl and C 1-9 Mixed aromatics;

[0097] Or its pharmaceutically acceptable salts or solvates.

[0098] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 6-10 aryl groups, which are optionally composed of one, two, three, four, or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is optionally surrounded by one, two, three, four, or five R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 4 Replace, where each R 4 Independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R1 It is a phenyl group, which is optionally separated by one or two R groups. 4 Replace, where each R 4 Independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is optionally separated by an R 4 Replace, where R 4 Selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is optionally separated by one or two R groups. 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is reacted with one or two R groups. 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is optionally separated by an R 4 Replace, where R 4 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is reacted with an R 4 Replace, where R 4 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is reacted with an R 4 Replace, where R 4 It is C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is reacted with an R 4 Replace, where R 4 It is a halogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is reacted with an R 4 Replace, where R 4 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 1 It is a phenyl group, which is reacted with an R 4 Replace, where R 4 Yes - OR 6 .

[0099] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is an unsubstituted phenyl group.

[0100] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 4Replace, where each R 4 Independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are optionally separated by one or two R groups 4 Replace, where each R 4 Independently selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are optionally divided by an R 4 Replace, where R 4 Selected from halogens, -CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 and -S(O)2N(R 6 (R) 7 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are optionally separated by one or two R groups 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are substituted by one or two R groups 4 Replace, where each R 4 Independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are optionally divided by an R 4 Replace, where R 4 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are oxidized by an R 4 Replace, where R 4 Selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are oxidized by an R 4 Replace, where R 4 It is C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 1-9 heteroaryl groups, which are oxidized by an R 4 Replace, where R 4 It is a halogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 1 It is C 1-9 heteroaryl groups, which are oxidized by an R 4 Replace, where R 4It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 1-9 heteroaryl groups, which are oxidized by an R 4 Replace, where R 4 Yes - OR 6 In some embodiments, the compound of formula (I) described herein, wherein R 1 It is C 1-9 heteroaryl, the C 1-9 The heteroaryl group is pyridyl.

[0101] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is the unreplaced C 1-9 heteroaryl. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is an unsubstituted pyridinyl group.

[0102] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is -CH2C 6-10 aryl groups, which are optionally composed of one, two, or three R groups 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is benzyl, which is optionally surrounded by one, two or three R. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is an unsubstituted benzyl group.

[0103] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, or three R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is the unreplaced C 2-9 Heterocyclic alkyl groups.

[0104] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is C 3-8 Cycloalkyl groups, optionally composed of one, two, or three R groups. 4 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 1 It is the unreplaced C 3-8 Cycloalkyl.

[0105] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 3-8 Cycloalkyl groups, optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is optionally divided by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -CN, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 -S(O)2N(R) 6 (R) 7 ) and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from the following: -OR 10 -C(O)OR 10 -C(O)R 13 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, C 1-6 Halogenated alkyl groups, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10-C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is optionally divided by one or two R groups. 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: halogen, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is optionally divided by an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace and R 5 Yes - OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Yes - OR 6 And R 6 Selected from hydrogen and C 1-6 An alkyl group, optionally substituted with one, two, or three groups selected from halogens and hydroxyl groups. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Yes - OR 6 And R 6 C is a carbon that is replaced by one, two, or three halogens. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is a C that is replaced by a hydroxyl group. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R5 Replace, R 5 Yes - OR 6 And R 6 It is the unreplaced C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, and R 5 It is C 1-6 Alkyl group, which is optionally substituted with a group selected from: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 It is C 1-6 Alkyl group, which is optionally substituted with a group selected from: -OR 10 -C(O)OR 10 and -C(O)N(R) 10 (R) 11 ), and R 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is bounded by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is an unsubstituted cyclohexyl group.

[0106] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 6-10 aryl groups, which are optionally composed of one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -CN, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 -S(O)2N(R) 6 (R) 7 ) and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from the following: -OR 10 -C(O)OR 10 -C(O)R 13 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, C 1-6 Halogenated alkyl groups, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is optionally separated by one or two R groups. 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: halogen, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is optionally separated by an R5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace and R 5 Yes - OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Yes - OR 6 And R 6 Selected from hydrogen and C 1-6 An alkyl group, optionally substituted with one, two, or three groups selected from halogens and hydroxyl groups. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Yes - OR 6 And R 6 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Yes - OR 6 And R 6 C is a carbon that is replaced by one, two, or three halogens. 1-6Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Yes - OR 6 And R 6 It is a C that is replaced by a hydroxyl group. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Yes - OR 6 And R 6 It is the unreplaced C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, and R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 and -C(O)N(R) 10 (R) 11 ), and R 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, R5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is reacted with an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is an unsubstituted phenyl group.

[0107] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, three, four, or five R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, or three R groups. 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -CN, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7-S(O)2R 9 -S(O)2N(R) 6 (R) 7 ) and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from the following: -OR 10 -C(O)OR 10 -C(O)R 13 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, C 1-6 Halogenated alkyl groups, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, optionally surrounded by one, two, or three R groups. 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, optionally marked with one or two R groups. 5Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: halogen, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are optionally marked with an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace and R 5 Yes - OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R5 Replace, R 5 Yes - OR 6 And R 6 Selected from hydrogen and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from halogens and hydroxyl groups. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Yes - OR 6 And R 6 C is a carbon that is replaced by one, two, or three halogens. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is C replaced by a hydroxyl group. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is the unreplaced C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, and R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 and -C(O)N(R) 10 (R) 11 ), and R 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 2-9 Heterocyclic alkyl groups, which are formed by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is the unreplaced C2-9 Heterocyclic alkyl groups. In some embodiments, compounds of formula (I) described herein, wherein R... 2 It is C 2-9 Heterocyclic alkyl, the C 2-9 The heterocyclic alkyl group is a tetrahydropyranyl group.

[0108] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 5 Substitution. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 5 Replace, and each R 5 Independently selected from halogens, -CN, C 1-6 Halogenated alkyl groups, -OR 6 -C(O)OR 6 -C(O)R 9 -C(O)N(R) 6 (R) 7 -S(O)2R 9 -S(O)2N(R) 6 (R) 7 ) and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from the following: -OR 10 -C(O)OR 10 -C(O)R 13 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 5 Replace, and each R 5 Independently selected from halogens, C 1-6 Halogenated alkyl groups, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R)11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are optionally separated by one, two, or three R groups 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are optionally separated by one or two R groups 5 Replace, and each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: halogen, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are optionally divided by an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, and R 5 Selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace and R 5 Yes - OR 6 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Yes - OR 6 And R 6 Selected from hydrogen and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with one, two, or three groups selected from halogens and hydroxyl groups. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Yes - OR 6 And R 6 C is a carbon that is replaced by one, two, or three halogens. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Yes - OR 6And R 6 It is a C that is replaced by a hydroxyl group. 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Yes - OR 6 And R 6 It is the unreplaced C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, and R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 ) and -S(O)2R 13 In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 It is C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 and -C(O)N(R) 10 (R) 11 ), and R 10 Selected from hydrogen, C 1-6 Alkyl and C 1-6 Haloalkyl. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Is it -OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 Is it -OR 10Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 1-9 heteroaryl groups, which are oxidized by an R 5 Replace, R 5 It is -C(O)OR 10 Replacement C 1-6 Alkyl, and R 10 It is C 1-6 Alkyl group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein R... 2 It is the unreplaced C 1-9 Mixed aromatic compounds.

[0109] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein each R... 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.

[0110] In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R... 3 It is hydrogen. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 It is a C1-C6 alkyl group. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 It is a C1-C6 haloalkyl group. In another embodiment, it is a compound of formula (I), or a pharmaceutically acceptable salt thereof, wherein R 3 It is C 3-8 Cycloalkyl.

[0111] In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is a bond. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is a C1-C6 alkylene group. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is -C(CH3)2-. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is -C(H)(CH3)-. In another embodiment, it is a compound of formula (I) or a pharmaceutically acceptable salt thereof, wherein X is -CH2-.

[0112] The further implementation schemes provided herein include combinations of one or more specific implementation schemes as described above.

[0113] In some embodiments, the compounds are selected from the following:

[0114]

[0115]

[0116] Or its pharmaceutically acceptable salt.

[0117] Preparation of compounds

[0118] The compounds used in the reactions described herein were prepared according to organic synthesis techniques, starting with commercially available chemicals and / or compounds described in chemical literature."Commercially available chemicals" were obtained from standard commercial sources, including Acros Organics (Geel, Belgium), Aldrich Chemical (Milwaukee, WI, including Sigma Chemical and Fluka), Apin Chemicals Ltd. (Milton Park, UK), Ark Pharm, Inc. (Libertyville, IL), Avocado Research (Lancashire, U.K.), BDH Inc. (Toronto, Canada), Bionet (Cornwall, U.K.), Chemservice Inc. (West Chester, PA), Combi-blocks (San Diego, CA), Crescent Chemical Co. (Hauppauge, NY), eMolecules (San Diego, CA), Fisher Scientific Co. (Pittsburgh, PA), Fisons Chemicals (Leicestershire, UK), Frontier Scientific (Logan, UT), ICN Biomedicals, Inc. (Costa Mesa, CA), Key Organics (Cornwall, U.K.), Lancaster Synthesis (Windham, NH), Matrix Scientific, (Columbia, SC), Maybridge Chemical Co. Ltd. (Cornwall, U.K.), Parish Chemical Co. (Orem, UT), Pfaltz & Bauer, Inc. (Waterbury, CN), Polyorganix (Houston, TX), Pierce Chemical Co. (Rockford, IL), Riedel de Haen AG (Hanover, Germany), Ryan Scientific, Inc. (Mount Pleasant, SC), Spectrum Chemicals (Gardena, CA), Sundia Meditech, (Shanghai, China), TCI America (Portland, OR), Trans World Chemicals, Inc. (Rockville, MD) and WuXi (Shanghai, China).

[0119] Suitable references and papers that detail the synthesis of reactants that can be used to prepare the compounds described herein, or references to literature describing such preparations, include, for example, "Synthetic Organic Chemistry," John Wiley & Sons, Inc., New York; SRSandler et al., "Organic Functional Group Preparations," 2nd ed., Academic Press, New York, 1983; HO House, "Modern Synthetic Reactions," 2nd ed., WABenjamin, Inc., Menlo Park, Calif., 1972; TL Gilchrist, "Heterocyclic Chemistry," 2nd ed., John Wiley & Sons, New York, 1992; J. March, "Advanced Organic Chemistry: Reactions, Mechanisms and Structure," 4th ed., Wiley-Interscience, New York, 1992. Other suitable references and papers that detail the synthesis of reactants that can be used to prepare the compounds described herein, or that provide references to literature describing such preparations, include, for example, Fuhrhop, J. and Penzlin G. "Organic Synthesis: Concepts, Methods, Starting Materials", 2nd ed., Revised and Expanded (1994) John Wiley & Sons ISBN: 3-527-29074-5; Hoffman, RV. "Organic Chemistry, An Intermediate Text" (1996) Oxford University Press, ISBN 0-19-509618-5; Larock, RC. "Comprehensive Organic Transformations: A Guide to Functional Group Preparations", 2nd ed. (1999) Wiley-VCH, ISBN: 0-471-19031-4; March, J."Advanced Organic Chemistry: Reactions, Mechanisms, and Structure", 4th Edition (1992), John Wiley & Sons, ISBN: 0-471-60180-2; Otera, J. (Editor), "Modern Carbonyl Chemistry" (2000), Wiley-VCH, ISBN: 3-527-29871-1; Patai, S., "Patai's 1992 Guide to the Chemistry of Functional Groups" (1992), Interscience, ISBN: 0-471-93022-9; Solomons, T.W.G., "Organic Chemistry", 7th Edition (2000), John Wiley & Sons, ISBN: 0-471-19095-0; Stowell, J.C., "Intermediate Organic Chemistry", 2nd Edition (1993), Wiley-Interscience, ISBN: 0-471-57456-2; "Industrial Organic Chemicals: Starting Materials and Intermediates: An Ullmann's Encyclopedia" (1999), John Wiley & Sons, ISBN: 3-527-29645-X, 8 volumes in total; "Organic Reactions" (1942 - 2000), John Wiley & Sons, over 55 volumes; and "Chemistry of Functional Groups", John Wiley & Sons, 73 volumes in total.

[0120] Specific and similar reactants are also identified by an index of known chemicals compiled by the Chemical Abstracts Service of the American Chemical Society, which is available in most public and university libraries as well as through online databases (American Chemical Society, Washington, DC). Known but not commercially available chemicals in the catalogue are optionally prepared by custom chemical synthesis companies, many of which are standard chemical suppliers (e.g., those listed above) that offer custom synthesis services. A reference for the preparation and selection of pharmaceutical salts for the compounds described herein is PHStahl & C.G. Wermuth, "Handbook of Pharmaceutical Salts," Verlag Helvetica Chimica Acta, Zurich, 2002.

[0121] Further forms of the compounds disclosed herein

[0122] Isomers

[0123] Furthermore, in some embodiments, the compounds described herein exist as geometric isomers. In some embodiments, the compounds described herein have one or more double bonds. The compounds presented herein include all cis, trans, syn, anti, engegen (E), and zusammen (Z) isomers and corresponding mixtures thereof. In some cases, the compounds exist as tautomers. The compounds described herein include all possible tautomers within the formula described herein. In some cases, the compounds described herein have one or more chiral centers, and each center exists as an R configuration or an S configuration. The compounds described herein include all diastereomers, enantiomers, and epimers, and corresponding mixtures thereof. In additional embodiments of the compounds and methods provided herein, mixtures of enantiomers and / or diastereomers produced by a single preparation step, combination, or interconversion can be used for the applications described herein. In some embodiments, the compounds described herein are prepared as optically pure enantiomers by chiral chromatographic resolution of racemic mixtures. In some embodiments, the compounds described herein are prepared as their respective stereoisomers by reacting a racemic mixture of the compounds with an optically active resolving agent to form a pair of diastereomers, separating the diastereomers, and recovering the optically pure enantiomers. In some embodiments, dissociable complexes (e.g., crystalline diastereomer salts) are preferred. In some embodiments, the diastereomers have different physical properties (e.g., melting point, boiling point, solubility, reactivity, etc.) and are separated by utilizing these differences. In some embodiments, the diastereomers are separated by chiral chromatography, or preferably by a separation / resolution technique based on solubility differences. In some embodiments, the optically pure enantiomers are then recovered along with the resolving agent by any practical method that does not result in racemization.

