Anti-eph a4 antibodies

CN117398459BActive Publication Date: 2026-09-08EISAI R&D MANAGEMENT CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202311449611.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-07-01
Filing Date
2020-06-29
Publication Date
2026-09-08
Estimated Expiration
2040-06-29

AI Technical Summary

Technical Problem

[0005]尽管KYL肽和化合物1等被称为现有的EphA4抑制药物(专利文献2、非专利文献18和非专利文献19),但还没有关于具有增强EphA4的裂解活性的抗体的报道

Benefits of technology

[0094]本披露提供可以结合EphA4并增强EphA4的裂解的抗EphA4抗体、编码所述抗体的核酸、包含所述核酸的载体、包含所述载体的细胞、产生所述抗体的方法以及包含作为活性成分的所述抗体的药物组合物。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117398459B_ABST
    Figure CN117398459B_ABST
Patent Text Reader

Abstract

This invention relates to anti-EphA4 antibodies. An anti-EphA4 antibody is provided that can bind to EphA4 and enhance the cleavage of EphA4, and a pharmaceutical composition comprising said antibody as an active ingredient is provided. A mouse anti-EphA4 antibody having binding affinity for EphA4 and enhancing the cleavage of EphA4 was obtained, and the sequence of the complementarity-determining region (CDR) of said mouse anti-EphA4 antibody was identified. Subsequently, a target anti-EphA4 antibody was obtained by generating a humanized antibody from said mouse anti-EphA4 antibody.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese invention patent application No. 202080039114.0 (PCT application number PCT / JP2020 / 025465), filed on June 29, 2020, entitled "Anti-EphA4 Antibody". Technical Field

[0002] The present invention relates to antibodies that bind to EphA4, nucleic acids encoding said antibodies, vectors containing said nucleic acids, cells containing said vectors, methods for producing said antibodies, and pharmaceutical compositions containing said antibodies. Background Technology

[0003] EphA4 is a member of the receptor tyrosine kinase family. Hepatin A and B are considered ligands of EphA4, and when EphA4 binds to hepatin (which is a ligand of EphA4), it induces deadhesion signaling. To date, EphA4 has been proposed to be involved in the pathology of Alzheimer's disease (hereinafter also referred to as "AD") (Non-Patent Literature 1-4), and it has been reported that inhibiting the binding between EphA4 and hepatin rescues amyloid-β (Aβ). (1-42) Oligomer-mediated neurotransmission dysfunction (Patent Document 1). In AD, it is believed that aggregates formed by hyperphosphorylated tau (neurofibrillar tangles) are involved in neuronal death (Non-Patent Document 5), and it has also been reported that inhibiting tau phosphorylation inhibits neurodegeneration resulting in synaptic loss (Non-Patent Document 6 and Non-Patent Document 7), and improves memory deficits or cognitive impairment (Non-Patent Documents 8-11). Activation of CDK5 has been reported as a cause of tau phosphorylation (Non-Patent Document 12 and Non-Patent Document 13). Genetically modified mice expressing the P301L mutation, already found in familial frontotemporal dementia (rTg4510 mice), are AD model mice. Similar to AD, hyperphosphorylation of tau and abnormal accumulation of tau in neuronal cells are observed in these mice. In rTg4510 mice, neurofibrillary tangles (a pathological feature of AD) form and cause cognitive impairment through brain atrophy and neuronal loss (Non-Patent Document 14 and Non-Patent Document 5).

[0004] EphA4 is highly expressed in the hippocampus or cerebral cortex and is cleaved in a neuroactive-dependent manner via matrix metalloproteinases (MMPs), ADAM (de-integrin and metalloproteinases), and γ-selectases. This cleavage of EphA4 is known to stabilize spinous processes, which are key structures for neural function (Non-Patent Literature 15). Spinous process density has been reported to be reduced in AD (Non-Patent Literature 16), and since a reduction in EphA4 cleavage fragments has also been confirmed in NFT stages V and VI in AD, it is believed that the cleavage of EphA4 is involved in the pathology of AD (Non-Patent Literature 17).

[0005] Although KYL peptides and compound 1 are known as existing EphA4 inhibitors (Patent Document 2, Non-Patent Document 18, and Non-Patent Document 19), there are no reports on antibodies that enhance the cleavage activity of EphA4.

[0006] List of cited references

[0007] [Patent Document 1] WO 2016 / 019280 A1

[0008] [Patent Document 2] WO 2012 / 156351 A1

[0009] [Non-Patent Literature 1] Vargas LM et al., PLoS One. March 21, 2014; 9(3)

[0010] [Non-Patent Literature 2] Fu AK et al., Proc Natl Acad Sci US A. [Proceedings of the National Academy of Sciences of the United States of America] July 8, 2014; 111(27):9959-64

[0011] [Non-Patent Literature 3] Rosenberger AF et al., Acta Neuropathol Commun. [Journal of Neuropathology Communications] July 16, 2014; 2:79

[0012] [Non-patent literature 4] Huang TY et al., J Exp Med. [Journal of Experimental Medicine] 2017 Dec 4; 214(12):3669-3685.

[0013] [Non-Patent Literature 5] Santa Cruz et al., Science. July 15, 2005; 309(5733):476-81

[0014] [Non-Patent Literature 6] Seo J et al., J Neurosci. [Journal of Neuroscience] 2017, 10:11; 37(41):9917-9924

[0015] [Non-Patent Literature 7] Patrick GN et al., Nature. [Science] 9 December 1999; 402(6762):615-22.

[0016] [Non-Patent Literature 8] Onishi T et al., J Neurochem. December 2011; 119(6):1330-40

[0017] [Non-Patent Literature 9] Belfiore R et al., Aging Cell. Feb 2019; 18(1):e12873.

[0018] [Non-Patent Literature 10] Webster SJ et al., Front Genet. [Frontiers in Genetics] 23 April 2014; 5:88.

[0019] [Non-Patent Literature 11] Grayson B et al., Behav Brain Res. May 15, 2015; 285:176-93.

[0020] [Non-Patent Literature 12] Cancino GI et al., Neurobiol Aging. July 2011; 32(7):1249-61.

[0021] [Non-Patent Literature 13] Vargas LM et al., Biochim Biophys Acta Mol Basis Dis. [Acta Biochimica & Biophysica Sinica: Molecular Basis of Disease] 2018, April; 1864: 1148-1159.

[0022] [Non-Patent Literature 14] Ramsden M et al., J Neurosci. November 16, 2005; 25(46):10637-47.

[0023] [Non-Patent Literature 15] Inoue E et al., J Cell Biol. May 4, 2009; 185(3):551-64

[0024] [Non-Patent Literature 16] Boros et al., Ann Neurol. [Annals of Neurology] October 2017; 82(4):602-614

[0025] [Non-Patent Literature 17] Matsui C et al., Brain Pathol. [Neuropathology] 2012 Nov; 22(6):776-87. doi:10.1111 / j.1750-3639

[0026] [Non-Patent Literature 18] Goldshmit et al., PLoS one. [PLOS ONE] 2011; 6(9):e24636

[0027] [Non-Patent Literature 19] Van Hoecke et al., Nature Medicine. Sep 2012; 18(9):1418-22, 2012 Summary of the Invention

[0028] The problem the invention aims to solve

[0029] The purpose of this disclosure is to provide an anti-EphA4 antibody that can bind to EphA4 and enhance the cleavage of EphA4, and to provide a pharmaceutical composition comprising said antibody as an active ingredient.

[0030] Problem-solving methods

[0031] As a result of extensive research to solve the above problems, the inventors of this invention obtained a mouse anti-EphA4 monoclonal antibody (which can bind to EphA4 and enhance the cleavage of EphA4) and produced a humanized antibody of the antibody, thereby completing the target antibody.

[0032] This disclosure covers the following characteristics.

[0033] (1) An anti-EphA4 antibody, wherein

[0034] The anti-EphA4 antibody comprises a heavy chain and a light chain, and includes:

[0035] (a) Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO.44;

[0036] (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 27;

[0037] (c) Heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO. 28;

[0038] (d) A light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO. 29;

[0039] (e) a light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 30; and

[0040] (f) The light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO.31.

[0041] (2) The anti-EphA4 antibody according to (1), wherein the anti-EphA4 antibody is humanized.

[0042] (3) The anti-EphA4 antibody according to (1) or (2), wherein the anti-EphA4 antibody specifically binds to EphA4 and enhances the cleavage of EphA4.

[0043] (4) The anti-EphA4 antibody according to any one of (1)-(3), wherein the anti-EphA4 antibody specifically binds to EphA4 and inhibits the binding between EphA4 and hepatocyte glycoside.

[0044] (5) The anti-EphA4 antibody according to any one of (1)-(4), wherein

[0045] The variable region of the heavy chain consists of the amino acid sequence shown in SEQ ID NO.45, and

[0046] The variable region of the light chain consists of the amino acid sequence shown in SEQ ID NO.46.

[0047] (6) The anti-EphA4 antibody according to any one of (1)-(5), wherein

[0048] The constant regions of the heavy chain and the light chain contain amino acid sequences derived from human antibodies.

[0049] (7) The anti-EphA4 antibody according to (6), wherein

[0050] The constant region of the heavy chain is the constant region of human IgG.

[0051] (8) The anti-EphA4 antibody according to (7), wherein

[0052] The constant region of human IgG is the constant region of human IgG2.

[0053] (9) The anti-EphA4 antibody according to (8), wherein

[0054] The constant region of the human IgG2 contains the amino acid sequence shown in SEQ ID NO.47.

[0055] (10) The anti-EphA4 antibody according to any one of (6)-(9), wherein

[0056] The constant region of the light chain is the constant region of human Igκ.

[0057] (11) The anti-EphA4 antibody according to (10), wherein

[0058] The constant region of the human Igκ contains the amino acid sequence shown in SEQ ID NO.48.

[0059] (12) An anti-EphA4 antibody, wherein

[0060] The anti-EphA4 antibody comprises heavy and light chains.

[0061] The heavy chain contains the amino acid sequence shown in SEQ ID NO. 59, and

[0062] The light chain contains the amino acid sequence shown in SEQ ID NO.60.

[0063] (13) The anti-EphA4 antibody according to (12), wherein

[0064] The heavy chain is missing a C-terminal lysine residue.

[0065] (14) An anti-EphA4 antibody, wherein

[0066] The anti-EphA4 antibody comprises heavy and light chains.

[0067] The heavy chain contains the amino acid sequence shown in SEQ ID NO. 59.

[0068] The light chain contains the amino acid sequence shown in SEQ ID NO. 60, and

[0069] The heavy chain is missing a C-terminal lysine residue.

[0070] (15) An isolated nucleic acid encoding an anti-EphA4 antibody according to any one of (1)-(14).

[0071] (16) A vector comprising the nucleic acid according to (15).

[0072] (17) A host cell comprising the vector according to (16).

[0073] (18) A method for producing an anti-EphA4 antibody, the method comprising the step of culturing host cells according to (17).

[0074] (19) A pharmaceutical composition comprising an anti-EphA4 antibody according to any one of (1)-(14).

[0075] (20) A pharmaceutical composition according to (19), wherein the pharmaceutical composition comprises at least one pharmaceutically acceptable carrier.

[0076] (21) The pharmaceutical composition according to (19) or (20) is used to treat Alzheimer's disease.

[0077] (22) The anti-EphA4 antibody according to any one of (1)-(14) is used in the treatment of Alzheimer's disease.

[0078] (23) A method for treating Alzheimer's disease, the method comprising administering to a patient in need a therapeutically effective amount of the anti-EphA4 antibody according to any one of (1)-(14).

[0079] (24) Use of the anti-EphA4 antibody according to any one of (1)-(14) in the manufacture of a pharmaceutical composition for the treatment of Alzheimer's disease.

[0080] (25) The pharmaceutical composition according to (19) or (20) is used to treat tau protein lesions.

[0081] (26) The anti-EphA4 antibody according to any one of (1)-(14) for use in the treatment of tau protein lesions.

[0082] (27) A method for treating tau protein lesions, the method comprising administering to a patient in need a therapeutically effective amount of the anti-EphA4 antibody according to any one of (1)-(14).

[0083] (28) Use of the anti-EphA4 antibody according to any one of (1)-(14) for the manufacture of a pharmaceutical composition for the treatment of tau protein lesions.

[0084] (29) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to any one of (25)-(28), wherein the tau protein lesion is Alzheimer's disease or frontotemporal degeneration with tau pathology.

[0085] (30) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (29), wherein the tau protein lesion is Alzheimer's disease.

[0086] (31) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (29), wherein the tau protein lesion is a frontotemporal lobe degeneration with tau pathology.

[0087] (32) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (31), wherein the frontotemporal degeneration with tau pathology is progressive supranuclear palsy, corticobasal degeneration, argyrophilic granulation dementia, neurofibrillary tangles of Alzheimer's disease, or Pick's disease.

[0088] (33) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (32), wherein the frontotemporal degeneration with tau pathology is progressive supranuclear palsy.