[0124] Labeled compounds

[0125] In some embodiments, the compounds described herein are present as isotopically labeled forms. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically labeled compounds. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such isotopically labeled compounds as pharmaceutical compositions. Thus, in some embodiments, the compounds disclosed herein include isotopically labeled compounds that are exactly the same as those listed herein, but in fact, one or more atoms are replaced by atoms having an atomic mass or mass number different from those commonly found in nature. Examples of isotopes incorporated into the compounds described herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, respectively such as2 H, 3 H, 13 C 14 C l5 N、 18 O、 17 O、 31 P, 32 P, 35 S, 18 F and 36 Cl. Compounds described herein containing the aforementioned isotopes and / or other isotopes, as well as their pharmaceutically acceptable salts, esters, solvates, hydrates, or derivatives, are within the scope of this invention. Certain isotope-labeled compounds, such as those doped with radioactive isotopes such as… 3 H and 14 Compounds of C can be used for the determination of drug and / or substrate tissue distribution. Tritium (i.e., 3 H) and carbon-14 (i.e., ... 14 C) Isotopes are particularly preferred due to their ease of preparation and detectability. Furthermore, heavy isotopes such as deuterium (i.e., 2 H) substitution, due to its higher metabolic stability, such as increased in vivo half-life or reduced dose requirement, produces certain therapeutic advantages. In some embodiments, the isotopically labeled compound, its pharmaceutically acceptable salt, ester, solvate, hydrate, or derivative is prepared by any suitable method.

[0126] In some embodiments, the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labeling, or chemiluminescent labeling.

[0127] Pharmaceutically acceptable salts

[0128] In some embodiments, the compounds described herein are present as pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods of treating a disease by administering such pharmaceutically acceptable salts as a pharmaceutical composition.

[0129] In some embodiments, the compounds described herein have acidic or basic groups, and thus react with a variety of inorganic or organic bases, as well as any of inorganic and organic acids, to form pharmaceutically acceptable salts. In some embodiments, these salts are prepared in situ during the final isolation and purification of the compounds described herein, or by reacting the purified free form of the compound with a suitable acid or base, and then isolating the salts thus formed.

[0130] solvates

[0131] In some embodiments, the compounds described herein are present as solvates. In some embodiments, methods of treating a disease are performed by applying such solvates. Methods of treating a disease by applying such solvates as pharmaceutical compositions are further described herein.

[0132] The solvates contain stoichiometric or non-stoichiometric amounts of solvent and, in some embodiments, are formed during crystallization with pharmaceutically acceptable solvents such as water, ethanol, etc. When the solvent is water, a hydrate is formed, or when the solvent is an alcohol, an alcohol is formed. The solvates of the compounds described herein are readily prepared or formed in the processes described herein. By way of example only, the hydrates of the compounds described herein are readily prepared by recrystallization from an aqueous / organic solvent mixture using organic solvents, including but not limited to dioxane, tetrahydrofuran, or MeOH. Furthermore, the compounds provided herein exist in both unsolvated and solvated forms. Generally, for the purposes of the compounds and methods provided herein, the solvated form is considered equivalent to the unsolvated form.

[0133] Pharmaceutical Composition

[0134] In some embodiments, the compound of formula (I) as described herein is administered as a pure chemical. In some embodiments, the compound of formula (I) described herein is combined with a pharmaceutically suitable or acceptable vehicle (also referred to herein as a pharmaceutically suitable (or acceptable) excipient, a physiologically suitable (or acceptable) excipient, or a physiologically suitable (or acceptable) vehicle) selected based on the chosen route of administration and standard pharmaceutical practice, which is described, for example, in Remington: The Science and Practice of Pharmacy (Gennaro, 21st edition. Mack Pub. Co., Easton, PA (2005)).

[0135] Therefore, the pharmaceutical compositions provided herein comprise at least one compound of formula (I) described herein, or a stereoisomer thereof, a pharmaceutically acceptable salt, hydrate, solvate, or N oxide, and one or more pharmaceutically acceptable carriers. A carrier (or excipient) is acceptable or suitable if it is compatible with the other components of the composition and is harmless to the recipient (i.e., the object) of the composition.

[0136] One embodiment provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0137] Another embodiment provides a pharmaceutical composition consisting essentially of a pharmaceutically acceptable excipient and a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0138] In some embodiments, compounds of formula (I) as described herein are substantially pure because they contain less than about 5%, less than about 1%, or less than about 0.1% of other small organic molecules, such as contaminating intermediates or byproducts generated in one or more steps of, for example, synthetic methods.

[0139] In some embodiments, the compounds of formula (I) described herein are formulated for oral, rectal, topical, buccal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous), vaginal, ocular, or aerosol administration, although the most suitable form of administration in any given case will depend on the extent and severity of the condition being treated and the nature of the particular compound used. For example, the disclosed compositions are formulated as unit doses and / or formulated for oral or subcutaneous administration.

[0140] Exemplary pharmaceutical compositions are used in the form of pharmaceutical formulations, such as solid, semi-solid, or liquid forms, comprising one or more disclosed compounds as active ingredients and a mixture of an organic or inorganic carrier or excipient suitable for external, enteral, or parenteral application. In some embodiments, the active ingredient is compounded with a generally non-toxic, pharmaceutically acceptable carrier, such as that used in tablets, pills, capsules, suppositories, solutions, emulsions, suspensions, and any other suitable form of use. The pharmaceutical composition comprises an amount of the active subject compound sufficient to produce the desired effect on the course or condition of a disease.

[0141] In some embodiments for preparing solid compositions such as tablets, the main active ingredient is mixed with a drug carrier, such as conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate, or gum, and other drug diluents, such as water, to form a solid preformation composition containing a homogeneous mixture of the disclosed compound or a non-toxic, pharmaceutically acceptable salt thereof. When these preformation compositions are referred to as homogeneous, it means that the active ingredient is uniformly dispersed throughout the composition so that the composition can be easily subdivided into equally effective unit dosage forms, such as tablets, pills, and capsules.

[0142] In solid dosage forms (capsules, tablets, pills, sugar-coated pills, powders, granules, etc.) intended for oral administration, the subject composition is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and / or any of the following: (1) fillers or extenders, such as starch, cellulose, microcrystalline cellulose, silicified microcrystalline cellulose, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethyl cellulose, hydroxypropyl methylcellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and / or gum arabic; (3) preservatives. (3) Wetting agents, such as glycerin; (4) Disintegrants, such as crospovidone, croscarmellose sodium, glycolate starch sodium, agar, calcium carbonate, potato or cassava starch, alginate, certain silicates and sodium carbonate; (5) Slow solvents, such as paraffin; (6) Absorption enhancers, such as quaternary ammonium compounds; (7) Wetting agents, such as, for example, sodium docusate, cetyl alcohol and glyceryl monostearate; (8) Absorbents, such as kaolin and bentonite; (9) Lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate and mixtures thereof; and (10) Colorants. In the case of capsules, tablets and pills, in some embodiments, the composition contains a buffer. In some embodiments, similar type of solid compositions are also used as fillers in soft-filled and hard-filled gelatin capsules, using excipients such as lactose or milk sugar and high molecular weight polyethylene glycol.

[0143] In some embodiments, tablets are formed by compression or molding, optionally having one or more excipients. In some embodiments, compressed tablets are prepared using binders (e.g., gelatin or hydroxypropyl methylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or croscarmellose sodium), surfactants, or dispersants. In some embodiments, molded tablets are made by molding a mixture of a subject composition wetted with an inert liquid diluent in a suitable machine. In some embodiments, tablets and other solid dosage forms such as sugar-coated pills, capsules, granules, and pellets are scratched and coated with coatings and shells, such as enteric coatings and other coatings.

[0144] Compositions for inhalation or inhalation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, as well as powders. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the subject composition, in some embodiments, the liquid dosage form contains an inert diluent, such as, for example, water or other solvents, a solubilizer, and an emulsifier, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, oils (optionally, cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofuranol, fatty acid esters of polyethylene glycol and sorbitol, cyclodextrins, and mixtures thereof.

[0145] In some embodiments, in addition to the subject composition, the suspension also contains suspending agents such as, for example, ethoxylated isostearyl alcohol, sorbitol polyoxyethylene and dehydrated sorbitol ester, microcrystalline cellulose, aluminum hydroxide, bentonite, agar, tragacanth gum and mixtures thereof.

[0146] In some embodiments, the formulation for rectal or vaginal administration is in the form of a suppository, which is prepared by mixing the subject composition with one or more suitable non-irritating excipients or carriers, including, for example, cocoa butter, polyethylene glycol, suppositories, or salicylates, which are solid at room temperature but liquid at body temperature, and thus will melt and release the active agent within the body cavity.

[0147] Dosage forms for transdermal application of the subject composition include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalers. In some embodiments, the active ingredient is mixed under sterile conditions with a pharmaceutically acceptable carrier and, if necessary, with any preservative, buffer, or propellant.

[0148] In some embodiments, in addition to the subject composition, ointments, pastes, creams, and gels contain excipients such as animal and vegetable fats, oils, waxes, paraffin wax, starch, tragacanth gum, cellulose derivatives, polyethylene glycol, siloxanes, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof.

[0149] In some embodiments, in addition to the subject composition, the powder and spray contain excipients such as lactose, talc, silica, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures of these substances. In some embodiments, the spray additionally contains conventional propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane.

[0150] In some embodiments, the compounds described herein are formulated as eye drops for ocular application.

[0151] The compositions and compounds disclosed herein are alternatively administered via aerosols. This is achieved by preparing aqueous aerosols, liposome formulations, or solid particles containing the compound. In some embodiments, non-aqueous (e.g., fluorocarbon propellants) suspensions are used. In some embodiments, sonic atomizers are used because they minimize exposure of the reagent to shear, which can lead to degradation of the compounds contained in the subject composition. Aqueous aerosols are typically prepared by formulating an aqueous solution or suspension of the subject composition with conventionally pharmaceutically acceptable carriers and stabilizers. Carriers and stabilizers vary depending on the requirements of the specific subject composition but typically include nonionic surfactants (Tween, Pluronic, or polyethylene glycol), sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars, or sugar alcohols. Aerosols are typically prepared from isotonic solutions.

[0152] Pharmaceutical compositions suitable for parenteral administration include a subject composition combined with one or more pharmaceutically acceptable sterile isotonic or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders that are reconstituted into sterile injectable solutions or dispersions prior to use, and in some embodiments containing antioxidants, buffers, antibacterial agents, solutes or suspending agents or thickeners that make the formulation isotonic with the blood of the intended recipient.

[0153] Examples of suitable aqueous and non-aqueous carriers for use in pharmaceutical compositions include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate and cyclodextrin. For example, in the case of dispersions, the desired particle size is maintained by using coating materials such as lecithin, and appropriate flowability is maintained by using surfactants.

[0154] Enteric drug formulations were also considered, including publicly disclosed compounds, enteric-coated substances, and their pharmaceutically acceptable carriers or excipients. Enteric-coated substances are polymers that are substantially insoluble in the acidic environment of the stomach and primarily soluble in intestinal fluids at a specific pH. The small intestine is the gastrointestinal tract (intestinal tract) between the stomach and large intestine, comprising the duodenum, jejunum, and ileum. The pH of the duodenum is approximately 5.5, the jejunum approximately 6.5, and the distal ileum approximately 7.5. Therefore, enteric substances are insoluble, for example, until the pH is about 5.0, about 5.2, about 5.4, about 5.6, about 5.8, about 6.0, about 6.2, about 6.4, about 6.6, about 6.8, about 7.0, about 7.2, about 7.4, about 7.6, about 7.8, about 8.0, about 8.2, about 8.4, about 8.6, about 8.8, about 9.0, about 9.2, about 9.4, about 9.6, about 9.8, or about 10.0. Exemplary enteric substances include cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate trimellitate, hydroxypropyl methylcellulose succinate, cellulose acetate succinate, cellulose acetate hexahydrophthalate, cellulose propionate phthalate, cellulose acetate maleate, cellulose acetate butyrate, cellulose acetate propionate, copolymers of methyl methacrylate and methyl methacrylate, methyl acrylate, copolymers of methyl methacrylate and methacrylate, copolymers of methyl vinyl ether and maleic anhydride (Gantrez ES series), ethyl methacrylate-methyl methacrylate-ethyl chlorotrimethylammonium acrylate copolymers, natural resins such as corn gluten, shellac, and copal collophorium, and several commercially available enteric dispersion systems (e.g., Eudragit L30D55, Eudragit FS30D, Eudragit...). L100, Eudragit S100, Kollicoat EMM30D, Estacryl 30D, Coateric, and Aquateric. The solubility of each of the above substances is known or readily determined in vitro.

[0155] The dosage of compositions comprising at least one compound of formula (I) described herein varies depending on the patient's (e.g., human) condition, i.e., stage of disease, general health status, age, and other factors.

[0156] The pharmaceutical composition is administered in a manner suitable for the disease to be treated (or prevented). The appropriate dosage and suitable duration and frequency of administration will be determined by factors such as the patient's condition, the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. Generally, an appropriate dosage and treatment regimen provides a quantity of the composition sufficient to provide therapeutic and / or preventive benefits (e.g., improved clinical outcomes, such as more frequent complete or partial remissions, or longer disease-free and / or overall survival, or reduced symptom severity). The optimal dosage is typically determined using experimental models and / or clinical trials. In some embodiments, the optimal dosage depends on the patient's weight, body mass, or blood volume.

[0157] method

[0158] In some embodiments, a method of treating cancer in a patient in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, a method of treating cancer in a patient in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotropin-secreting cell adenoma, and sex cord-stromal tumor. In some embodiments, a method of treating adrenocortical carcinoma in a patient in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, a method of treating ovarian cancer in a patient in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, a method of treating head and neck cancer in a patient in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating endometrial cancer in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating hormone-dependent prostate cancer in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating non-small cell lung cancer (NSCLC) in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating melanoma in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating pituitary gonadotropin-secreting cell adenoma in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, this is a method of treating sex cord-stromal tumors in patients in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some implementations, sex cord-stromal tumors are Leydig cell tumors.

[0159] In some embodiments, it is a method of treating an endocrine disorder in a mammal in need, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In another embodiment, it is a method of treating an endocrine disorder in a mammal in need, comprising administering to the mammal a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof, wherein the endocrine disorder is selected from endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome. In some embodiments, it is a method of treating endogenous Cushing's syndrome in a patient in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, it is a method of treating congenital adrenal hyperplasia in a patient in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, it is a method of treating polycystic ovary syndrome in a patient in need, comprising administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof.

[0160] In some implementations, a method of treating endometriomas or endometriosis in patients in need includes administering to the patient a therapeutically effective amount of a compound of formula (I) described herein, or a pharmaceutically acceptable salt thereof.

[0161] In some embodiments, the disclosed compound used by one or more of the foregoing methods is one of the genera, subgenera or specific compounds described herein, such as compounds of formula (I).

[0162] The disclosed compounds will be administered to patients (animals and humans) requiring such treatment at doses that will provide optimal pharmaceutical efficacy. It is understood that the required dose for any particular application will vary from patient to patient, depending not only on the specific compound or composition chosen, but also on the route of administration, the nature of the condition being treated, the patient's age and condition, any concurrent medications or special diets the patient will follow, and other factors. The appropriate dose is ultimately determined by the attending physician. For the treatment of the clinical conditions and diseases described above, the intended compounds of this disclosure are administered orally, subcutaneously, topically, parenterally, by inhalation spray, or rectally in dose-unit formulations containing conventional, non-toxic, pharmaceutically acceptable carriers, adjuvants, and mediators. Parenterally administration includes subcutaneous injection, intravenous or intramuscular injection, or infusion techniques.