[0089] (34) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use described in (32), wherein the frontotemporal degeneration with tau pathology is cortical basal ganglia degeneration.

[0090] (35) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (32), wherein the frontotemporal degeneration with tau pathology is argyrophilic granular dementia.

[0091] (36) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use according to (32), wherein the frontotemporal degeneration with tau pathology is neurofibrillary tangles of Alzheimer's disease.

[0092] (37) The pharmaceutical composition, anti-EphA4 antibody, treatment method, or use described in (32), wherein the frontotemporal degeneration with tau pathology is Picker's disease.

[0093] Invention Effects

[0094] This disclosure provides an anti-EphA4 antibody that can bind to and enhance the cleavage of EphA4, a nucleic acid encoding the antibody, a vector containing the nucleic acid, a cell containing the vector, a method for producing the antibody, and a pharmaceutical composition containing the antibody as an active ingredient. Attached Figure Description

[0095] Figure 1 The binding affinity of the anti-EphA4 monoclonal antibody (antibody A) against mouse and human EphA4 was demonstrated.

[0096] Figure 2 The study demonstrated the enhanced EphA4 cleavage activity of an anti-EphA4 monoclonal antibody (antibody A) using hippocampal neurons.

[0097] Figure 3 The mouse EphA4-mouse ligand binding inhibitory activity of the anti-EphA4 monoclonal antibody (antibody A) was demonstrated.

[0098] Figure 4The human EphA4-human ligand binding inhibitory activity of the anti-EphA4 monoclonal antibody (antibody A) was demonstrated.

[0099] Figure 5 The selectivity of the anti-EphA4 monoclonal antibody (antibody A) against the Eph receptor in each individual was demonstrated.

[0100] Figure 6 The selectivity of the anti-EphA4 monoclonal antibody (antibody A) against each mouse Eph receptor was demonstrated.

[0101] Figure 7 The reactivity of the anti-EphA4 monoclonal antibody (antibody A) against EphA4 in mice, rats, monkeys, and humans was demonstrated.

[0102] Figure 8 The reactivity of the anti-EphA4 monoclonal antibody (antibody A) against the extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1), and fibronectin type III domain 2 (FN2) of human EphA4 was demonstrated.

[0103] Figure 9 The study demonstrated the effect of anti-EphA4 monoclonal antibody (antibody A) on increasing the number of spinous processes in hippocampal neurons.

[0104] Figure 10 This demonstrates the effect of anti-EphA4 monoclonal antibody in inhibiting tau phosphorylation in vivo.

[0105] Figure 11A The image shows the amino acids of the EphA4 ligand-binding domain (EphA4-LBD) on the horizontal axis and the structural region of antibody A-Fab on the vertical axis. Black blocks indicate intersections of interacting combinations.

[0106] Figure 11B The surface structure of the EphA4 ligand-binding domain (EphA4-LBD) is shown. Figure 11B In the model, the names and numbers of amino acids contained in the binding region are shown at the corresponding positions, and the CDRs of the H and L chains of the binding antibody A-Fab are shown in the band model.

[0107] Figure 12 The affinity of the humanized anti-EphA4 monoclonal antibody (antibody B) for human EphA4 was demonstrated.

[0108] Figure 13 The study demonstrated the enhanced EphA4 cleavage activity of the humanized anti-EphA4 monoclonal antibody (antibody B) in hippocampal neurons.

[0109] Figure 14The human EphA4-human ligand binding inhibitory activity of the humanized anti-EphA4 monoclonal antibody (antibody B) was demonstrated.

[0110] Figure 15 The humanized anti-EphA4 monoclonal antibody (antibody B) was shown to inhibit mouse EphA4-mouse ligand binding.

[0111] Figure 16 The selectivity of the humanized anti-EphA4 monoclonal antibody (antibody B) against the human Eph receptor was demonstrated.

[0112] Figure 17 The selectivity of the humanized anti-EphA4 monoclonal antibody (antibody B) against the mouse Eph receptor was demonstrated.

[0113] Figure 18 The reactivity of the humanized anti-EphA4 monoclonal antibody (antibody B) against EphA4 in mice, rats, monkeys, and humans was demonstrated.

[0114] Figure 19 The reactivity of the humanized anti-EphA4 monoclonal antibody (antibody B) against the extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1), and fibronectin type III domain 2 (FN2) of human EphA4 was demonstrated.

[0115] Figure 20 This study demonstrated the effect of humanized anti-EphA4 monoclonal antibody (antibody B) on increasing the number of spinous processes in hippocampal neurons.

[0116] Figure 21 The study demonstrated the enhanced human EphA4 cleavage activity of the humanized anti-human EphA4 monoclonal antibody (antibody B) in hippocampal neurons.

[0117] Figure 22 The study demonstrated the effect of humanized anti-EphA4 monoclonal antibody (antibody A) on increasing the number of spinous processes in hippocampal neurons via MMP and ADAM.

[0118] Figure 23 This study demonstrated the effect of humanized anti-EphA4 monoclonal antibody (antibody B) in inhibiting tau phosphorylation in vivo. Detailed Implementation

[0119] The SEQ ID NO. used in this article describes or encodes the following areas:

[0120]

[0121]

[0122] This disclosure relates to anti-EphA4 antibodies that bind to EphA4.

[0123] The anti-EphA4 antibody described in this disclosure is an antibody that can recognize and bind to EphA4, and as described below, the antibody can be a complete antibody or a synthetic antibody (such as a recombinant antibody, chimeric antibody, humanized antibody, etc.), as long as it has binding affinity for EphA4. EphA4 in this document can be understood as human, mouse, rat, and monkey-derived EphA4. Human, mouse, rat, and monkey-derived EphA4 can be obtained from public databases that have registered sequence information (such as Genbank provided by the United States National Center for Biotechnology Information), or the EphA4 gene sequence information can be obtained by designing primers based on the EphA4 base sequence information of closely related animal species and then cloning RNA extracted from the desired animal species. For example, the base sequence information of human, mouse, rat and monkey EphA4 is registered in the database with Genbank accession numbers NM_004438.5, NM_007936.3, NM_001162411.1 and NM_001260870.1, respectively.

[0124] In one aspect, an anti-EphA4 antibody is an antibody that specifically binds to EphA4. The term "specific binding" is well-known to those skilled in the art, and methods for determining specific binding between an antibody or its antigen-binding fragment and an antigen or epitope are also well-known. In one embodiment, "specific binding" is understood to mean that an anti-EphA4 antibody binds to EphA4 more rapidly and / or for a longer duration of time via an immune response with higher binding affinity and binding activity compared to binding with other target molecules. This does not mean that an antibody specifically binding to EphA4 does not bind to other target molecules. In another embodiment, "specific binding" may be defined by having at least about 10 [units of something] targeting EphA4. -7 M, or at least about 10 -8 M, or at least about 10 -9 Antibodies with a KD of M or lower are shown. Furthermore, in another further embodiment, "specific binding" is understood to mean binding to EphA4 via an immune response, but essentially not binding to other family molecules of the Eph receptor.

[0125] In one aspect, an anti-EphA4 antibody is an antibody that binds to the extracellular region of EphA4. In one embodiment, an anti-EphA4 antibody is an antibody that binds to the ligand-binding domain (LBD) of the extracellular region of EphA4.

[0126] In one embodiment, the anti-EphA4 antibody can specifically bind to EphA4 and enhance the cleavage of EphA4. In a particular embodiment, the anti-EphA4 antibody can specifically bind to EphA4 and enhance the cleavage of the extracellular domain of EphA4 via matrix metalloproteinases (MMPs) or ADAM (de-integrin and metalloproteinases).

[0127] In one embodiment, the anti-EphA4 antibody can specifically bind to EphA4 and inhibit the binding between EphA4 and its ligand, hepatinin.

[0128] In another embodiment, the anti-EphA4 antibody can specifically bind to EphA4 and increase the number of spikes in hippocampal neurons or stabilize the spikes in hippocampal neurons.

[0129] In one embodiment, this disclosure covers an anti-EphA4 antibody that specifically binds to at least one of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibits binding to its ligand. In another embodiment, this disclosure covers an anti-EphA4 antibody that specifically binds to two or more of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibits binding to its ligand. In yet another further embodiment, this disclosure covers an anti-EphA4 antibody that specifically binds to all of human EphA4, mouse EphA4, rat EphA4, and monkey EphA4 and inhibits binding to its ligand.

[0130] For methods used to measure the antigen-binding properties of anti-EphA4 antibodies (such as binding affinity and cross-species reactivity), methods well-known to those skilled in the art in the relevant technical field can be employed. For example, binding affinity can be measured using Biacore. TM Biosensors, KinExA biosensors, scintillation proximity assays, ELISA, ORIGEN immunoassays (IGEN), flow cytometry, fluorescence extinction, fluorescence transfer, yeast visualization, and / or immunostaining can be used for assays, but are not limited to these. The neutralizing activity of anti-EphA4 antibodies against the binding between EphA4 and its ligands can be measured using Biacore. TM The assay may be performed using biosensors, ELISA, and / or flow cytometry, but is not limited to these.

[0131] The anti-EphA4 antibody described in this disclosure can be a monoclonal antibody, as long as it binds to EphA4.

[0132] The anti-EphA4 antibody described in this disclosure can be of any class, such as IgG, IgA, or IgM (or its subclasses), and is not limited to a specific class. Immunoglobulins are classified into different classes based on the amino acid sequence of the constant region of the heavy chain (which may be referred to as the H chain). There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and some of these can be further subdivided into subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The constant regions of the heavy chain corresponding to different classes of immunoglobulins are referred to as α, δ, ε, γ, and μ, respectively. In addition, the type of the light chain (which may be referred to as the L chain) of the antibody is the λ chain and the κ chain. The anti-EphA4 antibody described in this disclosure can be an IgG antibody, such as an IgG1 antibody or an IgG2 antibody. Furthermore, the anti-EphA4 antibody described in this disclosure can, in some cases, be in monomeric, dimeric, or multimeric form.

[0133] According to this disclosure, the variable region of an antibody may refer to the variable region of the antibody light chain and / or the variable region of the antibody heavy chain, and the constant region of an antibody may refer to the constant region of the antibody light chain and / or the constant region of the antibody heavy chain. The variable regions of the heavy and light chains are each composed of four frame regions (FRs) connected by three CDRs, also known as complementarity-determining regions. The CDRs in each chain remain adjacent through the FRs and together with the CDRs in the other chain contribute to the formation of the antigen-binding site of the antibody. Techniques for determining CDRs include, but are not limited to, methods based on cross-species sequence variability (e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, 1991, National Institutes of Health, Bethesda, MD); and (2) methods based on the crystalline structure studies of antigen-antibody complexes (Al-lazikani et al., 1997 J. Molec. Biol. 273:927-948). These methods, or other methods, can also be used in combination.

[0134] In this article, monoclonal antibodies can refer to antibodies obtained from a substantially homogeneous population of antibodies. In other words, the individual antibodies contained within the population are identical, except for the possibility of naturally occurring mutations present in small amounts. Monoclonal antibodies target a single antigenic site and are highly specific. Furthermore, unlike typical polyclonal antibodies that target different antigens or different epitopes, each monoclonal antibody targets a single epitope of an antigen. The modifier “monoclonal” indicates the characteristic of antibodies obtained from a substantially homogeneous population of antibodies and should not be construed as limiting the methods required to produce antibodies.

[0135] According to this disclosure, the anti-EphA4 antibody can be a mouse antibody, a chimeric antibody, or a humanized antibody. A chimeric antibody is, for example, an antibody that fuses the variable region of a non-human (e.g., mouse or rat) antibody with the constant region of a human antibody; for example, it can refer to an antibody where the variable region is derived from a non-human antibody and the constant region is derived from a human antibody. A humanized antibody is, for example, an antibody that incorporates the complementarity-determining region (CDR, also known as the hypervariable region) of a non-human antibody into a human antibody; and for example, it can refer to an antibody where the CDR is derived from a non-human antibody and the remaining antibody regions are derived from a human antibody. Note that the boundary between chimeric and humanized antibodies is not necessarily clear, and antibodies can be in a state that can be called either chimeric or humanized antibodies. Furthermore, in chimeric or humanized antibodies, the antibody region (FR, constant region) derived from the human antibody does not necessarily have to consist entirely of amino acids derived from the human antibody and may contain one or more amino acids from a non-human antibody, provided it can be normally used in human subjects. One example of a humanized antibody is an antibody where the CDR is derived from a rodent antibody and the remaining antibody regions are derived from a human antibody. A specific embodiment of a humanized antibody is an antibody in which the CDR is derived from a mouse antibody and the remaining antibody region is derived from a human antibody. In these embodiments, the CDR may contain one or more amino acids derived from a non-rodent antibody or from a non-mouse antibody, and the antibody region other than the CDR may contain one or more amino acids derived from a non-human antibody. Here, "a plurality of" is, but is not limited to, 2-20, or 2-15 (e.g., 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2) or up to 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the number of amino acids in the amino acid sequence. Humanization can be performed using CDR transplantation (Kontermann and Dubel, Antibody Engineering, Springer Lab Manual (2001) and Tsurushita et al., Methods 36:69-83 (2005)). Furthermore, it can be performed by replacing the corresponding sequence in the human antibody with the CDR sequence using methods well-known in the relevant technical field (see, for example, Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); and Verhoeyen et al., Science 239:1534-1536 (1988)).

[0136] To reduce antigenicity, the selection of the human variable region (FR) from the light and heavy chains after preparing the humanized antibody may be important. According to the "best fit" method, the variable region sequence of the rodent antibody is screened against an entire library of known human FR sequences. Next, the human sequence closest to the rodent sequence is accepted as the human FR for the humanized antibody. See, for example, Sims et al., J. Immunol. [Journal of Immunology] 151:2296-2308 (1993) and Chothia et al., J. Mol. Biol. [Journal of Molecular Biology] 196:901-917 (1987). In another approach, a specific frame containing a common sequence from a specific subgroup of the light or heavy chain is used in all human antibodies. Several different humanized antibodies can use the same frame. See, for example, Carter et al., Proc. Natl. Acad. Set USA [Proceedings of the National Academy of Sciences of the United States of America] 89:4285-4289 (1992) and Presta et al., J. Immunol. [Journal of Immunology] 151:2623-2632 (1993).

[0137] Furthermore, it is generally desirable for humanized antibodies to retain high binding affinity for antigens and other preferred biological properties. To this end, humanized antibodies are prepared according to a method involving the analysis of the parental sequence and various conceptual humanized products using a three-dimensional model employing both the parental and humanized sequences. Typically, three-dimensional immunoglobulin models are available and are known to those skilled in the art. Computer programs can be used to illustrate and demonstrate promising three-dimensional conformations of selected candidate immunoglobulin sequences. Studies of these demonstrations allow for the analysis of the possible roles of residues in the function of the candidate immunoglobulin sequences, i.e., the analysis of residues affecting the ability of candidate immunoglobulins to bind their antigens. Using this method, FR residues can be selected from the acceptor and input sequences and combined to achieve desired antibody properties, such as increased binding affinity to single or multiple target antigens (e.g., EphA4 or fragments thereof).

[0138] Of course, antibodies that have appropriate alterations (such as antibody modification, or partial substitution, addition, and / or deletion of the antibody's amino acid sequence) in the chimeric or humanized antibodies exemplified above while maintaining the antibody's function (or for adding to or improving the antibody's function) are also covered in the anti-EphA4 antibodies according to this disclosure. More specifically, antibodies that alter the amino acid sequence of the constant region to modify the effector function of the antibody are also included within the scope of this disclosure. For example, antibodies that replace valine (Val) at position 234 (Eu number) of a human IgG2 antibody with alanine (Ala) and have replaced glycine (Gly) at position 237 with alanine (Ala) are also included within the scope of this disclosure in order to reduce antibody-dependent cytotoxicity (ADCC) activity and / or antibody-dependent phagocytosis (ADCP) activity. Furthermore, antibody-binding sites having the CDR sequence of the anti-EphA4 antibody according to this disclosure, along with bispecific antibodies that bind to different antigens (Kontermann (2012), mAbs 4, 182-97), are also included within the scope of this disclosure.

[0139] The anti-EphA4 antibody disclosed herein can be modified as needed. Modifications to the anti-EphA4 antibody may include alterations to (a) the three-dimensional structure of the amino acid sequence in the region to be modified, such as sheet or helical conformations; (b) the charge or hydrophobic state of the molecule at the target site; or (c) the effect of the modification on the maintenance of side chain volume, or modifications in which these changes are not readily observable.

[0140] According to this disclosure, the modification of the anti-EphA4 antibody can be achieved, for example, by substitution, deletion, or addition of constituent amino acid residues.

[0141] The term "amino acid" as used herein is used in its broadest sense, including not only natural amino acids such as serine (Ser), asparagine (Asn), valine (Val), leucine (Leu), isoleucine (Ile), alanine (Ala), tyrosine (Tyr), glycine (Gly), lysine (Lys), arginine (Arg), histidine (His), aspartic acid (Asp), glutamic acid (Glu), glutamine (Gln), threonine (Thr), cysteine ​​(Cys), methionine (Met), phenylalanine (Phe), tryptophan (Trp), and proline (Pro), but also non-natural amino acids such as amino acid variants and derivatives. Those skilled in the art will naturally understand that, given this broad definition, for example, L-amino acids; D-amino acids; chemically modified amino acids such as amino acid variants and derivatives; amino acids that are not protein components in vivo, such as ortholeucine, β-alanine, and ornithine; and chemically synthesized compounds having amino acid characteristics well known to those skilled in the art are included as amino acids in this specification. Examples of non-natural amino acids may include, for example, α-methyl amino acids (such as α-methylalanine), D-amino acids (such as D-aspartic acid and D-glutamic acid), histidine-like amino acids (such as 2-amino-histidine, β-hydroxy-histidine, homohistidine, α-fluoromethyl-histidine and α-methyl-histidine), amino acids with an extra methylene group in the side chain (“hyper” amino acids), and amino acids in which the carboxylic acid functional group in the side chain is replaced by a sulfonic acid group (such as sulfoalanine).

[0142] Naturally occurring amino acid residues can be classified into the following groups, for example, based on general side chain characteristics:

[0143] (1) Hydrophobicity: Met, Ala, Val, Leu, Ile;

[0144] (2) Neutral hydrophilicity: Asn, Gln, Cys, Ser, Thr;

[0145] (3) Acidity: Asp, Glu;

[0146] (4) Alkaline: His, Lys, Arg;

[0147] (5) Residues affecting chain orientation: Gly, Pro; and

[0148] (6) Fang: Trp, Tyr, Phe.

[0149] Non-conserved substitutions of the amino acid sequence constituting an antibody can be made by exchanging an amino acid belonging to one of these groups with an amino acid belonging to another group. More conserved substitutions can be made by exchanging an amino acid belonging to one of these groups with another amino acid in the same group. Similarly, deletions or substitutions of amino acid sequences can also be made as appropriate.

[0150] Modification of the amino acids constituting an antibody can be achieved, for example, through glycosylation of carbohydrates or post-translational modifications such as acetylation or phosphorylation. Antibodies can undergo glycosylation at conserved sites within their constant regions. Antibody glycosylation is typically N-linked or O-linked. N-linking refers to the binding of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine, asparagine-X-threonine, and asparagine-X-cysteine ​​(where X is any amino acid other than proline) are recognition sequences for the enzymatic addition of the carbohydrate moiety to the asparagine side chain. Potential glycosylation sites exist when one of these tripeptide sequences is present in the antibody. O-linked glycosylation can be the binding of N-acetylgalactosamine, galactose, or xylose to a hydroxy amino acid (such as serine or threonine), and in some cases, to 5-hydroxyproline or 5-hydroxylysine. Those skilled in the art can appropriately select glycosylation conditions (e.g., the type of host cell or cell culture medium, pH, etc. when performing glycosylation using biological methods) according to their purpose.

[0151] The anti-EphA4 antibody disclosed herein can be further modified, either alone or in combination, using other modification methods based on common technical knowledge well known to those skilled in the art.

[0152] The anti-EphA4 antibody according to this disclosure can be generated by methods well known to those skilled in the art. For example, the antibody can be generated by integrating a nucleic acid encoding an anti-EphA4 antibody according to this disclosure into an expression vector, introducing the expression vector into a host cell, and culturing the host cell. Therefore, this disclosure covers a method for generating an anti-EphA4 antibody, including a nucleic acid encoding an anti-EphA4 antibody, a vector containing said nucleic acid, a host cell containing said vector, and a step of culturing the host cell.

[0153] The nucleic acid encoding the anti-EphA4 antibody according to this disclosure may have DNA encoding a signal sequence, or may have DNA encoding a signal sequence at the 5' end of both the DNA encoding the heavy chain variable region and the DNA encoding the light chain variable region. The signal sequence is an amino acid residue present at the N-terminus of a protein that is essential for the passage of secretory proteins or integrated membrane proteins through the lipid bilayer after synthesis on the ribosome, and is not particularly limited in this disclosure as long as it is a functional sequence. Signal sequences that may be included in the anti-EphA4 antibody according to this disclosure may include signal sequences derived from humans, mice, rats, rabbits, donkeys, goats, horses, birds, dogs, cats, yeast, etc. Specifically, in this disclosure, peptides containing the amino acid sequence represented by SEQ ID NO. 12 or 16 may be included as heavy chain-related signal sequences, and peptides containing the amino acid sequence represented by SEQ ID NO. 14 or 18 may be included as light chain-related signal sequences. Furthermore, provided they are functionally equivalent, the signal sequence may have substitutions, additions, and / or deletions of one or more (e.g., 2, 3, 4, or 5) amino acids from the amino acid sequence represented by SEQ ID NO. 12 or 16 and the amino acid sequence represented by SEQ ID NO. 14 or 18.

[0154] The anti-EphA4 antibody disclosed herein can be isolated or purified using methods well known to those skilled in the art.

[0155] In this article, "isolated" or "purified" means artificially separated or purified from its natural state. It also refers to a molecule or composition that is naturally occurring, but is altered or removed from its original environment, or both. Examples of separation or purification methods include, but are not limited to, electrophoresis, molecular biology, immunology, or chromatographic methods, specifically ion exchange chromatography, hydrophobic chromatography, reversed-phase HPLC, isoelectric focusing, or alkaline extraction.

[0156] In one embodiment, the anti-EphA4 antibody comprises the following CDRs:

[0157] (a) Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO.44;

[0158] (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 27;

[0159] (c) Heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO. 28;

[0160] (d) A light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO. 29;

[0161] (e) a light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 30; and

[0162] (f) The light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO.31.

[0163] In one embodiment, the anti-EphA4 antibody is a humanized antibody or a chimeric antibody, and in a particular embodiment it is a humanized antibody.

[0164] In another embodiment, the anti-EphA4 antibody comprises a heavy chain and a light chain, wherein the variable region of the heavy chain comprises the amino acid sequence shown in SEQ ID NO. 45, and the variable region of the light chain comprises the amino acid sequence shown in SEQ ID NO. 46. Note that in this embodiment, the variable region of the heavy chain and / or the variable region of the light chain may comprise an amino acid sequence having one or more amino acid substitutions, additions, and / or deletions in the amino acid sequence shown in SEQ ID NO. 45 and / or in the amino acid sequence shown in SEQ ID NO. 46. Here, "a plurality of" is not limited, as long as it retains binding affinity for EphA4 and enhances EphA4 cleavage, and is 2-15 or 2-10 (e.g., 9, 8, 7, 6, 5, 4, 3, or 2), or less than 10% of the number of amino acids in the amino acid sequence, such as less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%.

[0165] In one embodiment, the heavy chain of the anti-EphA4 antibody contains the constant region of human IgG2.

[0166] In a particular embodiment, the constant region of human IgG2 contains the amino acid sequence of SEQ ID NO.47.

[0167] In one embodiment, the light chain of the anti-EphA4 antibody contains the constant region of human Igκ.

[0168] In a particular embodiment, the constant region of human Igκ contains the amino acid sequence of SEQ ID NO.48.

[0169] In one embodiment, the anti-EphA4 antibody comprises a heavy chain and a light chain, the heavy chain comprising the amino acid sequence shown in SEQ ID NO:59 and the light chain comprising the amino acid sequence shown in SEQ ID NO:60.

[0170] For example, in another embodiment, lysine residues are deleted at the C-terminal (carboxyl terminus) position of the heavy chain of the anti-EphA4 antibody for reasons such as reducing the unevenness of antibodies produced by antibody-producing cells (U.S. Patent Application Publication No. 2010 / 0297697 or Liu H et al., MAbs. Sep-October 2014; 6(5):1145-1154). In this disclosure, anti-EphA4 antibodies with C-terminal lysine residues deleted from the heavy chain also include anti-EphA4 antibodies with C-terminal lysine residues deleted from the heavy chain through genetic modification or anti-EphA4 antibodies with C-terminal lysine residues deleted from the heavy chain post-translationally by carboxypeptidase or the like. Furthermore, in this disclosure, anti-EphA4 antibodies with C-terminal lysine residues deleted from the heavy chain include not only anti-EphA4 antibodies with C-terminal lysine residues deleted in both heavy chains, but also anti-EphA4 antibodies with C-terminal lysine residues deleted in only one heavy chain.

[0171] In one aspect, this disclosure relates to isolated nucleic acids encoding anti-EphA4 antibodies. Isolated nucleic acids encoding anti-EphA4 antibodies refer to one or more nucleic acid molecules encoding a heavy chain and / or a light chain of an anti-EphA4 antibody. In one embodiment, the nucleic acid according to this disclosure encodes the heavy chain of an anti-EphA4 antibody. In another embodiment, the nucleic acid according to this disclosure encodes the light chain of an anti-EphA4 antibody. In yet another further embodiment, the nucleic acid according to this disclosure encodes both the heavy and light chains of an anti-EphA4 antibody. The nucleic acid according to this disclosure also includes a first nucleic acid molecule encoding the heavy chain of an anti-EphA4 antibody and a second nucleic acid molecule encoding the light chain of an anti-EphA4 antibody.