[0163] The following examples are provided only as illustrations of various implementations and should not be construed as limiting the invention in any way.

[0164] Example

[0165] List of abbreviations

[0166] As used above and throughout the description of this invention, unless otherwise stated, the following abbreviations should be understood to have the following meanings:

[0167] ACN Acetonitrile

[0168] Bn benzyl

[0169] BOC or Boc tert-butyl carbamate

[0170] DCC (dichloroethane) (ClCH2CH2Cl)

[0171] DCM N,N'-Dicyclohexylcarbodiimide

[0172] DIPEA N,N-Diisopropylethylamine

[0173] DMAP 4-(N,N-dimethylamino)pyridine

[0174] DMF (dimethylformamide)

[0175] DMA N,N-dimethylacetamide

[0176] DMSO (dimethyl sulfoxide)

[0177] equivalent

[0178] EDCI 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide

[0179] Et Ethyl

[0180] EtOH (ethanol)

[0181] EtOAc (ethyl acetate)

[0182] HF hydrofluoric acid

[0183] HMDS bis(trimethylsilyl)amine

[0184] HPLC (High Performance Liquid Chromatography)

[0185] Me methyl

[0186] MeOH (methanol)

[0187] MMTr 4-Methoxytriphenylmethyl

[0188] MMTrCl 4-Methoxytriphenylmethyl chloride

[0189] MS mass spectrometry

[0190] NMM N-methylmorpholine

[0191] NMR (Nuclear Magnetic Resonance)

[0192] TBHP (tert-butyl hydroperoxide)

[0193] TEA Triethylamine

[0194] TFA (trifluoroacetic acid)

[0195] THF Tetrahydrofuran

[0196] TLC (Thin Layer Chromatography)

[0197] TBDMSCl tert-butyldimethylsilyl chloride

[0198] TMSCl trimethylsilyl chloride

[0199] TMSOTf trimethylsilyl trifluoromethanesulfonate

[0200] Chemical synthesis

[0201] Unless otherwise specified, reagents and solvents received authentic from commercial suppliers were used. Anhydrous solvents and oven-dried glassware were used for synthetic transformations sensitive to moisture and / or oxygen. Yields were not optimized. Reaction times are approximate and not optimized. Unless otherwise specified, column chromatography and thin-layer chromatography (TLC) were performed on silica gel. Spectra are in ppm (δ), and coupling constants (J) are in Hertz. For proton spectra, the solvent peak was used as a reference peak.

[0202] Example 1: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10)

[0203]

[0204] K₂CO₃ (80.6 g, 584.4 mmol) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (50 g, 292.2 mmol) in DMF (500 mL) at room temperature, followed by the addition of methyl iodomethane (20.0 mL, 321.4 mmol), and the reaction mixture was stirred at the same temperature for 16 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product. The crude product was purified by silica gel column chromatography to provide methyl 1-methyl-4-nitro-1H-pyrazole-5-carboxylate (2) (15.0 g, 27%) as a colorless liquid. 1 H NMR (400MHz, CDCl3): δ8.01 (s, 1H), 4.03 (s, 6H); MS (ESI) m / z 186.17 [M+H] + .

[0205] 10% Pd / C (3 g) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (2) (2 x 7.5 g, 40.54 mmol) in MeOH (75 mL), and the reaction mixture was stirred at room temperature under a hydrogen (balloon pressure) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth pad and the filtrate was concentrated to obtain methyl 4-amino-1H-pyrazole-5-carboxylate (3) (12.2 g, 97%). 1 H NMR (400MHz, DMSO): δ7.00(s,1H),4.98(brs,2H),3.89(s,3H),3.79(s,3H); MS(ESI)m / z 156.07[M+H] + .

[0206] DIPEA (72.5 mL, 393.50 mmol) and formamidin acetate (4) (9.80 g, 94.45 mmol) were added to a stirred solution of methyl 4-amino-1H-pyrazole-5-carboxylate (3) (12.2 g, 78.70 mmol) in n-butanol (122 mL) at room temperature, and the reaction was then stirred at 110 °C for 16 h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. The solid compound was ground with diethyl ether to provide 1-methyl-1,6-dihydro-7H-pyrazole[4,3-d]pyrimidin-7-one (5) (10.0 g, 84%) as a grayish-white solid. 1 H NMR (400MHz, DMSO-d6): δ7.95(s,1H), δ7.80(s,1H), δ4.18(s,3H); MS(ESI)m / z151.09[M+H] + .

[0207] NBS (15.41 g, 86.58 mmol) was added to a stirred solution of 1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (4) (10.0 g, 66.66 mmol) in DMF (200 mL) at room temperature, and the reaction mixture was then stirred at 80 °C for 16 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to provide 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (5) (11.0 g, 72%) as a grayish-white solid. 1 H NMR (400MHz, DMSO-d6): δ12.49(brs,1H),7.92(s,1H), δ4.18(s,3H); MS(ESI)m / z 229.06[M+H] + .

[0208] K₂CO₃ (13.25 g, 96.06 mmol) and tert-butyl 2-bromoacetate (6) (8.24 mL, 57.64 mmol) were added to a stirred solution of 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (5) (11.0 g, 48.24 mmol) in DMF (220 mL) at 0 °C and stirred for 16 h at room temperature. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 1 L). The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product, which was purified by rapid column chromatography to provide tert-butyl 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (12.0 g, 72%) as a white solid. 1 H NMR (400MHz, CDCl3): δ7.79(s,1H),4.61(s,2H),4.28(s,3H),1.49(s,9H); MS(ESI)m / z 343.22[M+H] + .

[0209] In a pressure vessel, at room temperature, Cs₂CO₃ (14.24 g, 43.71 mmol), Pd₂(dba)₃ (1.32 g, 1.45 mmol), Xantphos (843 mg, 1.45 mmol), and 4-(trifluoromethyl)aniline (8) (2.35 g, 14.619 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (7) (5.0 g, 14.619 mmol) in dioxane (100 mL). The solution was degassed again for 15 min, and the reaction mixture was heated to 100 °C for 5 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with ethyl acetate. The filtrate was concentrated under reduced pressure to provide a crude product, which was purified by silica gel column chromatography to obtain tert-butyl 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (9) (4.8 g, 77%), as a brown solid. 1 H NMR (400MHz, DMSO-d6): δ9.46 (s, 1H), 8.15 (s, 1H), 7.73 (d, J = 8.4Hz, 2H), 7.57 (d, J = 8.4Hz, 2H), 4.74 (s, 2H), 4.13 (s, 3H), 1.44 (s, 9H); MS (ESI) m / z 424.4[M+H]+ .

[0210] At 0 °C, 4N HCl / dioxane (50 mL) was added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid tert-butyl ester (9) (4.8 g, 11.34 mmol) in DCM (25 mL), and the mixture was stirred at room temperature for 16 h. The solvent was evaporated under reduced pressure, ground with ethyl acetate, and dried under reduced pressure to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (4.8 g), as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6): δ9.45 (s, 1H), 8.17 (s, 1H), 7.72 (d, J = 8.8Hz, 2H), 7.57 (d, J = 8.4Hz, 2H), 4.77 (s, 2H), 4.13 (s, 3H), 3.56 (s, 1H); MS (ESI) m / z 368.30[M+H] + .

[0211] Example 2: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (11)

[0212]

[0213] HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 3-fluoro-4-methoxyaniline (126 mg, 0.89 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to provide N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (11) (106 mg, 26%), as a grayish-white solid. MS (ESI) m / z 491.56 [M+H] +; 1 HNMR (400MHz, DMSO-d6): δ 10.48 (s, 1H), 9.46 (s, 1H), 8.15 (s, 1H), 7.73 (d, J = 8.4 Hz, 2H), 7.60–7.50 (m, 3H), 7.27 (d, J = 8.8 Hz, 1H), 7.14 (t, J = 9.2 Hz, 1H), 4.86 (s, 2H), 4.13 (s, 3H), 3.80 (s, 3H), 1.44 (s, 6H). Example 3: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(4-(2-(methanesulfonyl)propyl-2-yl)phenyl)acetamide (12).

[0214]

[0215] HATU (465 mg, 1.22 mmol) and DIPEA (0.4 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 4-(2-(methanesulfonyl)propyl-2-yl)aniline (2) (208 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(4-(2-(methanesulfonyl)propyl-2-yl)phenyl)acetamide (12) (110 mg, 23%), as a grayish-white solid. MS (ESI) m / z 563.43 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.58(s,1H),9.47(s,1H),8.17(s,1H),7.74(s,1H),7. 72(s,1H),7.65-7.53(m,6H),4.89(s,2H),4.13(s,3H),2.65(s,3H),1.73(s,6H).

[0216] Example 4: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(tetrahydro-2H-pyran-4-yl)acetamide (13)

[0217]

[0218] HATU (465 mg, 1.22 mmol) and DIPEA (0.4 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then tetrahydro-2H-pyran-4-amine (99 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(tetrahydro-2H-pyran-4-yl)acetamide (13) (120 mg, 32%), as a grayish-white solid. MS (ESI) m / z 465.44 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.66(s ,2H),4.12(s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J=6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H).

[0219] Example 5: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((tetrahydro-2H-pyran-4-yl)methyl)acetamide (14)

[0220]

[0221] HATU (465 mg, 1.22 mmol) and DIPEA (0.56 mL, 3.26 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.817 mmol) in DMF (5 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (tetrahydro-2H-pyran-4-yl)methylamine (112 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((tetrahydro-2H-pyran-4-yl)methyl)acetamide (14) (130 mg, 34%), as a pale yellow solid. MS (ESI) m / z 465.44 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.31(s,1H),8.08(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.66(s ,2H),4.12(s,3H),3.90-3.80(m,2H)3.30-3.20(m,2H),3.00(t,J=6.0Hz,2H),1.60-1.50(m,3H),1.40-1.30(m,2H).

[0222] Example 6: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(2-(tetrahydro-2H-pyran-4-yl)propyl-2-yl)acetamide (15)

[0223]

[0224] HATU (230 mg, 0.61 mmol) and DIPEA (0.24 mL, 1.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (150 mg, 0.40 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(tetrahydro-2H-pyran-4-yl)propyl-2-amine (179 mg, 0.48 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(2-(tetrahydro-2H-pyran-4-yl)propyl-2-yl)acetamide (15) (60 mg, 29%), as a grayish-white solid. MS (ESI) m / z 493.56 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.05(s,1H),7.83(s,1H),7.71(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.63( s,2H),4.12(s,3H),4.00-3.90(m,2H),3.30-3.15(m,2H),2.20-2.05(m,1H),1.60-1.50(m,2H),1.40-1.10(m,8H).

[0225] Example 7: Synthesis of (R)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (16)

[0226]

[0227] HATU (307 mg, 0.81 mmol) and DIPEA (209 mg, 1.62 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (259 mg, 0.70 mmol) in DMF (5 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. (R)-1-(tetrahydro-2H-pyran-4-yl)ethyl-1-amine (70 mg, 0.54 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated, and the crude product was purified by preparative HPLC to obtain (R)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (16) (45 mg, 17%), as a white solid. MS (ESI) m / z 479.63 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.12(d,J=8.8Hz,1H),8.08(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H), 4.12(s,3H),3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J=6.80Hz,3H).

[0228] Example 8: Synthesis of (S)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (17)

[0229]

[0230] HATU (307 mg, 0.81 mmol) and DIPEA (209 mg, 1.62 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (259 mg, 0.70 mmol) in DMF (5 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. (S)-1-(tetrahydro-2H-pyran-4-yl)ethyl-1-amine (70 mg, 0.54 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with cold water and extracted with EtOAc. The organic layer was evaporated and the residue was purified by preparative HPLC to give (S)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(1-(tetrahydro-2H-pyran-4-yl)ethyl)acetamide (17) (110 mg, 42%), as a white solid. MS (ESI) m / z 479.63 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.12(d,J=8.8Hz,1H),8.08(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H), 4.12(s,3H),3.90-3.80(m,2H),3.70-3.60(m,1H),3.40-3.20(m,2H),1.65-1.45(m,3H),1.30-1.15(m,2H),1.04(d,J=6.80Hz,3H).

[0231] Example 9: Synthesis of N-(2-methyl-4-(2-(methanesulfonyl)prop-2-yl)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (18)

[0232]

[0233] HATU (776 mg, 2.04 mmol) and DIPEA (0.75 mL, 4.08 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (500 mg, 1.36 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-methyl-4-(2-(methanesulfonyl)propyl-2-yl)aniline (371 mg, 1.63 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N-(2-methyl-4-(2-(methanesulfonyl)propyl-2-yl)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (18) (97 mg, 12%), as a grayish-white solid. MS (ESI) m / z 577.47 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.82(s,1H),9.45(s,1H),8.17(s,1H),7.72(d,J=8.8Hz,2H),7.56(d,J =8.4Hz,2H),7.55-7.35(m,3H),4.95(s,2H),4.14(s,3H),2.68(s,3H),2.29(s,3H),1.73(s,6H).

[0234] Example 10: Synthesis of 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propionic acid (19)

[0235]

[0236] HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenyl)-2-methylpropionic acid (175 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propionic acid (19) (90 mg, 20%), as a grayish-white solid. MS (ESI) m / z 529.46 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ12.40-12.30(br s,1H),10.45(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J=8.4Hz,2H),7.60 -7.50(m,4H),7.31(d,J=8.4Hz,1H),4.88(s,2H),4.13(s,3H),1.44(s,6H).

[0237] Example 11: Synthesis of N-(4-(2-hydroxy-2-methylpropoxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (20)

[0238]

[0239] HATU (465 mg, 1.22 mmol) and DIPEA (0.45 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.81 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 1-(4-aminophenoxy)-2-methylprop-2-ol (177 mg, 0.98 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was washed with diethyl ether to provide N-(4-(2-hydroxy-2-methylpropoxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (20) (160 mg, 36%), as a gray solid. MS (ESI) m / z 531.65 [M+H] + ; 1 HNMR (400MHz, DMSO-d6): δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H), 7.48(d,J=8.8Hz,2H),6.90(d,J=9.20Hz,2H),4.87(s,2H),4.59(s,1H),4.13(s,3H),3.69(s,2H),1.18(s,6H).

[0240] Example 12: Synthesis of 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propionamide (21)

[0241]

[0242] HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenyl)-2-methylpropionamide (196 mg, 1.11 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-methyl-2-(4-(2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamido)phenyl)propionamide (21) (75 mg, 17%), as a grayish-white solid. MS (ESI) m / z 526.33 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.42(s,1H),9.46(s,1H),8.16(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J =8.8Hz,2H),7.51(d,J=8.4Hz,2H),6.83(d,J=4.4Hz,2H),4.87(s,2H),4.13(s,2H),1.41(s,6H).