[0172] On the other hand, this disclosure relates to vectors containing isolated nucleic acids encoding anti-EphA4 antibodies. According to this disclosure, a vector refers to one or more vectors containing isolated nucleic acids encoding anti-EphA4 antibodies. In one embodiment, a vector according to this disclosure is a vector containing nucleic acids encoding both the heavy and light chains of an anti-EphA4 antibody. In another embodiment, a vector according to this disclosure is a vector containing both the heavy and light chains of an anti-EphA4 antibody. In yet another further embodiment, a vector according to this disclosure contains a first vector encoding the heavy chain of an anti-EphA4 antibody and a second vector encoding the light chain of an anti-EphA4 antibody. Vectors according to this disclosure can be, but are not limited to, plasmids, kinases, viruses, bacteriophages, etc. For example, as viral vectors, retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, or herpes simplex virus vectors are also included in vectors according to this disclosure.

[0173] In another aspect, the host cell comprising the vector according to this disclosure and the method for generating anti-EphA4 antibodies comprising the step of culturing said host cell are also included in this disclosure. The host cell according to this disclosure may be, but is not limited to, *E. coli* cells, monkey COS cells, Chinese hamster ovary (CHO) cells, NSO cells, etc. In one embodiment, the method for generating anti-EphA4 antibodies includes the step of culturing the host cell and the step of recovering the secreted anti-EphA4 antibodies from the host cell (or the culture medium of the host cell).

[0174] In one aspect, this disclosure relates to pharmaceutical compositions comprising an anti-EphA4 antibody. Pharmaceutical compositions according to this disclosure can be manufactured according to known methods, such as those described in the Japanese Pharmacopoeia (JP), the United States Pharmacopeia (USP), or the European Pharmacopoeia (EP).

[0175] The anti-EphA4 antibody disclosed herein may be used to treat Alzheimer's disease. In other words, in other respects, this disclosure covers a method for treating Alzheimer's disease, said method comprising the step of administering a therapeutically effective amount of the anti-EphA4 antibody to a subject suffering from Alzheimer's disease. Furthermore, in other respects, this disclosure covers the use of the anti-EphA4 antibody in the manufacture of a therapeutic medicament for Alzheimer's disease. In other respects, this disclosure covers the anti-EphA4 antibody for use in the treatment of Alzheimer's disease.

[0176] The anti-EphA4 antibody disclosed herein may be used to treat tau lesions. In other words, in other respects, this disclosure covers methods for treating tau lesions, said methods comprising the step of administering a therapeutically effective amount of the anti-EphA4 antibody to a subject suffering from tau lesions. Furthermore, in other respects, this disclosure covers the use of the anti-EphA4 antibody in the manufacture of a therapeutic medicine for tau lesions. In other respects, this disclosure covers the use of the anti-EphA4 antibody in the treatment of tau lesions. The tau lesions disclosed herein include Alzheimer's disease or frontotemporal degeneration with tau pathology (FTLD-tau). Furthermore, frontotemporal degeneration with tau pathology includes progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), aerophilic granular dementia (AGD), neurofibrillary tangles-type Alzheimer's disease (SD-NFT), Pick's disease (PiD), etc.

[0177] The anti-EphA4 antibody according to this disclosure can be used alone or in combination with other agents or compositions in a treatment regimen. For example, the anti-EphA4 antibody according to this disclosure can be administered simultaneously or separately from another agent. Such combination therapy includes combined administration (two or more agents included in the same or different formulations) and separate administration (such as simultaneously or sequentially). When two or more agents are administered separately, the administration of the anti-EphA4 antibody according to this disclosure can be performed before or after the concomitant treatment.

[0178] There are no limitations on the subjects to whom the pharmaceutical compositions according to this disclosure are administered, and they may be used, for example, in humans or non-human mammals (such as monkeys, mice, rats, rabbits, cattle, horses, and goats).

[0179] There are no limitations on the method of administering the pharmaceutical composition according to this disclosure to the subject (such as route of administration, dosage, number of times per day and time of administration), and it can be appropriately determined by a person skilled in the art (such as a physician) based on the subject's health status, the severity of the disease, the type of pharmaceutical agents used in combination, etc.

[0180] Those skilled in the art will recognize that, provided there is no technical contradiction, the invention can be practiced by any suitable combination of one or more of all aspects described herein. Furthermore, those skilled in the art will recognize that, provided there is no technical contradiction, it is preferable to practice the invention by suitable combination of all preferred or advantageous aspects described herein.

[0181] All disclosures in the references cited herein shall be deemed to be expressly incorporated herein by reference, and those skilled in the art shall understand the relevant disclosures in those references in light of the context of this document without departing from the spirit and scope of the invention, by referring to these references as part of this specification.

[0182] The references cited herein are provided solely for the purpose of disclosing the relevant art prior to the filing date of this application and should not be construed as an admission by the inventors that they do not have prior rights to the disclosed content due to prior inventions or any other reason. The entire description of all these references is based on information available to the applicants and does not in any way constitute an admission that the descriptions are accurate.

[0183] The terminology used herein is for describing particular embodiments and is not intended to limit the invention.

[0184] Unless the context clearly indicates otherwise, the term “comprise” as used herein means the presence of the described items (e.g., components, steps, elements, or figures), without excluding the presence of other items (e.g., components, steps, elements, and figures). The term “consist of” covers aspects described by the terms “consist of” and / or “consist essentially of”.

[0185] As used herein, the term "neutralizing activity" refers to the activity that inhibits the binding between EphA4 and its ligands, and / or the activity that inhibits the alteration of cellular signal transduction or molecular expression responses or functions induced by the binding of EphA4 and its ligands in the human body.

[0186] Unless otherwise defined, all terms used herein (including technical and scientific terms) shall have the same meaning as broadly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise expressly defined, terms used herein shall be interpreted as having the same meaning as in this document and in the relevant technical field, and shall not be interpreted as having an idealized or overly formal meaning.

[0187] For example, the terms "first" and "second" are used to express various elements, and it should be recognized that these elements are not limited by these terms themselves. These terms are only used to distinguish elements from other elements; for example, a first element may be referred to as a second element without departing from the scope of the invention, and similarly, a second element may be referred to as a first element.

[0188] Unless explicitly stated otherwise, numerical values ​​used herein to indicate component content or ranges should be understood to be modified by the term "about". For example, "4°C" is understood to mean "about 4°C" unless explicitly stated otherwise, and it will be apparent to those skilled in the art that their range can be reasonably understood in light of common technical knowledge and the meaning of the paragraphs herein.

[0189] Unless the context clearly indicates otherwise, when used in the description and claims herein, it should be recognized that aspects expressed in the singular can also be in the plural form, provided that they are not technically contradictory, and vice versa.

[0190] The invention will now be described in more detail with reference to examples. However, the invention can be embodied in various ways and should not be construed as limited to the examples described herein. Those skilled in the art can implement the invention with various modifications, additions, omissions, substitutions, etc., without changing the spirit or scope of the invention.

[0191] Example

[0192] Reference Example 1: Preparation of Anti-EphA4 Monoclonal Antibody

[0193] (A) Preparation of mouse anti-EphA4 monoclonal antibody

[0194] To prepare a monoclonal antibody that binds to mouse EphA4 (accession number NP_031962.2, SEQ ID NO.1), a secretory alkaline phosphatase (SEAP) fused to the extracellular region (positions 20-547) of mouse EphA4 (SEQ ID NO.2) and a histidine-tagged protein (hereinafter referred to as "mouse EphA4 extracellular region-SEAP-His protein," SEQ ID NO.3) was prepared by the following steps.

[0195] First, DNA sequences encoding the mouse EphA4 signal sequence (SEQ ID NO.4) and extracellular region (SEQ ID NO.2) were amplified by RT-PCR using total brain RNA derived from mice, and cloned into the Sal I / Not I sites of the pENTR1A vector (Ingentech / LifeScience). Then, the DNA sequences encoding the mouse EphA4 signal sequence, extracellular region, SEAP, and histidine tag were transferred to the pcDNA 3.1_rfcB vector via the Gateway system (Ingentech / LifeScience) using an LR reaction to construct the pcDNA 3.1-mouse EphA4 extracellular region-SEAP-His expression vector. The constructed pcDNA 3.1-mouse EphA4 extracellular region-SEAP-His expression vector was transfected into HEK293EBNA cells (Ingentech / LifeScience) using TransIT-LT1 (Takara Bio Inc.). After incubation (5% CO2, 37°C) for 6 days, the culture supernatant was recovered. Mouse EphA4 extracellular domain-SEAP-His protein (SEQ ID NO.3) was purified from the recovered culture supernatant using a Protino column (MACHEREY-NAGEL).

[0196] Twenty micrograms of mouse EphA4 extracellular SEAP-His protein were mixed with an equal amount of TiterMax Gold adjuvant (TiterMax USA) or GERBU adjuvant (GERBU Biotechnik GmbH) and injected subcutaneously into the paw pads of Balb / c mice. The mouse EphA4 extracellular SEAP-His protein was then administered similarly on days 3, 7, and 10. Here, TiterMax Gold adjuvant (TiterMax USA) was used only on day 10, and GERBU adjuvant (GERBU Biotechnik GmbH) was used on days 3, 7, and 10. Mice were sacrificed on day 13, and peripheral lymph nodes were collected to prepare lymph node cells. The prepared lymph node cells and P3U1 myeloma cells (donated by Kyoto University) were fused at a 5:1 ratio in the presence of GenomeONE-CF (Ishihara Sangyo Co., Ltd.). The fused cells were cultured in 96-well plastic plates. After incubation (5% CO2, 37℃) for 7 days, the culture supernatant was recovered.

[0197] Using the obtained culture supernatant, wells that were reactive to mouse, rat, and human EphA4 were selected.

[0198] The responsiveness to mouse, rat, and human EphA4 was assessed using ELISA and protein (the protein having the Fc region of human IgG1 fused to the extracellular region of mouse EphA4, the extracellular region of rat EphA4 (positions 20-547) (Genbank accession number NP_001155883.1), or the extracellular region of human EphA4 (Genbank accession number NP_004429.1, SEQ ID NO.5) (positions 20-547) (SEQ ID NO.6) and histidine labeling (hereinafter referred to as "mouse EphA4 extracellular region-Fc-His protein", "rat EphA4 extracellular region-Fc-His protein" or "human EphA4 extracellular region-Fc-His protein" respectively)).

[0199] The mouse, rat, or human EphA4 extracellular region-Fc-His protein was prepared via the following steps. Initially, the pcDNA3.1-mouse, rat, or human EphA4 extracellular region-Fc-His expression vector was constructed. First, total RNA from the brain of mice, rats, or humans was amplified by RT-PCR using DNA sequences encoding the mouse, rat, or human EphA4 signal sequence and extracellular region, and cloned into the Sal I / Not I site of the pENTR1A vector (Ingenieur Biotech / LifeScience). Then, the DNA sequences encoding the mouse, rat, or human EphA4 signal sequence and extracellular region, Fc, and histidine tag were transferred to the pcDNA 3.1_rfcB vector via an LR reaction using the Gateway system (Ingenieur Biotech / LifeScience) to construct the pcDNA 3.1-mouse, rat, or human EphA4 extracellular region-Fc-His expression vector. Using TransIT-LT1 (Takara Bio Inc.), these constructed expression vectors were transfected into HEK293 EBNA cells (Ingenie Biotech / Life Science Corporation). After incubation (5% CO2, 37°C) for 6 days, the culture supernatant was recovered.

[0200] The ELISA was performed using mouse, rat, or human EphA4 extracellular domain-Fc-His protein according to the following steps. Anti-human IgG antibody (Jackson ImmunoResearch Laboratories) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked with 1x blocking ACE (Dainippon Seiyaku) for one hour at room temperature. After washing three times with 0.02% Tween 20 / PBS (Nacalai Tesque), culture supernatant containing mouse, rat, or human EphA4 extracellular domain-Fc-His protein was added to each well (final concentration 1 nM) and incubated for one hour at room temperature. After three washes, culture supernatant of fused cells was added to each well. After incubation for one hour at room temperature and washing three times, horseradish peroxidase-labeled anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories) was added and incubated for one hour at room temperature. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to each well and incubated at room temperature for 5–20 minutes. An equal volume of stop solution (2N H2SO4, Wako Pure Chemical) was added to each well, and the absorbance was read at 450 nm using a microplate reader (PerkinElmer).

[0201] Hybridomas were cloned from the wells selected in the above steps using a limiting dilution method, and hybridoma clones expressing mouse anti-EphA4 antibodies with binding activity against mouse, rat, and human EphA4 were finally obtained.

[0202] The hybridoma clones obtained from the culture were purified from the culture supernatant using protein A (GE Healthcare) to obtain mouse anti-EphA4 monoclonal antibody.

[0203] (B) Evaluation of EphA4 cleavage enhancement activity

[0204] Rat hippocampal neurons were prepared according to the following steps. On day 18 of gestation, fetal rats (Charles River Laboratories Japan) were removed from their heads, and the brains were extracted. The hippocampus was excised under a stereomicroscope and placed in a digestive solution (137 mM NaCl (Wacopur Chemicals), 5 mM KCl (Wacopur Chemicals), 7 mM Na2HPO4 (Wacopur Chemicals), 25 mM Hepes (DOJINDO), 0.5 mg / mL DNase (Sigma-Aldrich), and 0.25% trypsin (Lifetechnologies)) and shaken at 37°C for 10 minutes. The solution was removed, and 20% fetal bovine serum / Hanks buffer (Sigma-Aldrich) was added. The solution was removed, and the tissue was washed twice with Hanks buffer. The hippocampal tissue was then pipetteted into Hanks buffer to prepare a cell suspension. Cells were seeded into 96-well culture dishes (Falcon) that had been coated with a culture medium containing poly-L-lysine (Neuron Basis Medium (Lifetechnologies), 1x B-27 supplement (Lifetechnologies), and 0.5 mM L-glutamine (Lifetechnologies)).

[0205] The following steps were performed to assess EphA4 cleavage enhancement activity in hippocampal neurons. Rat hippocampal neurons seeded in 96-well culture dishes (Folken) were treated with anti-EphA4 monoclonal antibody (67 nM) and γ-selectase inhibitor compound E (50 nM, Enzo LifeSciences). Sixteen hours later, the cells were washed with PBS (Wacopur Chemicals), and SDS sample buffer (Laemmli sample buffer (Bio-Rad)) and 5% 2-mercaptoethanol (Bio-Rad) were added to recover the cells, which were then boiled for 5 minutes. SDS-PAGE was performed on the sample, and Western blotting was performed with anti-EphA4 monoclonal antibody (Abnova), the intensity of the bands was quantified, and the EphA4 C-terminal fragment / full-length EphA4 value was calculated.

[0206] A mouse anti-EphA4 monoclonal antibody with enhanced activity in cleaving EphA4 (antibody A) was obtained. The isotype of antibody A was determined using a monoclonal antibody typing kit (Serotec): for heavy chain IgG1, for light chain κ.

[0207] (C) Sequence analysis of antibody A

[0208] The signal sequence encoding antibody A and the DNA sequences encoding the variable regions of the heavy and light chains were amplified using the 5'-RACE (5'-rapid amplification of cDNA ends) method. Total RNA was prepared from hybridomas using the RNeasy kit (QIAGEN) and treated with DNase (QIAGEN, RNase-free DNase kit). Double-stranded cDNA was prepared from the total RNA using a cDNA synthesis kit (Takara Bio Inc.). 5' adaptors obtained by annealing oligoDNA ad29S (ACATCACTCCGT) (SEQ ID NO. 7) and oligoDNA ad29AS (ACGGAGTGATGTCCGTCGACGTATCTCTGCGTTGATACTTCAG CGTAGCT) (SEQ ID NO. 8) were added to the cDNA. The obtained cDNA was amplified, with the 5' forward primer (5'-PCR4 primer, AGCTACGCTGAAGTATCAACGCAGAG (SEQ ID NO. 9)) and the 3' reverse primer (GCCAGTGGATAGACTGATGG (SEQ ID NO. 10) used to amplify the mouse IgG heavy chain, and GATGATACAGTTGGTGCAGC (SEQ ID NO. 11) used to amplify the mouse Igκ light chain). The amplified cDNA was inserted into the pCR2.1 vector (Ingenieur Biotech / LifeScience). The gene sequence of antibody A was analyzed using an ABI 3130XL. The amino acid sequences encoding the antibody A gene sequence identified in this analysis are as follows: the heavy chain signal sequence is shown in SEQ ID NO. 12, the heavy chain variable region is shown in SEQ ID NO. 13, the light chain signal sequence is shown in SEQ ID NO. 14, and the light chain variable region is shown in SEQ ID NO. 15. The nucleotide sequence encoding the antibody A gene sequence includes the heavy chain signal sequence shown in SEQ ID NO.16, the heavy chain variable region shown in SEQ ID NO.17, the light chain signal sequence shown in SEQ ID NO.18, and the light chain variable region shown in SEQ ID NO.19.

[0209] The following steps were used to obtain the full-length sequences of the heavy and light chains of antibody A. Total RNA was prepared from hybridoma using the RNeasy kit (QIAGEN) and treated with DNase (QIAGEN, RNase-free DNase kit). Reverse transcription products were prepared from the total RNA using an RNA-PCR kit (Takara Bio Inc.). Using the obtained reverse transcription product as a template, the gene sequences encoding the heavy and light chains of antibody A were amplified by PCR using 5' forward primers (GCGAAGCTTGCCGCCACCATGGCTGTCCTGGTGCTGCTCC (primer ID 7455) (SEQ ID NO. 20) for heavy chain amplification, GCGAAGCTTGCCGCCACCATGGACATGAGGGTTCCTGCTCACG (primer ID 7453) (SEQ ID NO. 21) for light chain amplification) and 3' reverse primers (GCGGAATTCATCATTTACCAGGAGAGTGGGAGAGGC (primer ID 7257) (SEQ ID NO. 22) for heavy chain amplification, and CGCGAATTCACTAACACTCATTCCTGTTGAAGCTCTTGAC (primer ID 7249) (SEQ ID NO. 23) for light chain amplification). The amplified sequences were then cloned into pEE6.4 and pEE12.4 vectors (Lonza). The gene sequence was analyzed using an ABI3130XL. The amino acid sequence encoded by the antibody A gene sequence identified in this analysis includes the heavy chain constant region sequence shown in SEQ ID NO. 24 and the light chain constant region sequence shown in SEQ ID NO. 25.

[0210] The CDR of antibody A was determined using the following method. The amino acid sequence of antibody A was numbered using the Abysis software (UCL) according to the Kabat numbering system. Based on this numbering, a decision was made according to the Kabat definition used for CDR identification. The amino acid sequence of the CDR of antibody A is shown in Table 1.

[0211] [Table 1] Amino acid sequence of CDR of antibody A

[0212] Heavy chain CDR1 RYGVH (SEQ ID NO.26) Heavy chain CDR2 VIWRGGSTDYNAAFMS(SEQ ID NO.27) Heavy chain CDR3 ESLFGVYYDYGYYSMDY(SEQ ID NO.28) Light chain CDR1 RASQEISGYLS (SEQ ID NO.29) Light chain CDR2 AASTLDS (SEQ ID NO.30) Light chain CDR3 LQYASYPLT (SEQ ID NO.31)

[0213] Reference Example 2: Binding affinity of anti-EphA4 monoclonal antibody against mouse and human EphA4

[0214] The binding affinity of antibody A for mouse and human EphA4 was determined using a Biacore T200 (GE Healthcare) via surface plasmon resonance (SPR) method. First, the anti-His antibody (GE Healthcare, 28-9950-56) was immobilized onto a sensor plate CM5. Immobilization was performed using amine coupling with N-hydroxysuccinimide (NHS) and N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), with ethanolamine used for blocking (sensor plate and immobilization reagents were from GE Healthcare). The antibody was diluted to 3.5 μg / mL with immobilization buffer (10 mM sodium acetate, pH 4.5) and immobilized onto the sensor plate according to the protocol attached to the Biacore T200. Mouse or human EphA4 extracellular domain-SEAP-His10 was diluted with running buffer HBS-EP (GE Healthcare, BR-1001-88), and the solution was captured in a flow cell for 120 seconds (approximately 10 RU). Subsequently, antibody A was serially diluted with HBS-EP to the range of 100, 50, 25, 12.5, 6.3, 3.2, 1.6, and 0 nM, and added to the sensor plate for 120 seconds. The binding reaction curves were observed sequentially at the time of addition (binding period, 120 seconds) and after addition (dissociation period, 600 seconds). After each observation, 4M MgCl2 (60 seconds, Wacopur Chemicals) was added to regenerate the sensor plate. The binding reaction curves were fitted and analyzed using a 1:1 binding model using the system's included BIA evaluation software to calculate the binding affinity (KD = kd / ka) for mouse and human EphA4.

[0215] The binding affinity (KD value) of antibody A against mouse and human EphA4 was 1.32 x 10⁻⁶. -9 M and 1.19x10 -9 M( Figure 1 Other binding parameters against mouse and human EphA4 were almost identical. Therefore, antibody A is considered to have the same binding affinity for mouse and human EphA4.

[0216] Reference Example 3: Enhanced EphA4 cleavage activity of anti-EphA4 monoclonal antibody in hippocampal neurons

[0217] For antibody A, the following steps were performed to assess the EphA4 cleavage enhancement activity in hippocampal neurons. Rat hippocampal neurons seeded in 96-well culture dishes (Folken Laboratories) were treated with antibody A (2.0, 6.7, and 20 nM) and γ-selectase inhibitor compound E (50 nM, Enzo Life Sciences). After 24 hours, the cells were washed with PBS (Wacopur Chemicals), and SDS sample buffer (Limri sample buffer (Bio-Rad Laboratories) and 5% 2-mercaptoethanol (Bio-Rad Laboratories)) was added to recover the cells, followed by boiling for 5 minutes. SDS-PAGE was performed on the sample, and Western blotting was performed with anti-EphA4 monoclonal antibody (Annofa Laboratories), the intensity of the bands was quantified, and the EphA4 C-terminal fragment / full-length EphA4 value was calculated.

[0218] Antibody A concentration-dependently enhances the EphA4 cleavage response in hippocampal neurons. Figure 2 ).

[0219] Reference Example 4: Inhibitory activity of anti-EphA4 monoclonal antibody against mouse EphA4-mouse ligand binding

[0220] For antibody A, the inhibitory activity of mouse EphA4 binding to mouse ligands was assessed according to the following steps. Anti-alkaline phosphatase antibody (Thermo Scientific) was plated into the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharma Biomedical). After washing three times with 0.02% Tween 20 / PBS (Thermo Scientific), the extracellular domain of mouse EphA4—SEAP-His protein—was added to the wells (final concentration 10 nM), and incubated for one hour at room temperature. After washing three times, ligands and antibody A (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, and 3000 nM) were added to the wells. Note that biotinylated mouse hepatocyte ligand A1-Fc chimera (R&D Systems, final concentration 6 nM) and biotinylated mouse hepatocyte ligand B2-Fc chimera (R&D Systems, final concentration 2.5 nM) were used as ligands. After incubation at room temperature for one hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma-Aldrich) solution was added to the wells and incubated at room temperature for 2 minutes. An equal volume of stop solution (1 N H₂SO₄, Wacopure Chemicals) was added to the wells, and the absorbance was read at 450 nm using a microplate reader (PerkinElmer).

[0221] Antibody A concentration-dependently inhibited the binding of mouse EphA4 to mouse ligands, and its IC50 against the binding of mouse hepatin A1 and hepatin B2 was [not specified]. 50 The values ​​are approximately 5.9 nM and 3.1 nM, respectively. Figure 3 Therefore, this indicates that antibody A strongly inhibits the binding of mouse EphA4 to the ligand.

[0222] Reference Example 5: Inhibitory activity of human EphA4-human ligand binding of anti-EphA4 monoclonal antibody

[0223] For antibody A, the inhibitory activity of human EphA4 binding to human ligand was assessed according to the following steps. Anti-alkaline phosphatase antibody (Thermo Scientific) was plated into the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), the extracellular domain of human EphA4—SEAP-His protein—was added to the wells (final concentration 10 nM), and incubated for one hour at room temperature. After washing three times, the ligand and serially diluted antibody A (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, and 3000 nM) were added to the wells. Note that biotinylated human hepatocyte ligand A5-Fc chimera (R&D Systems, final concentration 0.7 nM) and biotinylated human hepatocyte ligand B3-Fc chimera (R&D Systems, final concentration 2.3 nM) were used as ligands. After incubation at room temperature for one hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells and incubated at room temperature for 2–5 minutes. An equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance was read at 450 nm using a microplate reader (Molecular Devices or PerkinElmer).

[0224] Antibody A concentration-dependently inhibits the binding of human EphA4 to human ligands, and has an IC50 against human hepatin A5 and hepatin B3 binding. 50 The values ​​are approximately 2.8 nM and 1.4 nM, respectively. Figure 4 Therefore, it is shown that antibody A also strongly inhibits the binding of human EphA4 to human ligands.