[0243] Example 13: Synthesis of N-((1S,4r)-4-((S)-2-hydroxypropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (22) and N-((1R,4r)-4-((R)-2-hydroxypropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (23)

[0244]

[0245] HATU (400 mg, 1.05 mmol) and DIPEA (290 mg, 2.10 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (250 mg, 0.70 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 1-(((1r,4r)-4-aminocyclohexyl)oxy)prop-2-ol (142 mg, 0.83 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered off and dried to provide N-((trans)-4-(2-hydroxypropoxy)cyclohexyl)-2-(4-oxo-8-((5-(trifluoromethyl)pyridin-2-yl)amino)quinazolin-3(4H)-yl)acetamide (22 and 23) (320 mg), as a grayish-white solid. Chiral SFCs were used to separate the enantiomers to provide (22) (64 mg, 9%) and (23) (63 mg, 9%).

[0246] 22 Peak-1: MS(ESI)m / z 523.51[M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43 (s, 1H), 8.20 (d, J = 7.6Hz, 1H), 8.07 (s, 1H), 7 .72(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.62(s,2H),4.47(s,1H),4.12 (s,3H),3.70-3.60(brs,1H),3.60-3.50(brs,1H),3.30-3.10(m,3H),2.11 -1.90(m,2H),1.90-1.80(m,2H),1.30-1.15(m,4H),1.01(d,J=6.0Hz,3H).

[0247] 23 Peak-2: MS(ESI)m / z 523.51[M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.21(d,J=7.6Hz,1H),8.07(s,1H),7.72(d,J= 8.4Hz,2H),7.56(d,J=8.4Hz,2H),4.63(s,2H),4.48(s,1H),4.12(s,3H),3.70-3.60.

[0248] Example 14: Synthesis of N-((trans)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (24)

[0249]

[0250] HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 1-(((trans)-4-aminocyclohexyl)oxy)-2-methylprop-2-ol (166 mg, 0.88 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N-((trans)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (24) (75 mg, 25%), as a grayish-white solid. MS (ESI) m / z 537.36 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.20(d,J=7.2Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),4.63(s,2H),4.20( s,1H),4.12(s,3H),4.54(brs,1H),3.23-3.21(m,1H),3.14(s,2H),1.97-1.93(m,2H),1.83-1.79(m,2H),1.25-1.20(m,4H),1.05(s,6H).

[0251] Example 15: Synthesis of (R)-N-(4-((1-hydroxypropyl-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (25) and (S)-N-(4-((1-hydroxypropyl-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (26)

[0252]

[0253] HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(4-aminophenoxy)prop-1-ol (185 mg, 1.11 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative SFC to (R)-N-(4-((1-hydroxypropyl-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (25) (85 mg, 22%) and (S)-N-(4-((1-hydroxypropyl-2-yl)oxy)phenyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (26) (77 mg, 20%), which were grayish-white solids.

[0254] 25 Peak-1: MS(ESI)m / z 517.45[M+H] + ; 1H NMR (400MHz, DMSO-d6): δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H),7.47(d,J=8.4Hz,2H),6.89(d, J=9.2Hz,2H),4.85(s,2H),4.82(t,J=5.6Hz,1H),4.36-4.32(m,1H),4. 13(s,3H),3.55-3.50(m,1H),3.45-3.40(m,1H),1.17(d,J=6.0Hz,3H).

[0255] 26 Peak-2: MS(ESI)m / z 517.45[M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.29(s,1H),9.46(s,1H),8.15(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.8Hz,2H),7.47(d,J=9.2Hz,2H),6.89(d, J=8.8Hz,2H),4.85(s,2H),4.81(t,J=5.6Hz,1H),4.36-4.32(m,1H),4. 13(s,3H),3.55-3.49(m,1H),3.45-3.40(m,1H),1.17(d,J=6.0Hz,3H).

[0256] Example 16: Synthesis of N-((trans)-4-(1-hydroxy-2-methylpropyl-2-yl)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (27)

[0257]

[0258] HATU (424 mg, 1.11 mmol) and DIPEA (0.37 mL, 2.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (271 mg, 0.74 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-((trans)-4-aminocyclohexyl)-2-methylprop-1-ol (150 mg, 0.88 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N-((trans)-4-(1-hydroxy-2-methylpropyl-2-yl)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (27) (110 mg, 28%), as a grayish-white solid. MS (ESI) m / z 519.40 [MH] - ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.17(d,J=7.6Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),4.65(s,2H),4.40(t ,J=5.6Hz,1H),4.13(s,3H),4.46-3.42(m,1H),3.13(d,J=5.2Hz,2H), 1.86-1.83(m,2H),1.71-1.68(m,2H),1.23-0.98(m,4H),0.73(s,6H).

[0259] Example 17: N-((trans)-4-hydroxycyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (28)

[0260]

[0261] HATU (387 mg, 1.02 mmol) and DIPEA (0.53 mL, 3.06 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (250 mg, 0.68 mmol) in DMF (5 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (trans)-4-aminocyclohexane-1-ol (93 mg, 0.816 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N-((trans)-4-hydroxycyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (28) (95 mg, 30%), as a grayish-white solid. MS (ESI) m / z 465.35 [M+H] + ; 1 HNMR (400MHz, DMSO-d6): δ9.43(s,1H),8.16(d,J=7.6Hz,1H),8.06(s,1H),7.72(d,J=8.4Hz,2H),7.56(d, J=8.8Hz,2H),4.62(s,2H),4.52(d,J=4.4Hz,1H),3.49-3.36(m,2H),1.82-1.76(m,4H),1.23-1.17(m,4H).

[0262] Example 18: N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (32)

[0263]

[0264] K₂CO₃ (18 g, 132 mmol) was added to a stirred solution of trans-4-aminocyclohexane-1-ol (5 g, 33 mmol) in acetonitrile (100 mL) at 0 °C, followed by the addition of benzyl bromide (8.2 g, 69 mmol), and the mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was evaporated under reduced pressure. The resulting solid was washed with n-pentane to provide trans-4-(dibenzylamino)cyclohexane-1-ol (29 g) (8 g, 82%) as a white solid. This was used directly in the next step without further purification. MS (ESI) m / z 296.36 [M+H]+ ; 1 H NMR (400MHz, DMSO-d6): δ7.38-7.24(m,8H),7.23-7.14(m,2H),4.41(d,J=4.2Hz,1H),3 .55(s,4H),2.45-2.28(m,1H),1.90-1.70(m,4H),1.50-1.30(m,2H),1.10–0.90(m,2H).

[0265] CuI (0.258 g, 1.3 mmol) was added to a stirred solution of trans-4-(dibenzylamino)cyclohexyl-1-ol (29) (2 g, 6 mmol) in acetonitrile (50 mL) at room temperature. The reaction mixture was heated to 45 °C and 2,2-difluoro-2-(fluorosulfonyl)acetic acid (2.4 g, 13 mmol) was added. The reaction mixture was then stirred at the same temperature for 1 h. Another 2,2-difluoro-2-(fluorosulfonyl)acetic acid (2.4 g, 13 mmol) was added and stirring continued for another 1 h. The reaction mixture was then cooled to room temperature and filtered through a diatomaceous earth mat. The filtrate was evaporated, the residue was dissolved in EtOAc and washed with a saturated aqueous solution of NaHCO3 followed by washing with water. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain the crude compound, which was purified by rapid column chromatography on 100-200 silica gel using 5% EtOAc / hexane as eluent to provide trans-N,N-dibenzyl-4-(difluoromethoxy)cyclohexyl-1-amine (30) (1.8 g, 86%), as a white solid. MS (ESI) m / z 346.39 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ7.38-7.26(m,8H),7.23-7.15(m,2H),6.65(t,J=77.2Hz,1H),4.05-3.90(m,1H),3.56( s,4H),2.48-2.35(m,1H),1.97(d,J=10.4Hz,2H),1.82(d,J=11.6Hz,2H),1.55-1.42(m,2H),1.30-1.15(m,2H).

[0266] 20% Pd(OH)₂ / C (0.6 g) was added to a stirred solution of trans-N,N-dibenzyl-4-(difluoromethoxy)cyclohexyl-1-amine (30) (0.9 g, 2.6 mmol) in EtOH (10 mL), and the reaction mixture was stirred for 16 h under a hydrogenation (50 PSI) atmosphere. The mixture was passed through a diatomaceous earth pad, and the filtrate was concentrated to obtain trans-4-(difluoromethoxy)cyclohexylamine (31) (350 mg, 81%), a colorless oil, which was used directly in the next step without purification. MS (ESI) m / z 166.37 [M+H] + .

[0267] DIPEA (7.23 mL, 39.23 mmol), EDC·HCl (3.74 g, 19.61 mmol), and HOBT (2.64 g, 19.61 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (4.8 g, 13.07 mmol) in THF (48 mL) at 0 °C, and the reaction mixture was stirred at room temperature for 15 min. Then (1r,4r)-4-(difluoromethoxy)cyclohexyl-1-amine (31) (2.16 g, 13.07 mmol) was added, and the reaction mixture was stirred at room temperature for 12 h. After the reaction was confirmed to be complete by TLC, the reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 200 mL). The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product. This crude product was purified by rapid column chromatography on 100-200 silica gel using 90% EtOAc / hexane as the eluent to provide N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (32) (3.5 g, 57%), as a grayish-white solid. MS (ESI) m / z 515.61 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.23(d,J=7.2Hz,1H),8.07(s,1H),7.72(d,J=8.4Hz,2H),7.56(d,J=8.8Hz,2H),6.69(t,J=76.6 Hz,1H),4.63(s,2H),4.12-4.03(m,4H),3.57-3.55(m,1H),1.96–1.94(m,2H),1.85–1.82(m,2H),1.49-1.41(m,2H),1.34-1.32(m,2H).

[0268] Example 19: Synthesis of N-((1s,4s)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (36)

[0269]

[0270] K₂CO₃ (19.2 g, 139.07 mmol) was added to a stirred solution of (1s,4s)-4-aminocyclohexane-1-ol (5 g, 33.11 mmol) in acetonitrile (100 mL) at ice temperature, followed by the addition of benzyl bromide (17 g, 99.33 mmol), and the mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was stirred with petroleum ether and filtered to provide (1s,4s)-4-(dibenzylamino)cyclohexane-1-ol (33 g) (7 g, 72.16%) as a white solid. MS (ESI) m / z 296.27 [M+H] + .

[0271] CuI (566 mg, 2.98 mmol) was added to a stirred solution of (1s,4s)-4-(dibenzylamino)cyclohexyl-1-ol (33) (4.4 g, 14.91 mmol) in acetonitrile (45 mL), and the reaction mixture was heated to 45 °C. Then, 2,2-difluoro-2-(fluorosulfonyl)acetic acid (9.29 g, 52.20 mmol) was added and the mixture was stirred for 2 h. The reaction mixture was slowly quenched with aqueous NaHCO3 solution and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide (1s,4s)-N,N-dibenzyl-4-(difluoromethoxy)cyclohexyl-1-amine (34) (3.2 g, 62%) as a white solid. MS (ESI) m / z 346.70 [M+H]+ .

[0272] 10% Pd / C (8 g) was added to a stirred solution of (1s,4s)-N,N-dibenzyl-4-(difluoromethoxy)cyclohexyl-1-amine (34) (2 g, 5.79 mmol) in EtOH (10 mL), and the reaction mixture was stirred for 16 h under a hydrogen atmosphere (70 psi). The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to obtain (1s,4s)-4-(difluoromethoxy)cyclohexyl-1-amine (35) (0.45 g, 47%). MS (ESI) m / z 166.12 [M+H] - .

[0273] HATU (465 mg, 1.23 mmol) and DIPEA (0.43 mL, 2.45 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (300 mg, 0.82 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 15 min. (1s,4s)-4-(difluoromethoxy)cyclohexyl-1-amine (35) (150 mg, 0.89 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated, and the crude product was purified by silica gel column chromatography followed by preparative SFC to provide N-((1s,4s)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (36) (51 mg, 12%), as a grayish-white solid. MS (ESI) m / z 515.20 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.27(d,J=8.00Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6 .71(t,J=72.8Hz,1H),4.65(s,2H),4.30-4.20(m,1H),4.12(s,3H),3.70-3.60(m,1H),1.90-1.80(m,2H),1.70-1.50(m,6H).

[0274] Example 20: Synthesis of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl)acetamide (39)

[0275]

[0276] KO was added to a stirred solution of (1r,4r)-4-(dibenzylamino)cyclohexyl-1-ol (2g, 6.77mmol) in dioxane (20mL) at ice temperature. t Bu (4.0 g, 33.89 mmol) was then added, followed by the addition of 4-(bromomethyl)tetrahydro-2H-pyran (6.0 mL, 40.67 mmol), and the reaction mixture was stirred at 120 °C for 16 h. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide (1r,4r)-N,N-dibenzyl-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl-1-amine (37) (750 mg, crude). MS (ESI) m / z 394.54 [M+H] + .

[0277] 10% Pd / C (2 g) was added to a stirred solution of (1r,4r)-N,N-dibenzyl-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl-1-amine (37) (750 mg, 1.91 mmol) in EtOH (2 mL), and the reaction mixture was stirred at room temperature under a hydrogen (70 Psi) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to obtain (1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl-1-amine (38) (390 mg, crude).

[0278] HATU (720 mg, 1.90 mmol) and DIPEA (0.52 mL, 2.86 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (350 mg, 0.95 mmol) in DMF (5 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl-1-amine (38) (406 mg, 1.90 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The combined organic layers were evaporated and the residue was passed through a silica gel column (60-120 mesh) and then purified by preparative HPLC using RP to provide 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-((tetrahydro-2H-pyran-4-yl)methoxy)cyclohexyl)acetamide (39) (40 mg, 5% yield), as a grayish-white solid. MS (ESI) m / z 563.61 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43 (s, 1H), 8.20 (d, J = 7.80Hz, 1H), 8.07 (s, 1H), 7.72(d,J=8.40Hz,2H),7.56(d,J=8.40Hz,2H),4.62(s,2H),4.12(s,3H),3 .80-3.70(m,2H),3.60-3.50(m,1H),3.30-3.20(m,5H),2.00-1.90(m,2H), 1.90-1.80(m,2H),1.80-1.65(m,1H),1.60-1.50(m,2H),1.30-1.10(m,6H).

[0279] Example 21: Synthesis of N-((1S,3S)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide and N-((1R,3R)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (43 and 44)

[0280]

[0281] K₂CO₃ (30.28 g, 219.13 mmol) was added to a stirred solution of (trans)-3-aminocyclohexane-1-ol hydrochloride (6 g, 52.17 mmol) in acetonitrile (60 mL) at ice temperature, followed by the addition of benzyl bromide (26.76 g, 156.52 mmol), and the mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product. The resulting brown crude product was stirred with petroleum ether and filtered to provide (trans)-3-(dibenzylamino)cyclohexane-1-ol (40) (6.5 g, 42% yield) as a brown solid. MS (ESI) m / z 296.43 [M+H] - .

[0282] CuI (515 mg, 2.71 mmol) was added to a stirred solution of (trans)-3-(dibenzylamino)cyclohexyl-1-ol (40) (4 g, 13.55 mmol) in acetonitrile (40 mL), and the reaction mixture was heated to 45 °C. Then, 2,2-difluoro-2-(fluorosulfonyl)acetic acid (8.44 g, 47.45 mmol) was added and the mixture was stirred for 2 h. The reaction mixture was slowly quenched with aqueous NaHCO3 solution and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide the colloidal substance N,N-dibenzyl-3-(difluoromethoxy)cyclohexyl-1-amine (41) (3 g, 65% yield). MS (ESI) m / z 346.28 [M+H] - .

[0283] 10% Pd / C (6 g) was added to a stirred solution of N,N-dibenzyl-3-(difluoromethoxy)cyclohexyl-1-amine (41) (1.5 g, 4.34 mmol) in EtOH (22 mL), and the reaction mixture was stirred at room temperature under a hydrogen (70 Psi) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to obtain 3-(difluoromethoxy)cyclohexyl-1-amine (42) (0.450 g, 63% yield). MS (ESI) m / z 166.08 [M+H] - .

[0284] HATU (621 mg, 1.63 mmol) and DIPEA (0.6 mL, 3.26 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (400 mg, 1.08 mmol) in DMF (4 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 3-(difluoromethoxy)cyclohexyl-1-amine (42) (179 mg, 1.08 mmol) was added, and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated and the residue was purified by silica gel column chromatography (60-120 mesh), followed by preparative SFC purification, to give two trans isomers of N-((1,3)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide of unknown stereochemistry, as grayish-white solids (43) (105 mg, 19% yield) and (44) (125 mg, 22% yield).

[0285] Compound 43: MS (ESI) m / z 515.23 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.43(s,1H),8.25(d,J=8.00Hz,1H),8.07(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.69(t,J= 72.8Hz,1H),4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H).

[0286] Compound 44: MS (ESI) m / z 515.23 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.26(d,J=8.00Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.69(t,J= 72.8Hz,1H),4.64(s,2H),4.50-4.40(m,1H),4.12(s,3H),4.00-3.90(m,1H),1.90-1.80(m,1H),1.80-1.50(m,6H),1.40-1.20(m,1H).

[0287] Example 22: Synthesis of N-((1S,3R)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide and N-((1R,3S)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (48 and 49)

[0288]

[0289] K₂CO₃ (30.28 g, 219.13 mmol) was added to a stirred solution of (cis)-3-aminocyclohexane-1-ol hydrochloride (6 g, 52.17 mmol) in acetonitrile (60 mL) at ice temperature, followed by the addition of benzyl bromide (26.76 g, 156.52 mmol), and the mixture was stirred at room temperature for 18 h. The mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product. The resulting brown crude product was stirred with petroleum ether and filtered to provide (cis)-3-(dibenzylamino)cyclohexane-1-ol (45 g) (6.5 g, 42% yield) as a brown solid. MS (ESI) m / z 296.43 [M+H] - .

[0290] CuI (515 mg, 2.71 mmol) was added to a stirred solution of 3-(dibenzylamino)cyclohexyl-1-ol (45) (4 g, 13.55 mmol) in acetonitrile (40 mL), and the reaction mixture was heated to 45 °C. Then, 2,2-difluoro-2-(fluorosulfonyl)acetic acid (8.44 g, 47.45 mmol) was added and the mixture was stirred for 2 h. The reaction mixture was slowly quenched with aqueous NaHCO3 solution and extracted with EtOAc. The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide the colloidal substance N,N-dibenzyl-3-(difluoromethoxy)cyclohexyl-1-amine (46) (3 g, 65% yield). MS (ESI) m / z 346.28 [M+H] - .

[0291] 10% Pd / C (6 g) was added to a stirred solution of N,N-dibenzyl-3-(difluoromethoxy)cyclohexyl-1-amine (46) (1.5 g, 4.34 mmol) in EtOH (22 mL), and the reaction mixture was stirred at room temperature under a hydrogen (70 Psi) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to obtain 3-(difluoromethoxy)cyclohexyl-1-amine (47) (0.450 g, 63% yield). MS (ESI) m / z 166.08 [M+H] - .

[0292] HATU (621 mg, 1.63 mmol) and DIPEA (0.6 mL, 3.26 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (10) (400 mg, 1.08 mmol) in DMF (4 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 3-(difluoromethoxy)cyclohexyl-1-amine (47) (179 mg, 1.08 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with EtOAc (2 x 50 mL). The organic layer was evaporated and the residue was passed through a silica gel column (60-120 mesh) and then purified by SFC to provide two cis isomers of N-((1,3)-3-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide, which are of absolutely stereochemical unknown, as (48) (15 mg, 3% yield) and as (49) (2 mg, 1% yield) as an off-white solid.

[0293] Compound 48: MS (ESI) m / z 515.23 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.32(d,J=7.20Hz,1H),8.08(s,1H),7.72(d,J=8.80Hz,2H),7.56(d,J=8.80Hz,2H),6.70(t, J=72.8Hz,1H),4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.35-1.23(m,4H).

[0294] Compound 49: MS (ESI) m / z 515.33 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.32(d,J=8.4Hz,1H),8.08(s,1H),7.73(d,J=8.4Hz,2H),7.57(d,J=8.80Hz,2H),6.70(t,J =76.4Hz,1H),4.63(s,2H),4.12(s,3H),4.10-4.00(m,1H),3.65(m,1H),2.14(m,1H),1.93(m,1H),1.73(m,2H),1.29-1.11(m,4H).

[0295] Example 23: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (52)

[0296]

[0297] To a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)tert-butyl acetate (7) (500 mg, 1.46 mmol) in 1,4-dioxane (15 mL), 5-(trifluoromethyl)pyridine-2-amine (190 mg, 1.18 mmol) and cesium carbonate (1.42 g, 4.38 mmol) were added. The reaction mixture was degassed with argon for 15 min, and then Pd2(dba)3 (267 mg, 0.29 mmol) and Xantphos (168 mg, 0.29 mmol) were added. The reaction mixture was again degassed with argon for 5 min, and then stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide tert-butyl 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (50) (200 mg, 32% yield), as a pale yellow solid. MS (ESI) m / z 425.25 [M+H] + .

[0298] At 0 °C, 4 M HCl / dioxane (3 mL) was added to a stirred solution of 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid tert-butyl ester (50) (200 mg, 0.47 mmol) in 1,4-dioxane (2 mL), and the reaction mixture was stirred at room temperature for 16 h. The reaction mixture was evaporated to provide 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (51) (150 mg, 90%) as a grayish-white solid. MS (ESI) m / z 369.0 [M+H] + .

[0299] HATU (231 mg, 0.61 mmol) and DIPEA (0.21 mL, 1.22 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (51) (150 mg, 0.40 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. 1-(((1r,4r)-4-aminocyclohexyl)oxy)-2-methylprop-2-ol (114 mg, 0.61 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 mL). The organic layer was evaporated, and the residue was purified by preparative SFC to provide N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (52) (40 mg, 10% yield), as a grayish-white solid. MS (ESI) m / z 538.19 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.65(s,1H),8.42(s,1H),8.20(d,J=7.2Hz,1H),8.02(s,1H),7.89(d,J=6.80Hz,1H),7.17(d,J=8.8Hz,1H),4.62(s,2H), 4.20(s,1H),4.14(s,3H),3.60-3.50(m,1H),3.30-3.20(m,1H),3.14(s,2 H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).

[0300] Example 24: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (55)

[0301]

[0302] HATU (2.3 g, 6.27 mmol) and DIPEA (2.3 mL, 12.54 mmol) were added to a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (53) (1.2 g, 4.18 mmol) in DMF (15 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then (1r,4r)-4-(difluoromethoxy)cyclohexyl-1-amine (35) (827 mg, 5.017 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and washed with Et2O to provide N2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (1.0 g, 55%), as a pale yellow solid. MS (ESI) m / z 434.27 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ8.23(d,J=7.6Hz,1H),8.15(s,1H),6.69(t,J=76Hz,1H),4.62(s,2H),4.16(s,3H),4. 10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).

[0303] To a stirred solution of N2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (400 mg, 0.921 mmol) in 1,4-dioxane (5 mL), 5-(trifluoromethyl)pyridine-2-amine (149 mg, 0.921 mmol) and cesium carbonate (898 mg, 2.76 mmol) were added. The reaction mixture was then degassed with argon for 15 min, followed by the addition of Pd2(dba)3 (53 mg, 0.09 mmol) and Xantphos (84, 0.09 mmol). The reaction mixture was then degassed with argon again for 5 min, and stirred at 100 °C for 2 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (55) (90 mg, 19% yield), as a white solid. MS (ESI) m / z 516.50 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.70(s,1H),8.42(s,1H),8.24(d,J=7.6Hz,1H),8.02(s,1H),7.90(d,J=6.80Hz,1H),7.18(d,J=8.80Hz,1H),6.69(t,J=76 Hz,1H),4.62(s,2H),4.18(s,3H),4.10-4.00(m,1H),3.60-3.50(m,1H),2 .00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).

[0304] Example 25: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (64)

[0305]

[0306] 10% Pd / C (3.0 g) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g, 58.47 mmol) in MeOH (100 mL). The reaction mixture was stirred at room temperature under a hydrogen (50 PSI) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth pad and the filtrate was concentrated to obtain methyl 4-amino-1H-pyrazole-5-carboxylate (56) (8 g, 97% yield) as a brown solid. 1 H NMR (400MHz, DMSO-d6): δ12.82(brs,1H),7.09(s,1H),4.87(s,2H),3.77(s,3H).

[0307] DIPEA (48.15 mL, 283.8 mmol) and formamidin acetate (6.49 g, 62.41 mmol) were added to a stirred solution of methyl 4-amino-1H-pyrazol-5-carboxylate (56) (8 g, 56.73 mmol) in n-butanol (80 mL) at room temperature, and the reaction was then stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. The solid compound was ground with diethyl ether to provide 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (57) (7.1 g, 92%) as a grayish-white solid. MS (ESI) m / z 137.05 [M+H] + ; 1 HNMR (400MHz, DMSO-d6): δ13.10(brs,2H),8.11(s,1H),7.85(s,1H).

[0308] NBS (10 g, 5.51 mmol) was added to a stirred solution of 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (57) (5 g, 3.67 mmol) in DMF (80 mL) at room temperature, and the reaction mixture was stirred at 60 °C for 12 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to provide 3-bromo-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (58) (5.5 g, 64%) as a grayish-white solid. MS (ESI) m / z 216.97 [M+2] + .

[0309] pTSA (134 mg, 0.7 mmol) was added to a stirred solution of 3-bromo-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (58) (3 g, 14.31 mmol) in DMF (30 mL), followed by DHP (6.05 g, 70.42 mmol), and the reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was cooled to room temperature, quenched with cold water, and extracted with EtOAc (3 x 50 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by rapid column chromatography to provide 3-bromo-1-(tetrahydro-2H-pyran-2-yl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (59) (2.6 g, 61%) as a grayish-white solid. MS (ESI) m / z 298.95 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ8.98(s,1H),6.13(dd,J=10.4,2.0Hz,1H),3.93(d,J=12.8 Hz,1H),3.64-3.58(m,1H),2.49-2.24(m,1H),2.02-1.91(m,2H),1.70-1.55(m,4H).

[0310] At room temperature, K₂CO₃ (3.6 g, 26.03 mmol) was added to a stirred solution of 3-bromo-1-(tetrahydro-2H-pyran-2-yl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (59) (2.6 g, 8.69 mmol) in DMF (30 mL), followed by the addition of 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (2.83 g, 13.04 mmol), and the reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography on 100-200 silica gel using 70% EtOAc / hexane as eluent to provide 2-(3-bromo-7-oxo-1-(tetrahydro-2H-pyran-2-yl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (61) (1.5 g, 30% yield), as a grayish-white solid. MS (ESI) m / z 482.01 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ8.31(s,1H),7.53(dd,J=13.6,2.4Hz,1H),7.27-7.20(m,1H),7.14(t,J=9.8Hz,1H),6.11(dd,J=10.4,2. 0Hz,1H),4.88(s,2H),4.0-3.90(m,1H),3.80(s,3H),3.62–3.56(m,1H),2.32-2.24(m,1H),2.01–1.92(m,2H),1.70-1.50(m,3H).

[0311] At room temperature, Cs₂CO₃ (406 mg, 1.25 mmol), Pd₂(dba)₃ (38 mg, 0.04 mmol), Xantphos (24 mg, 0.041 mmol), and 5-(trifluoromethyl)pyridin-2-amine (101 mg, 0.626 mmol) were added to a degassed (argon) solution of 2-(3-bromo-7-oxo-1-(tetrahydro-2H-pyran-2-yl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (61) (200 mg, 0.417 mmol) in toluene (6 mL). The solution was degassed again for 15 min and the mixture was heated in a microwave at 130 °C for 1.5 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure to provide a crude product, which was then purified by preparative HPLC to provide N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (62) (50 mg, 24%), as a pale yellow solid. MS (ESI) m / z 562.14 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ10.56(brs,1H),9.80(brs,1H),8.45(s,1H),8.19(s,1H),7.95(dd,J=8.8,2.4Hz,1H),7.55(dd,J=13.2,2 Hz,1H),7.26(d,J=8.8Hz,2H),7.15(t,J=9.2Hz,1H),6.12(dd,J=8,2Hz,1H),4.87(s,2H),3.95(d,J=7.6Hz,1H),3.80(s,3H),3.63 -3.56(m,1H),2.39-2.31(m,1H),2.03-1.93(m,2H),1.72-1.56(m,1H),1.55-1.53(m,2H).

[0312] 4N HCl / dioxane (2 mL) was added to a stirred solution of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (62) (45 mg, 0.08 mmol) in DCM (2 mL). The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was concentrated and the residue was purified by preparative HPLC to provide N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (63) (12 mg, 31% yield), as a grayish-white solid. MS (ESI) m / z 478.05 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ13.92(brs,1H),10.49(s,1H),9.77(brs,1H),8.44(s,1H),8.09(s,1H),7.90(d,J =8.8Hz,1H),7.55(dd,J=13.2,2Hz,1H),7.26(d,J=9.2Hz,1H),7.21–7.12(m,2H),4.86(s,2H),3.80(s,3H).

[0313] At room temperature, Cs₂CO₃ (68 mg, 0.209 mmol) was added to a stirred solution of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (63) (50 mg, 0.104 mmol) in DMF (2 mL), followed by iodomethane (18 mg, 0.125 mmol). The reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water (50 mL) and extracted with EtOAc (2 x 25 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by preparative HPLC to provide N-(3-fluoro-4-methoxyphenyl)-2-(1-methyl-7-oxo-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (64) (10 mg, 14%), as a white solid. MS (ESI) m / z 492.09 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.60(s,1H),9.68(s,1H),8.50(brs,2H),8.43(s,1H),8.10(s,1H),7.90(d,J=8.8Hz ,1H),7.55(d,J=13.6Hz,1H),7.27(d,J=8.8Hz,1H),7.19–7.12(m,2H),4.85(s,2H),4.15(s,3H),3.80(s,3H).