[0225] Reference Example 6: Selectivity of anti-EphA4 monoclonal antibody against human Eph receptor

[0226] Following the method for preparing mouse EphA4 extracellular region-SEAP-His protein as described in Reference Example 1, total RNA derived from tissues was used to amplify the signal sequence and extracellular region DNA sequence encoding each human Eph receptor (EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) by RT-PCR, and cloned into the pENTR1A vector (Ingenieur / Life Technologies) containing the DNA sequence encoding SEAP and histidine tags. Then, the DNA sequence encoding the signal sequence and extracellular region, SEAP, and histidine tag of each person's Eph receptor was transferred to the pcDNA 3.1_rfcB vector via the Gateway system (Engineer / Life Technologies) to construct a vector (referred to as the "Eph receptor extracellular region-SEAP-His protein expression vector") that expresses a protein with SEAP and His tags fused to the extracellular region of each person's Eph receptor.

[0227] Then, the extracellular region of the Eph receptor from the individual SEAP-His protein expression vector was introduced into Expi293F cells (Gibco / Thermo Fisher Scientific) using the Expi293 expression system (Gibco / Thermo Fisher Scientific). After culturing (5% CO2, 37°C, 120 rpm) for 5 days, the culture supernatant was recovered and centrifuged at 1500 rpm for 5 minutes at room temperature. The supernatant was filtered through a 0.45 μm filter (Millipore).

[0228] For antibody A, assess its binding activity to the human Eph receptor using the following steps.

[0229] Rabbit anti-6-His antibody (Bethyl Laboratories) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), each Eph receptor extracellular domain of human-SEAP-His protein (final concentration 1 nM) was seeded into each well and incubated for one hour at room temperature. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Pharma Corporation) and antibody A (10 μg / mL) were added to the wells and incubated for one hour at room temperature. Horseradish peroxidase-labeled donkey anti-mouse IgG antibody (Jackson Immunological Research Laboratory) was added and incubated for one hour at room temperature. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0230] Within the human Eph receptor family, antibody A has specific binding activity only against human EphA4. Figure 5 ).

[0231] Reference Example 7: Selectivity of anti-EphA4 monoclonal antibody against mouse Eph receptor

[0232] Following the method for preparing the EphA4 extracellular region-Fc-His protein according to Reference Example 1, total RNA derived from tissues was used to amplify the signal sequence and extracellular region DNA sequence encoding each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) by RT-PCR, and cloned into the pENTR1A vector (Ingenieur / Life Technologies) containing the Fc region encoding human IgG1 and a histidine tag. Then, the DNA sequences encoding the signal sequence and extracellular region, Fc, and histidine tag of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) were transferred into the pcDNA 3.1_rfcB vector via LR reaction using the Gateway system (Ingenieur / Lifetech Corporation) to construct extracellular region-Fc-His protein expression vectors for each mouse Eph receptor. In the construction of the mouse EphA2-Fc-His protein extracellular region expression vector, the signal sequence and extracellular region encoding mouse EphA2 were amplified by RT-PCR using total RNA derived from tissues, and cloned into the pcDNA 3.1 vector containing the DNA sequence encoding Fc and histidine tag to construct the mouse EphA2 extracellular region-Fc-His protein expression vector.

[0233] Then, each mouse Eph receptor extracellular domain-Fc-His protein expression vector was introduced into Expi293F cells (Gibberellic A.S. / Thermo Fisher Scientific) using the Expi293 expression system (Gibberellic A.S. / Thermo Fisher Scientific). After culturing (5% CO2, 37°C, 120 rpm) for 5 days, the culture supernatant was recovered and centrifuged at 1500 rpm for 5 minutes at room temperature. The supernatant was filtered through a 0.45 μm filter (Millibert & Co.).

[0234] For antibody A, assess the binding activity of mouse Eph receptors according to the following steps.

[0235] Rabbit anti-6-His antibody (Beth Laboratories) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), each well was seeded with mouse Eph receptor extracellular domain-Fc-His protein (final concentration 1 nM) and incubated for one hour at room temperature. After washing three times, human IgG solution (100 μg / mL, Sigma) and antibody A (10 μg / mL) were added to the wells and incubated for one hour at room temperature. Horseradish peroxidase-labeled donkey anti-mouse IgG antibody (Jackson Immunological Research Laboratory) was added and incubated for one hour at room temperature. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0236] Within the mouse Eph receptor family, antibody A exhibits specific binding activity only against mouse EphA4. Figure 6 ).

[0237] Reference Example 8: Reactivity of anti-EphA4 monoclonal antibodies against EphA4 in mice, rats, monkeys, and humans.

[0238] The extracellular region-Fc-His protein of EphA4 in mice, rats, monkeys, and humans was prepared according to the following steps. First, a monkey EphA4 extracellular region-Fc-His protein expression vector was constructed according to the method for preparing the EphA4 extracellular region-Fc-His protein according to Reference Example 1. The amino acid sequence of the monkey EphA4 used for vector construction is shown in SEQ ID NO. 32, and its extracellular region is shown in SEQ ID NO. 33. Various EphA4 extracellular region-Fc-His proteins were prepared using the monkey EphA4 extracellular region-Fc-His protein expression vector and the mouse, rat, and human EphA4 extracellular region-Fc-His protein expression vectors described in Reference Example 1.

[0239] For antibody A, assess its binding activity to various extracellular regions of EphA4 using the following steps.

[0240] Donkey anti-human IgG antibody (Jackson Immunology Research Laboratory) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked with 1% blocking ACE (DS Pharmaceuticals) at room temperature for one hour. After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), mouse, rat, monkey, and human EphA4 extracellular domain-Fc-His protein (final concentration 1 nM) was seeded into the wells and incubated at room temperature for one hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Pharmaceuticals) and antibody A (0, 0.00013, 0.00064, 0.0032, 0.016, 0.08, 0.4, 2, and 10 μg / mL) were added to the wells and incubated at room temperature for one hour. Horseradish peroxidase-conjugated donkey anti-mouse IgG antibody (Jackson Immunology Research Laboratory) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0241] Antibody A exhibited equivalent binding activity in all mouse, rat, monkey, and human EphA4 samples. Figure 7 ).

[0242] Reference Example 9: Anti-EphA4 monoclonal antibody targets the extracellular region, ligand-binding domain, and fibronectin of human EphA4. Reactivity of type III domain 1 and fibronectin type III domain 2

[0243] The following steps were followed to prepare a protein fused with human EphA4 extracellular domain (ECD), ligand-binding domain (LBD), fibronectin type III domain 1 (FN1) or fibronectin type III domain 2 (FN2) to maltose-binding protein (MBP) and a histidine tag (hereinafter referred to as "human EphA4 extracellular domain-MBP-His protein", "human EphA4 ligand-binding domain-MBP-His protein", "human EphA4 fibronectin type III domain 1-MBP-His protein", and "human EphA4 fibronectin type III domain 2-MBP-His protein"). Initially, the pcDNA 3.4 human EphA4 extracellular domain, ligand-binding domain, fibronectin type III domain 1 or fibronectin type III domain 2-MBP-His expression vector was constructed. First, the signal sequence of human EphA4 (SEQ ID NO. 34) or the signal sequence of proprototrypsin (SEQ ID NO. 35) and the DNA sequences encoding each domain of human EphA4 were amplified by PCR and cloned into a pcDNA 3.4 vector (Ingentech / LifeScience) containing DNA sequences encoding MBP and histidine tags to construct expression vectors for human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein. The amino acid sequence of human EphA4 used for vector construction is shown in SEQ ID NO. 5, its extracellular domain is shown in SEQ ID NO. 36, its ligand-binding domain is shown in SEQ ID NO. 37, its fibronectin type III domain 1 is shown in SEQ ID NO. 38, and its fibronectin type III domain 2 is shown in SEQ ID NO. 39. The above expression vectors were transfected into Expi293F cells (Thermo Scientific) using the Expi293 expression system (Thermo Scientific). After 4 days, the culture supernatant was recovered and filtered through a 0.45 μm filter (Millipore). Crude purification was performed using NEB resin, and the buffer was replaced with PBS (Wacopure) using a Zeba rotary desalting column (Thermo Scientific). The monomer fractions were differentially purified using Superdex 200 10 / 300 (GE Healthcare).

[0244] For antibody A, the following steps were performed to assess its binding activity to various domains in human EphA4.

[0245] Rabbit anti-6-His antibody (Beth Labs) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked with 1% blocking ACE (DS Pharmaceuticals) at room temperature for one hour. After washing twice with 0.02% Tween 20 / PBS (Nacalai Tesque), human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein (final concentration 10 nM) were seeded into the wells and incubated at room temperature for one hour. After washing three times, antibody A (final concentration 10 nM) was added to the wells and incubated at room temperature for one hour. Horseradish peroxidase-labeled goat anti-mouse IgG Fcγ fragment antibody (Jackson Immunological Research Laboratory) was added and incubated at room temperature for one hour. After washing five times, TMB solution (KPL) was added to the wells, and after confirming adequate staining, an equal volume of stop solution (2N H2SO4, Wacopure Chemicals) was added to the wells. The absorbance at 450 nm and 650 nm was read using a microplate reader (PerkinElmer).

[0246] Antibody A has binding activity to the extracellular domain (ECD) and ligand-binding domain (LBD) of human EphA4. Figure 8 It showed no response to fibronectin type III domain 1 (FN1) and fibronectin type III domain 2 (FN2). Therefore, antibody A was found to specifically bind to the ligand-binding domain of the extracellular region of human EphA4.

[0247] Reference Example 10: Effect of anti-EphA4 monoclonal antibody on increasing the number of spinous processes in hippocampal neurons

[0248] Rat hippocampal neurons were prepared as described in Reference Example 1(B) above. The EGFP gene was introduced into rat hippocampal neurons using nuclear transfection (Lonza Group), mixed with rat hippocampal neurons without the gene, and seeded into 24-well plates (Folken Corporation) containing poly-L-lysine-coated coverslips (Matsunami Glass Industries).

[0249] Spiral counting of rat hippocampal neurons was performed following these steps. Day 13 rat hippocampal neurons inoculated with EGFP were seeded in 24-well plates (Folken Chemicals) (with coverslips coated with poly-L-lysine (Matsunami Glass Industries)) and treated for 24 hours with either a control antibody (mouse IgG1; BioLegend) or antibody A (6.7 and 20 nM). The coverslips were then transferred to 2% PFA (Wacopur Chemicals) / 4% sucrose (Wacopur Chemicals) / PBS and incubated for 20 minutes to fix the cells. After removing the fixative and washing the cells three times with PBS, 0.25% Triton X-100 (Wacopur Chemicals) / PBS was added, and the cells were permeabilized for 15 minutes. After removing the solution, the coverslips were transferred to 2% BSA (Sigma) / 0.25% Triton X-100 / Opti-MEM (Gibco) and blocked for one hour, then allowed to react with anti-GFP antibody (Nacalai Tesque) for 1.5 hours. After removing the first antibody solution and washing three times with PBS, the second antibody was allowed to react for one hour. After removing the second antibody solution and washing three times with PBS, Prolong Gold anti-fluorescence attenuation mounting medium (antifade reagent) (Molecular Probes) was added for mounting, and the slides were observed using an LSM800 (ZEISS). The above experiments were performed three times, and for each experiment, neurons were extracted from two coverslips and analyzed using image analysis software. (Bitplane) counts the spikes on each dendrite and calculates the number of spikes per 10 μm for each neuron.

[0250] Antibody A increased the number of spinous processes in hippocampal neurons. Figure 9 This result shows that antibody A has the activity to stabilize the spinous processes of hippocampal neurons.

[0251] Reference Example 11: The effect of anti-EphA4 monoclonal antibody on inhibiting tau phosphorylation in vivo.

[0252] The effect of tau transgenic mice (rTg4510) on inhibiting tau phosphorylation in vivo was evaluated using the following steps. Tau transgenic mice (rTg4510) were subcutaneously administered antibody A or a control antibody twice weekly from 20 to 26 weeks of age. The control antibody was prepared by conventional methods using dinitrophenol (mouse anti-dinitrophenol antibody) at a dose of 100 mg / kg (10 mL / kg) each time. Three and a half days after the last administration, anesthesia was performed using a mixture of 2% isoflurane (Intervet) and three types of anesthetic drugs (4.0 mg / kg midazolam (Astellas Pharma), 0.3 mg / kg metoprimidine (Zenya Pharma), and 5.0 mg / kg Vetorphale (Meiji Seika Pharma)). Anesthesia was performed using a mixture containing 3 units / mL heparin (Ajinomoto) and 1% phosphatase inhibitor (Nacalai). Under anesthesia, brain hemispheres were perfused with PBS (Wacopure Chemicals) from Tesque Corporation and removed. Collected brain hemispheres were fixed at 4°C and incubated overnight with shaking in 2% paraformaldehyde (TAAB) / 0.1M phosphate buffer (Wacopure Chemicals). Brain hemispheres were then replaced with 20% sucrose (Wacopure Chemicals) / 0.1M phosphate buffer (Wacopure Chemicals) and subsequently 25% sucrose / 0.1M phosphate buffer (Wacopure Chemicals), and then embedded in tissue-TekO.CT compound (Sakura Finetek Japan) / 25% sucrose and frozen with liquid nitrogen. Sections were produced at a thickness of 7 μm using a CM1860 cryostat (Leica) and adhered to slides (Muto Pure Chemicals). The slides were dried in cold air and then placed in a sealed bag and stored at -80°C. The slides used for immunostaining were thawed, dried in cold air, washed with PBS (Wacopure Chemicals), and then immersed in a 1% BSA (Sigma-Aldrich) / 10% normal donkey serum (Jackson Immunological Research Laboratory) / 0.5% Triton X-100 (Wacopure Chemicals) / PBS solution for one hour of blocking. Afterward, the antiphosphorylated tau antibody AT8 (Fujirebio Europe NV) was allowed to react overnight at room temperature. After washing three times with PBS, the secondary antibody was allowed to react for one hour. After washing three times with PBS, Prolong Gold anti-fluorescence attenuation mounting medium (Molecular Probes) was placed on the slide and mounted, and observed using an LSM700 (ZEISS).The area of ​​the AT8 positive signal in the CA1 radiation layer of the hippocampus was measured using the image analysis software ImageJ, and the proportion of the AT8 positive signal area to the total area was calculated.