[0314] Example 26: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (65)

[0315]

[0316] To a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (54) (300 mg, 0.69 mmol) in 1,4-dioxane (5 mL), 6-(trifluoromethyl)pyridine-3-amine (111 mg, 0.69 mmol) and cesium carbonate (673 mg, 2.07 mmol) were added. The reaction mixture was degassed with argon for 15 min, and then Pd2(dba)3 (63 mg, 0.06 mmol) and Xantphos (39 mg, 0.06 mmol) were added. The reaction mixture was again degassed with argon for 5 min, and then stirred at 100 °C for 2 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product, which was purified by SFC to provide N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (65) (100 mg, 28% yield), as a light brown solid. MS (ESI) m / z 516.50 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.80(s,1H),8.89(s,1H),8.30-8.20(m,2H),8.10(s,1H),7.76(d,J=8.80Hz,1H),6.69(t,J=76Hz,1H),4.64( s,2H),4.30(s,3H),4.10-4.00(m,1H),3.65-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.40(m,2H),1.40-1.25(m,2H).

[0317] Example 27: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (68)

[0318]

[0319] To a stirred solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)tert-butyl acetate (7) (500 mg, 1.46 mmol) in 1,4-dioxane (15 mL), 6-(trifluoromethyl)pyridine-3-amine (284 mg, 1.75 mmol) and cesium carbonate (1.42 g, 4.38 mmol) were added. The reaction mixture was degassed with argon for 15 min, and then Pd2(dba)3 (133 mg, 0.14 mmol) and Xantphos (84 mg, 0.14 mmol) were added. The reaction mixture was degassed with argon again for 5 min, and then stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)tert-butyl acetate (66) (600 mg, 70% yield), as a pale yellow solid. MS (ESI) m / z 425.4 [M+H] + .

[0320] At 0 °C, 4 M HCl / dioxane (10 mL) was added to a stirred solution of 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid tert-butyl ester (66) (600 mg, 1.45 mmol) in 1,4-dioxane (2 mL). The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was evaporated to give 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (67) (500 mg, 90% yield) as a pale yellow solid. MS (ESI) m / z 369.33 [M+H] + .

[0321] HATU (464 mg, 1.22 mmol) and DIPEA (0.31 mL, 2.44 mmol) were added to a stirred solution of 2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (67) (300 mg, 0.81 mmol) in DMF (10 mL) at 0 °C. The reaction mixture was stirred at the same temperature for 5 min. 1-(((1r,4r)-4-aminocyclohexyl)oxy)-2-methylprop-2-ol (182 mg, 0.97 mmol) was added and the reaction was stirred at room temperature for 16 h. The reaction mixture was diluted with water and extracted with ethyl acetate (2 x 50 mL). The combined organic layers were evaporated and the residue was purified by preparative HPLC to provide N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(1-methyl-7-oxo-3-((6-(trifluoromethyl)pyridin-3-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (68) (120 mg, 27% yield), as a grayish-white solid. MS (ESI) m / z 538.15 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.80(s,1H),8.89(s,1H),8.21(d,J=7.2Hz,2H),8.09(s,1H),7.76(d,J=8.80Hz,1H),4.63(s,2H),4.20(s,1H) ,4.13(s,3H),3.60-3.50(m,1H),3.30-3.20(m,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).

[0322] Example 28: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(7-oxo-1-(tetrahydro-2H-pyran-2-yl)-3-((5-(trifluoromethyl)pyridin-2-yl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (70)

[0323]

[0324] At room temperature, K₂CO₃ (3.6 g, 26.03 mmol) was added to a stirred solution of 3-bromo-1-methyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (5) (2 g, 8.70 mmol) in DMF (30 mL), followed by the addition of 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (2.83 g, 13.04 mmol). The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography to provide 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (2.91 g, 81% yield), as a pale yellow solid. MS (ESI) m / z 412.20 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.49(brs,1H),8.31(s,1H),7.53(dd,J=9.6,2.4Hz,1H),7 .25(1H,J=10.0Hz,1H),7.13(t,J=9.2Hz,1H),4.85(s,2H),4.17(s,3H),3.80(s,3H).

[0325] At room temperature, Cs₂CO₃ (812 mg, 2.50 mmol), Pd₂(dba)₃ (76 mg, 0.08 mmol), Xantphos (48 mg, 0.082 mmol), and 4-isopropoxyaniline (186 mg, 1.34 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (343 mg, 0.82 mmol), 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (343 mg, 0.82 mmol) in dioxane (10 mL) at room temperature. The reaction mixture was degassed again for 15 min and heated at 100 °C for 16 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide N-(3-fluoro-4-methoxyphenyl)-2-(3-((4-isopropoxyphenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (70) (30 mg, 8%), as a grayish-white solid. MS (ESI) m / z 481.50 [M+H] + ;1 H NMR (400MHz, DMSO-d6): δ10.47(s,1H),8.66(s,1H),8.10(s,1H),7.58-7.53(m,4H),7.27(d,J=8.8Hz,1H),7.14(t,J =9.2Hz,1H),6.82(d,J=8.8Hz,2H),4.85(s,2H),4.48-4.44(m,1H),4.07(s,3H),3.80(s,3H),1.23(d,J=6.0Hz,6H).

[0326] Example 29: Synthesis of 2-(3-((4-chlorophenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (71)

[0327] At room temperature, Cs₂CO₃ (812 mg, 2.5 mmol), Pd₂(dba)₃ (76 mg, 0.08 mmol), Xantphos (48 mg, 0.082 mmol), and 4-chloroaniline (160 mg, 1.34 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (69) (343 mg, 0.82 mmol) in dioxane (10 mL). The reaction mixture was degassed again for 15 min and heated at 100 °C for 16 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide 2-(3-((4-chlorophenyl)amino)-1-methyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (71) (50 mg, 13%), as a grayish-white solid. MS (ESI) m / z 455.26 [MH] - ; 1 H NMR (400MHz, DMSO-d6): δ10.47(s,1H),9.12(s,1H),8.13(s,1H),7.64(dd,J=9.2,2.4Hz,2H),7.54(dd, J=13.6,2.4Hz,1H),7.28(d,J=9.2Hz,3H),7.14(t,J=9.2Hz,1H),4.85(s,2H),4.10(s,3H),3.80(s,3H).

[0328] Example 30: Synthesis of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (77)

[0329]

[0330] K₂CO₃ (12.07 g, 87.66 mmol) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5.0 g, 29.22 mmol) in DMF (50 mL) at room temperature, followed by the addition of iodoethane (2.58 mL, 32.14 mmol). The reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.7 g, 29%). MS (ESI) m / z 200.07 [M+H] + . 1 H NMR (400MHz, DMSO-d6): δ8.39 (s, 1H), 4.75-4.70 (m, 1H), 4.29 (q, J = 7.2Hz, 2H), 3.99 (s, 3H), 1.38 (d, J = 7.2Hz, 3H).

[0331] 10% Pd / C (3.0 g) was added to a stirred solution of methyl 1-ethyl-4-nitro-1H-pyrazole-5-carboxylate (72) (1.8 g, 9.04 mmol) in MeOH (100 mL). The reaction mixture was stirred at room temperature under a hydrogen (50 PSI) atmosphere for 8 h. The reaction mixture was filtered through a diatomaceous earth mat and the filtrate was concentrated to obtain methyl 4-amino-1-ethyl-1H-pyrazole-5-carboxylate (73) (1.5 g, 98% yield), as a brown solid. MS (ESI) m / z 170.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ7.02 (s, 1H), 5.00 (brs, 2H), 4.31 (q, J = 7.2Hz, 2H), 3.80 (s, 3H), 1.20 (d, J = 7.2Hz, 3H).

[0332] DIPEA (9.2 mL, 53.2 mmol) and formamidine acetate (1.21 g, 11.70 mmol) were added to a stirred solution of ethyl 4-amino-1H-pyrazole-5-carboxylate (73) (1.8 g, 10.64 mmol) in n-butanol (80 mL) at room temperature. The reaction mixture was stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. The solid compound was ground with diethyl ether to provide 1-ethyl-1,6-dihydro-7H-pyrazole[4,3-d]pyrimidin-7-one (74) (1.2 g, 69%), as a grayish-white solid. MS (ESI) m / z 165.11 [M+H] + ; 1 HNMR (400MHz, DMSO-d6): δ7.97 (s, 1H), 7.79 (s, 1H), 4.57 (q, J = 7.2Hz, 2H), 1.38 (d, J = 7.2Hz, 3H).

[0333] NBS (2.86 g, 16.08 mmol) was added to a stirred solution of ethyl 1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (74) (1.2 g, 7.31 mmol) in DMF (80 mL) at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to provide 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (1.0 g, 56%) as a grayish-white solid. MS (ESI) m / z 243.08 [M+2] + ; 1 H NMR (400MHz, DMSO-d6): δ12.51 (s, 1H), 7.93 (s, 1H), 4.55 (q, J = 7.2Hz, 2H), 1.39 (d, J = 7.2Hz, 3H).

[0334] At room temperature, K₂CO₃ (854 mg, 6.18 mmol) was added to a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (500 mg, 2.06 mmol) in DMF (30 mL), followed by the addition of 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (537.9 mg, 2.47 mmol). The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography on silica gel at 100–200 °C to provide 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (76) (400 mg, 46% yield), as a grayish-white solid. MS (ESI) m / z 424.29 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ8.24(s,1H),7.53(d,J=10.8Hz,1H),7.26(d,J=4.4Hz,1H),7.13 (d, J = 8.0 Hz, 1H), 4.86 (s, 2H), 4.56 (q, J = 7.2 Hz, 2H), 3.80 (s, 3H), 1.39 (d, J = 7.2 Hz, 3H).

[0335] At room temperature, Cs₂CO₃ (406 mg, 1.25 mmol), Pd₂(dba)₃ (70.5 mg, 0.077 mmol), Xantphos (44.5 mg, 0.077 mmol), and 5-(trifluoromethyl)pyridine-2-amine (188 mg, 1.165 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (76) (330 mg, 0.777 mmol) in dioxane (6 mL). The solution was degassed again for 15 min, and the reaction mixture was heated in a microwave at 100 °C for 3 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure to provide a crude product, which was then purified by preparative HPLC to provide 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (77) (103 mg, 26%), as a pale yellow solid. MS (ESI) m / z 505.31 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.47(s,1H),9.44(s,1H),8.16(s,1H),7.72(d,J=8.8Hz,2H),7.57(d,J=8.8Hz,2H),7.53(s,1 H), 7.27 (d, J = 8.8Hz, 1H), 7.14 (t, J = 9.2Hz, 1H), 4.81 (s, 2H), 4.52 (q, J = 7.2Hz, 2H), 3.80 (s, 3H), 1.39 (t, J = 7.2Hz, 3H).

[0336] Example 31: Synthesis of N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (80)

[0337]

[0338] K₂CO₃ (509 mg, 3.66 mmol) was added to a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (600 mg, 2.46 mmol) and 2-bromo-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (78) (642 mg, 2.96 mmol) in DMF (20 mL) and stirred at room temperature for 16 h. The reaction mixture was diluted with water (10 mL) to give a solid, which was filtered and washed with water to provide 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (79) (300 mg, 27%) as a white solid. MS(ESI) m / z 448.48 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ8.26(d,J=7.6Hz,1H),8.15(s,1H),6.68(t,J=76.4Hz,1H),4.63(s,2H),4.50(q,J =7.6Hz,2H),4.10-4.00(m,1H),3.60-3.50(m,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.60-1.20(s,7H).

[0339] To a stirred solution of 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)acetamide (79) (500 mg, 1.12 mmol) in 1,4-dioxane (5 mL), 4-(trifluoromethyl)aniline (216 mg, 1.34 mmol) and cesium carbonate (1.1 g, 3.45 mmol) were added. The reaction mixture was degassed with argon for 15 min, and then Pd2(dba)3 (103 mg, 0.11 mmol) and Xantphos (63 mg, 0.11 mmol) were added. The reaction mixture was again degassed with argon for 5 min, and then stirred at 100 °C for 16 h. The reaction mixture was diluted with ice-cold water and extracted with EtOAc (2 x 15 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated to obtain a crude product, which was purified by silica gel column chromatography to provide N-((1r,4r)-4-(difluoromethoxy)cyclohexyl)-2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (80) (120 mg, 20% yield), as a white solid. MS (ESI) m / z 529.56 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.23(d,J=7.6Hz,1H),8.08(s,1H),7.71(d,J=8.4Hz,2H),7.56(d,J=8.4Hz,2H),6.69(t,J=76.4Hz ,1H),4.64(s,2H),4.50(q,J=7.6Hz,2H),4.10-4.00(m,1H),3.60-3.50(m,1H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.50-1.30(s,7H).

[0340] Example 32: Synthesis of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)acetamide (84)

[0341]

[0342] K₂CO₃ (2.1 g, 15.6 mmol) was added to a stirred solution of 3-bromo-1-ethyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (75) (1.9 g, 7.81 mmol) in DMF (100 mL), followed by the addition of tert-butyl bromoacetate (1.4 mL, 9.38 mmol). The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography on silica gel (100-200) to provide tert-butyl 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (81) (2.3 g, 82% yield) as a grayish-white solid. MS(ESI) m / z 357.42 [M+H] + ; 1 HNMR (400MHz, CDCl3): δ8.24 (s, 1H), 4.74 (s, 2H), 4.57 (q, J = 7.2Hz, 2H), 1.41 (s, 9H).

[0343] At room temperature, Cs₂CO₃ (6.2 g, 19.38 mmol), Pd₂(dba)₃ (591 mg, 0.64 mmol), Xantphos (373 mg, 0.64 mmol), and 4-(trifluoromethyl)aniline (1.0 g, 6.46 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-ethyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (81) (2.3 g, 6.46 mmol) in dioxane (25 mL). The solution was degassed again for 15 min, and the mixture was heated at 100 °C for 3 h in a sealed tube. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth pad. The diatomaceous earth pad was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)tert-butyl acetate (82) (1.8 g, 64%), as a pale yellow solid. MS (ESI) m / z 438.09 [M+H] + ; 1HNMR (400MHz, DMSO-d6): δ9.46(s,1H),8.16(s,1H),7.72(d,J=8.4Hz,2H),7.57(d,J =8.4Hz, 2H), 4.74 (s, 2H), 4.50 (q, J = 7.2Hz, 2H), 1.44 (s, 9H), 1.38 (t, J = 7.2Hz, 3H).