[0253] Antibody A reduced the signal of phosphorylated tau in the CA1 region of the hippocampus. Figure 10 This result shows that antibody A has the activity to inhibit the progression of tau pathology in tau transgenic mice (rTg4510).

[0254] Reference Example 12: X-ray crystallography analysis of the EphA4 ligand-binding domain (EphA4-LBD) Epitope plotting

[0255] Antibody A-Fab was prepared according to the following steps. 101.1 mg of antibody A was dissolved in 0.1 M sodium phosphate buffer (pH 7.0), which contained 30 mM L-cysteine ​​and 2 mM EDTA at a concentration of 15 mg / mL. Papain (Sigma-Aldrich) was added to this antibody solution at a volume of 1 / 200, and the mixture was enzymatically digested at 37°C for 18 hours. The antibody A digest was dialyzed against PBS, and the precipitate was removed by centrifugation (the resulting precipitate was redissolved in PBS and mixed with the centrifugation supernatant). Then, to remove impurities other than antibody A-Fab, the following steps were performed.

[0256] 1) Purification via Protein A column

[0257] The enzyme digestion solution was applied to 2 mL of ProSep vA high-volume (Millibert) equilibrated with PBS, and the fraction was recovered by fractionation and PBS washing fraction.

[0258] 2) Affinity purification using anti-human IgG Fcγ antibody

[0259] According to this agarose manual, an affinity column containing an anti-human IgG Fcγ antibody (Jackson Immunology Research Laboratory) covalently bound to NHS-activated Sepharose 4FF (GE Healthcare) was prepared. The solution recovered in step 1) above was charged into this affinity column, and the column was then recovered via a solution and a PBS wash solution.

[0260] 3) Gel filtration purification

[0261] The fraction obtained in step 2) above was concentrated using an ultrafiltration membrane. Superose 12 (GE Healthcare) was equilibrated with PBS, and the concentrated sample was applied for separation and purification. A portion of the separated and purified fractions was analyzed by SDS-PAGE, and the fraction containing high-purity antibody A-Fab was recovered and combined. The sample purified in this manner was designated as antibody A-Fab.

[0262] To prepare a complex of antibody A-Fab and antigen EphA4-LBD, EphA4-LBD was prepared (Qin H. et al., J. Biol. Chem., 283:29473-29484 (2008)). 0.68 μmol of EphA4-LBD (200 μM, 3.4 mL) and 0.45 μmol of antibody A-Fab (300 μM, 1.5 mL) were mixed to achieve a molar ratio of EphA4-LBD to antibody A-Fab of approximately 1.5. The mixed solution was then applied to a HILOAD 26 / 60 Superdex 75 preparative grade (GE Healthcare) and eluted with chromatographic buffer (25 mM Tris / HCl (pH 7.5), 100 mM NaCl). The fraction containing the complex was analyzed by SDS-PAGE, and fractions with high purity were collected and concentrated to approximately 40.8 mg / mL for crystallization.

[0263] Crystallization of the composite was carried out using a seated drop vapor diffusion method with an automated crystallization system, Hydra II Plus OneSystem (Matrix Technologies Corp., Ltd.). MRC-2 (molecular size) was used as the plate. The reservoir composition consisted of 100 mM HEPES (pH 7.5), 10% polyethylene glycol 8000, and 8% ethylene glycol. This reservoir was mixed with the composite solution at a volume ratio of 1:1 to generate crystallization droplets. The resulting crystallized plate was allowed to stand at 20°C.

[0264] After crystallization under the above conditions, a crystal with space group P212121 was obtained, and the lattice constant was... and The obtained crystal was subjected to X-ray radiation. Incident, obtained Diffraction data were obtained. The diffraction data were processed using HKL2000 (HKL Research Inc.), and phase determination was performed using a molecular substitution method. The program PHASER (version 2.5.0, McCoy A.J. et al., J. Appl. Cryst. 40:658-674 (2007)) included in the CCP4 software suite (Collaborative computational project number 4, [CCP4] version 6.5.0, Acta Cryst. D 67:235-242 (2011)) was used for the molecular substitution method. The crystal structure of EphA4-LBD (PDBID: 3CKH) and the crystal structure of the Fab region of IgG (PDBID: 2VXT (L chain) and 1FGN (H chain)) were used as search models for the molecular substitution method. Molecular models were constructed using the COOT program (Emsley P. et al., Acta Cryst. D 60:2126-2132n (2004)) to fit the electron densities obtained from the measured phases, and the structures were refined using the REFMAC program (Murshudov GN, Acta Cryst. D 53:240-255 (1997)).

[0265] Through structural calculations (R = 0.212, Rfree = 0.258), the following results were obtained: Crystal structure of the resolution complex.

[0266] The crystal structure of the obtained antibody A-Fab / EphA4-LBD complex was analyzed using the interaction detection tool provided in the computational chemistry system MOE 2018.0101 (Chemical Computing Group Inc.), and the amino acid residues on EphA4-LBD that are in direct contact with antibody A-Fab were identified. Figure 11A The identified amino acid residues were Glu51, Gly52, Ile59, Gln71, Cys73, Asn74, Val75, Met76, Glu77, Thr104, Arg106, Leu111, Pro112, Met115, Arg162, Met164, Cys191, Ala193, and Val195. Figure 11BThe surface structure of EphA4-LBD generated using Maestro (version 11.0, Schrodinger, LLC) is shown. As a result, the inventors of this invention conclude that the regions where these amino acid residues are located are antibody A-Fab binding regions in EphA4-LBD.

[0267] Example 1: Preparation of humanized antibody for antibody A

[0268] Preparation of humanized anti-EphA4 antibody

[0269] The variable regions of the humanized antibody were designed. Based on the high homology of the frame region (FR) of antibody A, IGHV3-33*03 (SEQ ID NO.42) and JH6 (SEQ ID NO.43) (for the heavy chain) and IGKV1-17*01 (SEQ ID NO.40) and JK4 (SEQ ID NO.41) (for the light chain) were selected as the FRs of the humanized antibody. Then, the amino acids that interact with the CDR amino acids in the FR were predicted using a 3D structure prediction model of mouse antibody A. These amino acids were then transplanted together with the CDR of antibody A with the Y32F mutation in the heavy chain CDR1 (SEQ ID NO.44, 27, 28, and 29-31). HK2-42 (SEQ ID NO.45) was designed as the variable region of the humanized antibody heavy chain, and L1-8 (SEQ ID NO.46) was designed as the variable region of the humanized antibody light chain. The amino acid sequences of the transplanted CDRs are shown in Table 2, and the nucleic acid sequences are shown in Table 3.

[0270] The constant region of human IgG2 (SEQ ID NO. 47) was used as the heavy chain constant region. Human Igκ (SEQ ID NO. 48) was used as the light chain constant region. An expression vector (pcDNA 3.4) containing the gene sequence encoding the amino acid sequence of the humanized antibody was transfected into Expi293F cells (Gibberellic A.S. / Thermo Fisher Scientific) using the Expi293 expression system (Gibberellic A.S. / Thermo Fisher Scientific). Specifically, the nucleic acid sequence shown in SEQ ID NO. 55 was used as the heavy chain variable region, the nucleic acid sequence shown in SEQ ID NO. 56 as the light chain variable region, the nucleic acid sequence shown in SEQ ID NO. 57 as the heavy chain constant region, and the nucleic acid sequence shown in SEQ ID NO. 58 as the light chain constant region. The full-length amino acid sequence of the humanized antibody heavy chain (excluding the signal sequence) is shown in SEQ ID NO. 59, and the full-length amino acid sequence of the light chain (excluding the signal sequence) is shown in SEQ ID NO. 60. The nucleic acid sequence encoding the full-length heavy chain of the humanized antibody is shown in SEQ ID NO. 61, and the nucleic acid sequence encoding the full-length light chain is shown in SEQ ID NO. 62. The supernatant was recovered, and the humanized antibody (antibody B) of antibody A was purified using MabSelectSuRe (GE Healthcare).

[0271] [Table 2]

[0272] amino acid sequence of CDR of antibody B

[0273] Heavy chain CDR1 RFGVH (SEQ ID NO.44) Heavy chain CDR2 VIWRGGSTDYNAAFMS(SEQ ID NO.27) Heavy chain CDR3 ESLFGVYYDYGYYSMDY(SEQ ID NO.28) Light chain CDR1 RASQEISGYLS (SEQ ID NO.29) Light chain CDR2 AASTLDS (SEQ ID NO.30) Light chain CDR3 LQYASYPLT (SEQ ID NO.31)

[0274] [Table 3]

[0275] Nucleic acid sequence of CDR of antibody B

[0276]

[0277] Example 2: Affinity of humanized anti-EphA4 monoclonal antibody against human EphA4

[0278] The binding affinity of antibody B against human EphA4 obtained in Example 1 was determined using a Biacore T200 (GE Healthcare) via surface plasmon resonance (SPR) method. First, the anti-His antibody (GE Healthcare, 28-9950-56) was immobilized on a sensor plate CM5. Immobilization was performed using amine coupling with N-hydroxysuccinimide (NHS) and N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), with ethanolamine used for blocking (sensor plate and immobilization reagents were from GE Healthcare). The antibody was diluted to 3.5 μg / mL with immobilization buffer (10 mM sodium acetate, pH 4.5) and immobilized on the sensor plate according to the protocol attached to the Biacore T200. The human EphA4 extracellular domain-SEAP-His10 was diluted with running buffer HBS-EP (GE Healthcare, BR-1001-88), and the solution was fed into a flow cell for 120 seconds for capture (approximately 10 RU). Subsequently, antibody B was serially diluted with HBS-EP to the range of 100, 50, 25, 12.5, 6.3, 3.2, 1.6, and 0 nM, and added to the sensor plate for 120 seconds. The binding reaction curves were observed sequentially at the time of addition (binding period, 120 seconds) and after addition (dissociation period, 600 seconds). After each observation, 4 mmol / L MgCl2 (60 seconds, Wacopur Chemicals) was added to regenerate the sensor plate. The binding reaction curves were fitted and analyzed using a 1:1 binding model using the system's included BIA evaluation software to calculate the affinity for human EphA4 (KD = kd / ka).

[0279] The binding affinity (KD value) of antibody B against human EphA4 is 1.34 x 10⁻⁶. -9 M( Figure 12 This indicates that antibody B exhibits almost identical affinity to antibody A (the pre-humanized antibody).

[0280] Example 3: Enhanced EphA4 cleavage activity of humanized anti-EphA4 monoclonal antibody in hippocampal neurons

[0281] For antibody B obtained in Example 1, the following steps were performed to evaluate EphA4 cleavage enhancement activity using hippocampal neurons.

[0282] Rat hippocampal neurons seeded in 96-well culture dishes (Folken Laboratories) were treated with antibody B (2.0, 6.7, and 20 nM) and γ-selectase inhibitor compound E (50 nM, Enzo Life Sciences). Twenty-four hours later, the cells were washed with PBS (Wacopur Chemicals), and SDS sample buffer (Limri sample buffer (Bio-Rad Laboratories) and 5% 2-mercaptoethanol (Bio-Rad Laboratories)) was added to recover the cells, followed by boiling for 5 minutes. SDS-PAGE was performed on the samples, and Western blotting was performed with anti-EphA4 monoclonal antibody (Annofa Laboratories), quantifying band intensity and calculating the EphA4 C-terminal fragment / full-length EphA4 value.