[0344] A solution of 4M HCl / dioxane (10 mL) was added to a stirred solution of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid tert-butyl ester (82) (1.8 g, 4.11 mmol) in DCM (10 mL). The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was evaporated under reduced pressure, ground with diethyl ether, and dried under reduced pressure to give 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (83) (1.1 g, 7.3%) as a pale yellow solid. MS (ESI) m / z 382.46 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.46 (s, 1H), 8.17 (s, 1H), 7.71 (d, J = 8.4Hz, 2H), 7.5 7(d,J=8.4Hz,2H), 4.77(s,2H), 4.52(q,J=7.2Hz,2H), 1.40(t,J=7.2Hz,3H).

[0345] HATU (374 mg, 0.98 mmol) and DIPEA (0.36 mL, 1.96 mmol) were added to a stirred solution of 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (83) (250 mg, 0.65 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(((1r,4r)-4-aminocyclohexyl)methoxy)prop-2-ol (147 mg, 0.78 mmol) was added, and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide 2-(1-ethyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)acetamide (84) (39 mg, 10%), as a grayish-white solid. MS (ESI) m / z 551.72 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.44(s,1H),8.20(d,J=7.6Hz,1H),8.07(s,1H),7.71(d,J=8.4Hz ,2H),7.56(d,J=8.8Hz,2H),4.63(s,2H),4.51(q,J=4.4Hz,1H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.15(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.39(t,J=7.2Hz,3H),1.30-1.20(m,4H),1.05(s,6H).

[0346] Example 33: Synthesis of N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (92)

[0347]

[0348] K₂CO₃ (16.1 g, 116.9 mmol) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (10 g, 58.4 mmol) in DMF (100 mL) at room temperature, followed by the addition of 2,2,2-trifluoroethyl trifluoromethanesulfonic acid (12.7 mL, 87.7 mmol). The reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by silica gel column chromatography to provide methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (85) (4 g, 32% yield) as a colorless liquid, and further elution gave the other isomer methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-3-carboxylate (85a) (5 g). MS(ESI)m / z254.14[M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ9.57 (s, 1H), 5.41 (q, J = 7.20Hz, 2H), 3.98 (s, 3H).

[0349] 10% Pd / C (2 g) was added to a stirred solution of methyl 4-nitro-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (85) (3.3 g, 13.04 mmol) in MeOH (33 mL), and the reaction mixture was stirred at room temperature under a hydrogen (50 PSI) atmosphere for 16 h. The reaction mixture was filtered through a diatomaceous earth mat, and the filtrate was concentrated to obtain methyl 4-amino-1-(2,2,2-trifluoroethyl)-1H-pyrazole-5-carboxylate (86) (2.3 g, 82% yield). MS (ESI) m / z 224.09 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ7.24 (s, 1H), 5.09 (q, J = 7.20Hz, 2H), 4.20 (s, 2H), 3.93 (s, 3H).

[0350] DIPEA (9.5 mL, 51.56 mmol) and formamidin acetate (2.1 g, 20.62 mmol) were added to a stirred solution of methyl 4-amino-1-(2,2,2-trifluoroethyl)-1H-pyrazol-5-carboxylate (86) (2.3 g, 10.31 mmol) in n-butanol (23 mL) at room temperature. The reaction mixture was stirred at 110 °C for 16 h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. The solid compound was ground with diethyl ether to provide 1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (87) (2 g, 89% yield) as a grayish-white solid. MS (ESI) m / z 218.04 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ12.52(brs,1H),8.21(s,1H),7.98(s,1H),5.46(q,J=7.20Hz,2H).

[0351] NBS (6.5 g, 36.69 mmol) was added to a stirred solution of 1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (87) (1.6 g, 7.33 mmol) in DMF (16 mL) at room temperature. The reaction mixture was stirred at 110 °C for 30 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to provide 3-bromo-1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (88) (1.0 g, 46% yield) as a grayish-white solid.

[0352] MS(ESI) m / z 297.04 [M+H] - ; 1 H NMR (400MHz, DMSO-d6): δ12.79 (brs, 1H), 8.04 (s, 1H), 5.46 (q, J = 7.20Hz, 2H).

[0353] K₂CO₃ (935 g, 6.77 mmol) was added to a stirred solution of 3-bromo-1-(2,2,2-trifluoroethyl)-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (88) (1.0 g, 3.3 mmol) in DMF (10 mL), followed by the addition of tert-butyl bromoacetate (0.7 mL, 5.08 mmol). The reaction mixture was stirred at room temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography on silica gel (100-200) to provide tert-butyl 2-(3-bromo-7-oxo-1-(2,2,2-trifluoroethyl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (89) (600 mg, 43% yield), as a grayish-white solid. MS (ESI) m / z 410.02 [M+H] + ;411.20.

[0354] At room temperature, tert-butyl 2-(3-bromo-7-oxo-1-(2,2,2-trifluoroethyl)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetate (89 mg, 0.97 mmol) was added to a degassed (argon) solution of dioxane (5 mL) with Cs₂CO₃ (951 g, 2.92 mmol), Pd₂(dba)₃ (89 mg, 0.09 mmol), Xantphos (56 mg, 0.09 mmol), and 4-(trifluoromethyl)aniline (157 g, 0.97 mmol). The solution was degassed again for 15 min, and the mixture was heated in a sealed tube at 100 °C for 3 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth pad. The diatomaceous earth pad was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)tert-butyl acetate (90) (250 mg, 52% yield), as a pale yellow solid. MS (ESI) m / z 491.13 [M+H] + ;492.27.

[0355] A solution of 4M HCl / dioxane (3 mL) was added to a stirred solution of 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid tert-butyl ester (90) (250 mg, 0.50 mmol) in 1,4-dioxane (3 mL). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was evaporated under reduced pressure, ground with diethyl ether, and dried under reduced pressure to give 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (91) (200 mg, 90%) as a pale yellow solid. MS(ESI) m / z 435.07 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ13.32(br s,1H),9.71(s,1H),8.30(s,1H),7.99(d,J=8.40Hz,2H),7.61(d,J=8.8Hz,2H),5.35(q,J=8.80Hz,2H),4.78(s,2H).

[0356] HATU (262 mg, 0.68 mmol) and DIPEA (0.25 mL, 1.37 mmol) were added to a stirred solution of 2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetic acid (91) (200 mg, 0.45 mmol) in DMF (3 mL) at 0 °C, and the reaction mixture was stirred at the same temperature for 5 min. Then 2-(((1r,4r)-4-aminocyclohexyl)methoxy)prop-2-ol (103 mg, 0.55 mmol) was added and the reaction was stirred at room temperature for 16 h. The reaction mixture was quenched with ice-cold water. The precipitated solid was filtered and purified by preparative HPLC to provide N-((1r,4r)-4-(2-hydroxy-2-methylpropoxy)cyclohexyl)-2-(7-oxo-1-(2,2,2-trifluoroethyl)-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (92) (50 mg, 18% yield), as a grayish-white solid. MS (ESI) m / z 605.36 [M+H] + ; 1H NMR (400MHz, DMSO-d6): δ9.70 (s, 1H), 8.30-8.20 (m, 2H), 7.81 (d, J = 8.4Hz, 2H), 7.6 0(d,J=8.8Hz,2H),5.34(q,J=8.80Hz,2H),4.64(s,2H),4.20(s,1H),3.60-3.50(br s,1H),3.30-3.20(br s,1H),3.14(s,2H),2.00-1.90(m,2H),1.90-1.80(m,2H),1.30-1.20(m,4H),1.05(s,6H).

[0357] Example 34: Synthesis of N-(3-fluoro-4-methoxyphenyl)-2-(1-isopropyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (98)

[0358]

[0359] K₂CO₃ (8.04 g, 58.44 mmol) was added to a stirred solution of methyl 4-nitro-1H-pyrazole-5-carboxylate (1) (5 g, 29.22 mmol) in DMF (50 mL) at room temperature, followed by the addition of 2-iodopropane (5.46 g, 32.11 mmol), and the reaction mixture was stirred at the same temperature for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by silica gel column chromatography to give methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g, 32%). MS (ESI) m / z 213.07 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ8.41 (s, 1H), 4.75-4.70 (m, 1H), 4.00 (s, 2H), 1.44 (d, J = 6.8Hz, 6H).

[0360] 10% Pd / C (1.0 g) was added to a stirred solution of methyl 1-isopropyl-4-nitro-1H-pyrazole-5-carboxylate (93) (2.0 g, 9.38 mmol) in MeOH (20 mL). The reaction mixture was stirred at room temperature under a hydrogen (50 PSI) atmosphere for 8 h. The reaction mixture was filtered through a diatomaceous earth mat and the filtrate was concentrated to obtain methyl 4-amino-1-isopropyl-1H-pyrazole-5-carboxylate (94) (1.4 g, 81% yield), as a brown solid. MS (ESI) m / z 184.20 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ7.05 (s, 1H), 5.30-5.15 (m, 1H), 4.99 (s, 2H), 3.79 (s, 3H), 1.31 (d, J = 6.8Hz, 6H).

[0361] DIPEA (6.65 mL, 38.2 mmol) and formamidin acetate (874.9 mg, 8.40 mmol) were added to a stirred solution of methyl 4-amino-1-isopropyl-1H-pyrazol-5-carboxylate (94) (1.4 g, 7.64 mmol) in n-butanol (80 mL). The reaction mixture was stirred at 110 °C for 3 h. The reaction mixture was cooled to room temperature and the precipitated solid was filtered off. The solid compound was ground with diethyl ether to provide 1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (95) (1.0 g, 73%) as a grayish-white solid. MS (ESI) m / z 179.18 [M+H] + .

[0362] NBS (2.19 g, 12.34 mmol) was added to a stirred solution of 1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (95) (1 g, 5.61 mmol) in DMF (10 mL) at room temperature. The reaction mixture was stirred at 80 °C for 12 h. The reaction mixture was cooled to room temperature, quenched with cold water, and the precipitated solid was filtered off. The solid was dried under vacuum to provide 3-bromo-1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (96) (700 mg, 49%) as a grayish-white solid. MS (ESI) m / z 257.21 [M+H] + ; 1 HNMR (400MHz, DMSO-d6): δ12.51 (s, 1H), 7.92 (s, 1H), 5.40-5.30 (m, 1H), 4.87 (s, 2H), 1.47 (d, J = 6.8Hz, 6H).

[0363] At room temperature, K₂CO₃ (803.1 mg, 5.82 mmol) was added to a stirred solution of 3-bromo-1-isopropyl-1,6-dihydro-7H-pyrazolo[4,3-d]pyrimidin-7-one (96) (500 mg, 1.94 mmol) in DMF (10 mL), followed by the addition of 2-chloro-N-(3-fluoro-4-methoxyphenyl)acetamide (60) (423 mg, 1.94 mmol). The reaction mixture was stirred at 60 °C for 16 h. The reaction mixture was quenched with water (100 mL) and extracted with EtOAc (2 x 250 mL). The combined organic layers were dried over anhydrous Na₂SO₄, filtered, and concentrated. The residue was purified by rapid column chromatography on silica gel at 100–200 °C to provide 2-(3-bromo-1-isopropyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (97) (350 mg, 41% yield), as a grayish-white solid. MS (ESI) m / z 438.28 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.57(brs,1H),8.24(s,1H),7.54(d,J=10.8Hz,1H),7.26(d,J=8.8Hz ,1H),7.15(d,J=8.8Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.45(d,J=6.8Hz,6H).

[0364] At room temperature, Cs₂CO₃ (735 mg, 2.25 mmol), Pd₂(dba)₃ (68 mg, 0.075 mmol), Xantphos (43 mg, 0.075 mmol), and 5-(trifluoromethyl)pyridin-2-amine (181 mg, 1.12 mmol) were added to a degassed (argon) solution of 2-(3-bromo-1-isopropyl-7-oxo-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)-N-(3-fluoro-4-methoxyphenyl)acetamide (97) (330 mg, 0.752 mmol) in dioxane (6 mL). The solution was degassed again for 15 min, and the reaction mixture was heated in a microwave at 100 °C for 3 h. The reaction mixture was cooled to room temperature and filtered through a diatomaceous earth mat. The diatomaceous earth mat was washed with 5% MeOH / CH₂Cl₂. The filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to provide N-(3-fluoro-4-methoxyphenyl)-2-(1-isopropyl-7-oxo-3-((4-(trifluoromethyl)phenyl)amino)-1,7-dihydro-6H-pyrazolo[4,3-d]pyrimidin-6-yl)acetamide (98%) (74 mg, 19%), as a pale yellow solid. MS (ESI) m / z 519.17 [M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ10.49(s,1H),9.46(s,1H),8.16(s,1H),7.70(d,J=8.8Hz,2H),7.57(d,J=8.8Hz,2H),7.53(s ,1H),7.27(d,J=8.8Hz,1H),7.14(t,J=9.2Hz,1H),5.40-5.30(m,1H),4.87(s,2H),3.80(s,3H),1.47(d,J=6.8Hz,6H).

[0365] Example 35: SF-1 Luc determination

[0366] Carrier structure:pGal4DBD_SF-1LBD was generated by cloning a polymerase chain reaction fragment encoding the ligand-binding domain (LBD) of any human SF-1 (aa 198–462) within a frame containing the DNA-binding domain (DBD) of the yeast transcription factor Gal4 encoded by the pFA-CMV vector (Stratagene, La Jolla, CA). SF-1 (aa 198–462) was amplified from a sequence tag clone expressed by Invitrogen (San Diego, CA). The BamHI and XbaI sites introduced by primers GATCGGATCCCCGGAGCCTTATGCCAGCCC (forward) and GATCGTCTAGATCAAGTCTGCTTGGCTTGCAGCATTTCGATGAG (reverse) were used to subclone the amplicon into pFA-CMV.

[0367] Cell culture and transient transfection conditions: K1 subtype Chinese hamster ovary (CHO) cells (American Type Culture Collection, Manassas, VA) were cultured in T-175 flasks (Corning Life Sciences, Acton, MA) in Ham's F-12 medium (Gibco, Carlsbad, CA) supplemented with 10% (v / v) fetal bovine serum (Gemini Bio-Products, West Sacramento, CA) and 1% (v / v) penicillin / streptomycin mixture (Gibco) at 37°C, 5% CO2, and 95% relative humidity. Cells were routinely cultured by splitting them at 1:10 to 1:20. The day before transfection, cells were washed with PBS and trypsinized with 0.25% trypsin-EDTA solution (Gibco), then cultured in 6 x 10⁶ cells / mL. 6One CHO-K1 cell was seeded in a T-175 flask containing 20 ml of Ham's F-12 medium replenished as described above. The cells were incubated overnight at 37°C, 5% CO2, and 95% relative humidity (RH). The next day, CHO-K1 cells were transiently co-transfected with either 250 ng of pGal4DBD_SF-1LBD plasmid (combined with 9 μg of pG5luc (Promega, Madison, WI) and 8.75 μg of empty pcDNA3.1 (Invitrogen) in 1.2 mL of Ham's F-12 medium containing 54 μl of TransIT-CHO reagent and 9 μl of TransIT-CHO Mojo reagent, or 125 ng of pGal4DBD_RORALBD plasmid, according to the manufacturer's protocol (MirusBioproducts, Madison, WI). The flask containing the transfected cells was then returned to an incubator at 37°C, 5% CO2, and 95% relative humidity. Four hours after transfection, the cells were trypsinized and resuspended in supplemented Ham's F-12 medium to a concentration of 1.6 x 10⁻⁶. 5 A concentration of cells per ml.

[0368] Measurement: The collected cells were resuspended in culture medium and seeded at 8,000 cells / 50 μL / well into 384-well white plates (Corning Life Sciences, Acton, MA). The 384 plates were incubated at room temperature for 1 hour, followed by a further incubation at 37°C and 5% CO2 for 3 hours. The test item solution was added to the 384 plates and incubated at 37°C and 6% CO2 for 40 hours.

[0369] Cell viability was assessed using a fluorescence method with resazurin. After incubating transfected CHO cells with the test solution, 10 μL of a 20 μmol / L resazurin solution was added to each 384-well plate. Fluorescence was then immediately measured at 615 nm with an excitation wavelength of 570 nm (0-hour reading). After incubation at 37°C and 6% CO2 for 2 hours, fluorescence was again measured at 615 nm with an excitation wavelength of 570 nm (2-hour reading). The fluorescence count was calculated by subtracting the 0-hour reading from the 2-hour reading (2-hour - 0-hour).

[0370] Measurement of SF-1 transcriptional activity: SF-1 transcriptional activity was measured as intracellular Luc activity using the SteadyLite Plus HTS reporter gene assay system. After measuring cell viability, the culture medium was completely removed from the 384-well plate. Then, 30 μL of Luc substrate solution was added to each well and incubated at room temperature for 10 min. After incubation, the luminescence of each well was measured using a microplate reader.

[0371] Calculation of cell viability (%): Cell viability (%) is calculated using the following formula:

[0372] Formula: Cell viability (%) = (A / B) × 100

[0373] A: Average fluorescence count in the test item group (2 hours - 0 hours)

[0374] B: Average fluorescence count in the media group (2 hours - 0 hours)

[0375] Calculation of SF-1 transcriptional activity (percentage of control): The percentage of transcriptional activity relative to the control was calculated using the following formula:

[0376] Formula: Percentage of control group = A / B × 100

[0377] A: Luminescent counts in CHO cells treated with test specimens transfected with GAL4-SF-1 plasmid.

[0378] B: Luminescence counts in CHO cells treated with a medium transfected with GAL4-SF-1 plasmid.

[0379] EC 50 calculate: The half-maximum effective concentration (EC50) was calculated using embedded software from Collaborative Drug Discovery Inc. (CDD). 50 The potency of the compounds is shown in Table 1:

[0380] Table 1

[0381]

[0382]

[0383] ++++=EC 50 <200nM;++=200nM≤EC 50 <1μM;

[0384] ++=1μM≤EC 50 ≤10μM; +=10μM <EC 50 ≤20μM

[0385] Example 36: R2C proliferation assay of SF-1 antagonists

[0386] SF-1 regulates the formation and survival of progenitor cells in adult Leydig cells. The antiproliferative effect of SF-1 antagonists was investigated using the SF-1+ rat Leydig tumor cell line R2C. Cell proliferation was measured by detecting EdU DNA incorporation; EdU is a nucleoside analog that can be fluorescently labeled after cell fixation.

[0387] method

[0388] Evaluation of the rat Leydig tumor cell line R2C using 5-ethynyl-2'-deoxyuridine (EdU) CCL-97 TM EdU, a nucleoside analog incorporated during DNA synthesis, is used to inhibit cell proliferation and can be fluorescently labeled after cell fixation. Cycloheximide, a protein synthesis inhibitor, is used as a positive control in the assay.

[0389] R2C cells were maintained according to the protocol provided by the American Type Culture Collection (ATCC). For assays, R2C cells were diluted to 1 million cells / mL with F12 medium supplemented with 2% FBS and 1% penicillin-streptomycin, and 50 μL of cell suspension was seeded into each well of a 384-well clear plate. The assay plate was incubated for 24 hours at 37°C in a humidified atmosphere with 6% CO2. Then, serially diluted SF-1 antagonist, cyclohexylimide, or mediator (DMSO) was applied to the R2C cells, and the plates were incubated for two days at 37°C in a humidified atmosphere with 6% CO2. EdU (Invitrogen) was added to the cells to a final concentration of 5 μM, and the cells were incubated for another 16 hours, after which the cells were fixed with 10% formalin.

[0390] Cells were then washed and permeabilized in 0.5% Triton X-100 / PBS solution for 1 h at room temperature. EdU incorporation was detected by labeling EdU with 6-FAM azide (Lumiprobe) using a copper(I)-catalyzed Click reaction between azide and alkyne. The reaction mixture consisted of 5 mM ascorbic acid, 1 mM CuSO4, and 1 μM 6-FAM azide dissolved in PBS buffer. Fluorescence signals were detected using an Envision 2104 multimode microplate reader. For data normalization, the average fluorescence of the DMSO wells was defined as 100%, and the average fluorescence of the 10 μM cyclohexylimide wells was defined as 0%. Curve fitting and EC were performed using a variable slope S-shaped dose-response analysis. 50 Measurement.

[0391] Preparation of various culture media and reagents

[0392] Preparation of R2C medium

[0393] Preparation method: The culture medium was prepared by adding 92 mL of horse serum (Invitrogen), 15.5 mL of fetal bovine serum, and 6.1 mL of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) solution to 500 mL of Ham's F-12 medium (Invitrogen). The medium was stored in a refrigerator (set to 4°C) and used within one month of preparation.

[0394] Preparation of R2C plate culture medium

[0395] Preparation method: The culture medium was prepared by adding 10 mL of fetal bovine serum and 5.1 mL of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) solution to 500 mL of Ham's F-12 medium. The medium was stored in a refrigerator (set to 4°C) and used within one month of preparation.

[0396] Preparation of R2C daughter plate culture medium

[0397] Preparation method: The culture medium was prepared by adding 50 mL of fetal bovine serum and 5.5 mL of penicillin (10,000 units / mL) and streptomycin (10 mg / mL) solution to 500 mL of Ham's F-12 medium. The medium was stored in a refrigerator (set to 4°C) and used within one month of preparation.

[0398] Preparation of cyclohexylimide (positive control) solution

[0399] Preparation method: Dissolve cyclohexylimide in DMSO to obtain a concentration of 5 mmol / L. Dilute the 5 mmol / L solution 20-fold in R2C subplate medium to obtain a subplate. Then add the subplate to the assay plate to obtain the final test conditions.

[0400] Preparation of test item solution

[0401] Preparation method: Dissolve the test sample in DMSO to obtain a concentration of 10 mmol / L. Further dilute the 10 mmol / L solution in DMSO to obtain a concentration of 256 μmol / L. Serially dilute the 10 mmol / L and / or 256 μmol / L solutions 2.5-fold to the medium to obtain 10-point dilutions. Dilute these solutions 20-fold to R2C subplate medium to obtain serially diluted test sample subplates. Then add the subplates to the assay plate to obtain the final test conditions.

[0402] Preparation of EdU plating solution

[0403] Preparation method: Dissolve EdU in DMSO to obtain a 30 mmol / L EdU stock solution. Store the 30 mmol / L EdU stock solution in a refrigerator (set to -20℃). When using, add 25 μl of the 30 mM EdU stock solution to 25 ml of R2C plating medium to obtain the EdU plating solution.

[0404] Preparation of 6-FAM azide solution

[0405] Preparation method: 6-FAM azide was dissolved in DMSO to obtain a concentration of 30 mmol / L. The 30 mmol / L stock solution was further diluted to 1 mmol / L to obtain the working solution.

[0406] Preparation of 25 mL 2x Sealing Mixture

[0407] Preparation method: Ascorbic acid was dissolved in PBS to obtain a concentration of 1 mol / L. Copper(II) sulfate was dissolved in water to obtain a concentration of 0.2 mol / L. A 25 mL 2x blocking mixture was prepared by adding the following: 1. 2-4.4 mL PBS, 2. 0.25 mL 1M ascorbic acid solution, 3. 0.25 mL 0.2M CuSO4 solution, and 4. 0.05 mL 1 mM 6-FAM azide DMSO solution. The 2x blocking mixture was used during preparation.

[0408] Hoechst 33258 staining solution

[0409] Preparation method: Ascorbic acid was dissolved in PBS to obtain a concentration of 1 mol / L. Copper(II) sulfate was dissolved in water to obtain a concentration of 0.2 mol / L. A 25 mL 2x sealing mixture was prepared by adding the following: 1. 2-4.4 mL PBS, 2. 0.25 mL 1M ascorbic acid solution, 3. 0.25 mL 0.2M CuSO4 solution, and 4. 0.05 mL 1M 6-FAM azide DMSO solution. The 2x sealing mixture was used during preparation.

[0410] Research Procedures

[0411] R2C cells were incubated together with the test items.

[0412] R2C cells were routinely cultured in R2C medium. To determine the inhibitory activity of the SF-1 antagonist, R2C cells were resuspended in R2C plating medium and seeded at 20,000 cells / 50 μL / well into 384-well clear-bottomed black plates. The 384 plates were incubated at 37°C and 6% CO2 for 24 hours to allow cell attachment to the assay plate. Then, serially diluted test item solution, cyclohexylimide positive control solution, or mediator solution were added to the 384 plates and incubated at 37°C and 6% CO2 for two days. Then, 10 μL of EdU plating solution was dispensed into each well of the assay plate after two days of incubation at 37°C and 6% CO2.

[0413] Measurement of R2C cell proliferation

[0414] R2C proliferation was measured by detecting fluorescently labeled EdU. R2C assay plates were fixed by aliquoting 60 μL of 10% formalin into each well and incubated on an orbital shaker at room temperature for 1 hour. The plates were washed three times with 80 μL of PBS and permeabilized by treating with 100 μL of PBS-0.5% Triton X-100 on an orbital shaker at room temperature for 1 hour. The plates were washed three times with 80 μL of PBS, and after the final wash, 25 μL of PBS was aliquoted into each well. Then, 25 μL of 2x mounting mix was added to each well to fix the cells, and the plates were incubated in the dark on an orbital shaker at room temperature for 30 min. The cells were washed three times with 80 μL of PBS, and after the final wash, 25 μL of PBS was aliquoted into each well. Then, 25 μL of Hoechst 33258 staining solution was added to each well to fix the cells, and the plates were incubated in the dark on an orbital shaker at room temperature for 30 min. The cells were washed three times with 80 μL of PBS. After the final wash, 50 μL of PBS was dispensed into each well. The assay plate was sealed with aluminum foil, and fluorescence was measured using an Envision microplate reader.

[0415] Calculation of R2C proliferation activity (percentage of control)

[0416] The percentage of proliferation activity relative to the control was calculated using the following formula:

[0417] Formula: Percentage of control group = 100 × (AC) / (BC)

[0418] A: Fluorescence counts in R2C cells treated with test items

[0419] B: Average fluorescence count in R2C cells treated with the medium

[0420] C: Average fluorescence count in R2C cells treated with 10 μM cyclohexylimide

[0421] EC 50 calculate: The half-maximum effective concentration (EC50) was calculated using embedded software from Collaborative Drug Discovery Inc. (CDD). 50 The potency of the compounds is shown in Table 2:

[0422] Table 2

[0423]

[0424] ++++=EC 50 <200nM; +++=200nM≤EC 50 <1μM;

[0425] ++=1μM≤EC 50 ≤10μM; +=10μM <EC 50 ≤20μM.

Claims

1. A compound having the structure of formula (I): Formula (I); in: X is a bond or a C1-C6 alkylene group; R 1 is phenyl or pyridyl, which phenyl or pyridyl is optionally substituted by one, two or three R 4 substituents; R 2 is C 3-8 cycloalkyl, phenyl or tetrahydropyranyl, wherein the C 3-8 cycloalkyl, phenyl or tetrahydropyranyl is optionally substituted with one, two or three R 5 substituents; R 3 is hydrogen, Ci-C6alkyl or Ci-C6haloalkyl; each R is independently selected from the group consisting of halogen, C 4 each R is independently selected from the group consisting of halogen, C 1-6 alkyl, C 1-6 haloalkyl and -OR 6 ; Each R 5 Each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and -OR 6 Wherein C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 ); Each R 6 Independently selected from hydrogen and C 1-6 Alkyl, wherein C 1-6 The alkyl group may optionally be substituted by one, two, or three groups selected from the following groups: halogens and hydroxyl groups; Each R 10 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups; Each R 11 Independently selected from hydrogen, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups; and Each R 13 Selected independently from C 1-6 alkyl; Or its pharmaceutically acceptable salt.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 1 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 4 replace.

3. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 1 It is a pyridyl group, which is optionally surrounded by one, two, or three R groups. 4 replace.

4. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein each R 4 C 1-6 Halogenated alkyl groups.

5. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 2 It is C 3-8 Cycloalkyl groups, optionally composed of one, two, or three R groups. 5 replace.

6. The compound of claim 5, or a pharmaceutically acceptable salt thereof, wherein R 2 It is a cyclohexyl group, which is optionally divided by one, two, or three R groups. 5 replace.

7. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 2 It is a phenyl group, which is optionally surrounded by one, two, or three R groups. 5 replace.

8. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 2 It is a tetrahydropyranyl group, which is optionally surrounded by one, two, or three R groups. 5 replace.

9. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogens, -OR 6 and C 1-6 Alkyl, the C 1-6 The alkyl group is optionally substituted with a group selected from the following: -OR 10 -C(O)OR 10 -C(O)N(R) 10 (R) 11 -S(O)2R 13 and -S(O)2N(R 10 (R) 11 ).

10. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein each R 5 Independently selected from halogens and -OR 6 .

11. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R 3 It is a C1-C6 alkyl group.

12. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein X is a bond.

13. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein X is a C1-C6 alkylene group.

14. The compound of claim 1, selected from: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and or its pharmaceutically acceptable salt.

15. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound is .

16. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound is .

17. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound is .

18. A pharmaceutical composition comprising a pharmaceutically acceptable diluent, excipient or binder and a compound as described in any one of claims 1-17; or a pharmaceutically acceptable salt thereof.

19. Use of the compound of any one of claims 1-17 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating cancer in mammals.

20. The use as described in claim 19, wherein the cancer is selected from adrenocortical carcinoma, ovarian cancer, head and neck cancer, endometrial cancer, hormone-dependent prostate cancer, non-small cell lung cancer (NSCLC), melanoma, pituitary gonadotropin-secreting cell adenoma, and sex cord-stromal tumor.

21. The use as claimed in claim 19, wherein the cancer is adrenocortical carcinoma.

22. The use of the compound of any one of claims 1-17; or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating endocrine disorders in mammals.

23. The use as described in claim 22, wherein the endocrine disorder is selected from endogenous Cushing's syndrome, congenital adrenal hyperplasia, and polycystic ovary syndrome.

24. Use of the compound of any one of claims 1-17; or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating endometriosis in mammals.