[0283] Antibody B concentration-dependently enhances the EphA4 cleavage response in hippocampal neurons. Figure 13 )

[0284] Example 4: Inhibitory activity of human EphA4-human ligand binding of humanized anti-EphA4 monoclonal antibody

[0285] For antibody B obtained in Example 1, the inhibitory activity of human EphA4 binding to human ligand was evaluated according to the following steps. Anti-alkaline phosphatase antibody (Thermo Scientific) was plated into the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked at room temperature for one hour with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), human EphA4 extracellular domain-SEAP-His protein (final concentration 10 nM) was seeded into the wells and incubated at room temperature for one hour. After washing three times, the ligand and serially diluted antibody B (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, and 3000 nM) were added to the wells. Note that biotinylated human hepatocyte ligand A5-Fc chimera (R&D Systems, final concentration 0.7 nM) and biotinylated human hepatocyte ligand B3-Fc chimera (R&D Systems, final concentration 2.3 nM) were used as ligands. After incubation at room temperature for one hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma-Aldrich) solution was added to the wells and incubated at room temperature for 2–5 minutes. An equal volume of stop solution (1 N H₂SO₄, Wacopure Chemicals) was added to the wells, and the absorbance was read at 450 nm using a microplate reader (Molecular Devices or PerkinElmer).

[0286] Antibody B concentration-dependently inhibits the binding of human EphA4 to human ligands, and has an IC50 against binding to human hepatin A5 and hepatin B3. 50The values ​​were approximately 4.9 nM and 1.6 nM, respectively. Therefore, antibody B was found to strongly inhibit the binding between human EphA4 and the human ligand, and exhibited almost identical inhibitory activity to antibody A (the unhumanized antibody). Figure 14 ).

[0287] Example 5: Inhibitory activity of humanized anti-EphA4 monoclonal antibody against mouse EphA4-mouse ligand binding

[0288] For antibody B obtained in Example 1, the inhibitory activity of mouse EphA4 binding to the mouse ligand was evaluated according to the following steps. Anti-alkaline phosphatase antibody (Thermo Scientific) was plated into the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.02% Tween 20 / PBS (Thermo Scientific), the mouse EphA4 extracellular domain-SEAP-His protein was added to the wells (final concentration 10 nM), and incubated for one hour at room temperature. After washing three times, the ligand and serially diluted antibody B (0, 0.003, 0.01, 0.03, 0.1, 0.3, 1, 3, 10, 30, 100, 300, 1000, and 3000 nM) were added to the wells. Note that biotinylated mouse hepatocyte ligand A1-Fc chimera (R&D Systems, final concentration 6 nM) and biotinylated mouse hepatocyte ligand B2-Fc chimera (R&D Systems, final concentration 2.5 nM) were used as ligands. After incubation at room temperature for one hour and washing three times, horseradish peroxidase-labeled streptavidin (GE Healthcare) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma-Aldrich) solution was added to the wells and incubated at room temperature for 2 minutes. An equal volume of stop solution (1 N H2SO4, Wacopure Chemicals) was added to the wells, and the absorbance was read at 450 nm using a microplate reader (Molecular Devices or PerkinElmer).

[0289] Antibody B concentration-dependently inhibited the binding of mouse EphA4 to mouse ligands, and its IC50 against binding to mouse hepatin A1 and hepatin B2 was [not specified]. 50 The values ​​were approximately 8.7 nM and 4.2 nM, respectively. Therefore, antibody B was found to strongly inhibit the binding between mouse EphA4 and its ligand, and exhibited almost identical inhibitory activity to antibody A (the unhumanized antibody). Figure 15 ).

[0290] Example 6: Selectivity of humanized anti-EphA4 monoclonal antibody against human Eph receptor

[0291] Similar to the method described in Reference Example 1 for preparing the mouse EphA4 extracellular region-SEAP-His protein, total RNA derived from tissues was used to amplify the signal sequence and extracellular region DNA sequence encoding each human Eph receptor (EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) by RT-PCR, and cloned into the pENTR1A vector (Ingenieur / Life Technologies) containing the DNA sequence encoding the SEAP protein and histidine tag. Then, the DNA sequence encoding the signal sequence and extracellular region of each person's Eph receptor, the SEAP protein, and the histidine tag were transferred into the pcDNA3.1_rfcB vector via the Gateway system (Engineer / Life Technologies) to construct a vector (referred to as the "Eph receptor extracellular region-SEAP-His protein expression vector") that expresses a protein fused with the extracellular region of each person's Eph receptor and a His tag.

[0292] Then, each of the individual Eph receptor extracellular domain-SEAP-His protein expression vectors was introduced into Expi293F cells (Gibberellic A.S. / Thermo Fisher Scientific) using the Expi293 expression system (Gibberellic A.S. / Thermo Fisher Scientific). After incubation (5% CO2, 37°C) for five days, the culture supernatant was recovered and centrifuged at 1500 rpm for 5 minutes at room temperature. The supernatant was filtered through a 0.45 μm filter (Millibert).

[0293] For antibody B obtained in Example 1, the binding activity of the human Eph receptor was evaluated according to the following steps.

[0294] Rabbit anti-6-His antibody (Beth Laboratories) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), each of the human Eph receptor extracellular domain-SEAP-His proteins (final concentration 1 nM) was seeded into each well and incubated for one hour at room temperature. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Pharmaceuticals) and antibody B (10 μg / mL) were added to the wells and incubated for one hour at room temperature. Horseradish peroxidase-labeled donkey anti-human IgG antibody (Jackson Immunological Research Laboratory) was added and incubated for one hour at room temperature. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0295] Antibody B was found to be similar to antibody A (the pre-humanized antibody) and specifically binds to human EphA4 within the human Eph receptor family. Figure 16 ).

[0296] Example 7: Selectivity of humanized anti-EphA4 monoclonal antibody against mouse Eph receptor

[0297] Following the method for preparing the EphA4 extracellular region-Fc-His protein according to Reference Example 1, total RNA derived from tissues was used to amplify the signal sequence and extracellular region DNA sequence encoding each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) by RT-PCR, and cloned into the pENTR1A vector (Ingenieur / Life Technologies) containing the Fc region encoding human IgG1 and a histidine tag. Then, the signal sequences and DNA sequences encoding the extracellular region, Fc, and histidine tags of each mouse Eph receptor (EphA1, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA10, EphB1, EphB2, EphB3, EphB4, and EphB6) were transferred into the pcDNA 3.1_rfcB vector via LR reaction using the Gateway system (Ingenieur / LifeSciences) to construct each of the mouse Eph receptor extracellular region-Fc-His protein expression vectors. In the construction of the mouse EphA2 extracellular region-Fc-His protein expression vector, the signal sequence and extracellular region DNA sequence encoding mouse EphA2 were amplified by RT-PCR using total RNA derived from tissues, and cloned into the pcDNA 3.1 vector containing the DNA sequence encoding the Fc and histidine tags to construct the mouse EphA2 extracellular region-Fc-His protein expression vector.

[0298] Then, each of the mouse Eph receptor extracellular domain-Fc-His protein expression vectors was introduced into Expi293F cells (Gibberellic A.S. / Thermo Fisher Scientific) using the Expi293 expression system (Gibberellic A.S. / Thermo Fisher Scientific). After culturing (5% CO2, 37°C, 120 rpm) for 5 days, the culture supernatant was recovered and centrifuged at 1500 rpm for 5 minutes at room temperature. The supernatant was filtered through a 0.45 μm filter (Millibert).

[0299] For antibody B, assess the binding activity of mouse Eph receptors according to the following steps.

[0300] Rabbit anti-6-His antibody (Beth Labs) was spread onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), each of the mouse Eph receptor extracellular domain-Fc-His proteins (final concentration 1 nM) was seeded into each well and incubated for one hour at room temperature. After washing three times, human IgG solution (100 μg / mL, Sigma) and antibody B (10 μg / mL) were added to the wells and incubated for one hour at room temperature. Horseradish peroxidase-labeled goat anti-human κ light chain antibody (IBL) was added and incubated for one hour at room temperature. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal amount of stop solution (1N H2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0301] Within the mouse Eph receptor family, antibody B exhibits specific binding activity only against mouse EphA4. Figure 17 ).

[0302] Example 8: Reactivity of humanized anti-EphA4 monoclonal antibody against mouse, rat, monkey, and human EphA4

[0303] For antibody B, assess its binding activity with various EphA4s according to the following steps.

[0304] Anti-alkaline phosphatase antibody (Thermo Scientific) was spread into the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked with 1% blocking ACE (DS Pharmaceuticals) at room temperature for one hour. After washing three times with 0.05% Tween 20 / PBS (Thermo Scientific), mouse, rat, monkey, and human EphA4 extracellular domain-SEAP-His protein (final concentration 1 nM) was seeded into the wells and incubated at room temperature for one hour. After washing three times, human IgG solution (100 μg / mL, Mitsubishi Pharmaceuticals) and antibody B (0, 0.00013, 0.00064, 0.0032, 0.016, 0.08, 0.4, 2, and 10 μg / mL) were added to the wells and incubated at room temperature for one hour. Horseradish peroxidase-labeled donkey anti-human IgG antibody (Jackson Immunological Research Laboratory) was added and incubated at room temperature for one hour. After washing three times, TMBZ (3,3',5,5'-tetramethylbenzidine, Sigma) solution was added to the wells. After confirming adequate staining, an equal volume of stop solution (1NH2SO4, Wacopure Chemicals) was added to the wells, and the absorbance at 450 nm was read using a microplate reader (PerkinElmer).

[0305] Antibody B exhibited equivalent binding activity in all mouse, rat, monkey, and human EphA4 antibodies. Figure 18 ).

[0306] Example 9: Humanized anti-EphA4 monoclonal antibody targeting the extracellular region, ligand-binding domain, and fibronectin of human EphA4. Reactivity of leukin type III domain 1 and fibronectin type III domain 2

[0307] For antibody B obtained in Example 1, the following steps were performed to evaluate its binding activity with various domains in human EphA4.

[0308] Rabbit anti-6-His antibody (Beth Labs) was plated onto the wells of a 96-well plate (Nunc). After incubation overnight at 4°C, the wells were blocked for one hour at room temperature with 1% blocking ACE (DS Pharmaceuticals). After washing twice with 0.02% Tween 20 / PBS (Nacalai Tesque), human EphA4 extracellular domain-MBP-His protein, human EphA4 ligand-binding domain-MBP-His protein, human EphA4 fibronectin type III domain 1-MBP-His protein, and human EphA4 fibronectin type III domain 2-MBP-His protein (final concentration 10 nM) were seeded into the wells and incubated for one hour at room temperature. After washing three times, antibody B (final concentration 10 nM) was added to the wells and incubated for one hour at room temperature. Horseradish peroxidase-labeled rabbit anti-human IgG Fcγ fragment antibody (Jackson Immunological Research Laboratory) was added and incubated for one hour at room temperature. After washing five times, TMB (KPL) solution was added to the wells, and after confirming adequate staining, an equal volume of stop solution (2NH2SO4, Wacopure Chemicals) was added to the wells. The absorbance at 450 nm and 650 nm was read using a microplate reader (PerkinElmer).

[0309] Antibody B exhibits binding activity to the extracellular domain (ECD) and ligand-binding domain (LBD) of human EphA4. Figure 19 It showed no response to fibronectin type III domain 1 (FN1) and fibronectin type III domain 2 (FN2). Therefore, antibody B was found to specifically bind to the ligand-binding domain of the extracellular region of human EphA4.

[0310] Example 10: Effect of humanized anti-EphA4 monoclonal antibody on increasing the number of spinous processes in hippocampal neurons

[0311] Rat hippocampal neurons were prepared as described in Reference Example 1(B). The EGFP gene was introduced into rat hippocampal neurons using nuclear transfection (Lonza Group) and seeded into 24-well plates (Folken Company) containing poly-L-lysine-coated coverslips (Matsunami Glass Industry).

[0312] Spiral counting of rat hippocampal neurons was performed following these steps. Day 13 rat hippocampal neurons inoculated with EGFP were seeded in 24-well plates (Folken Industries, Inc.) (with coverslips coated with poly-L-lysine (Matsunami Glass Industries, Ltd.)) and treated for 24 hours with either a control antibody (human IgG2; Sigma-Aldrich) or antibody B (6.7 and 20 nM). The coverslips were then transferred to 2% PFA (Wacopur Chemicals, Inc.) / 4% sucrose (Wacopur Chemicals, Inc.) / PBS and incubated for 20 minutes to fix the cells. After removing the fixative and washing the cells three times with PBS, 0.25% Triton X-100 (Wacopur Chemicals, Inc.) / PBS was added, and the cells were permeabilized for 15 minutes. After removing the first antibody solution, the coverslips were transferred to 2% BSA (Sigma) / 0.25% Triton X-100 / OPTI-MEM (Gibco) and blocked for one hour, then allowed to react with the anti-GFP antibody (Nacalai Tesque) for 1.5 hours. After removing the first antibody solution and washing three times with PBS, the second antibody was allowed to react for one hour. After removing the second antibody solution and washing three times with PBS, Prolong Gold anti-fluorescence attenuation mounting medium (Molecular Probes) was added for mounting, and observation was performed using an LSM800 (Zeiss). The above experiments were performed three times, and for each experiment, neurons were extracted from two coverslips and analyzed using image analysis software. (Bitplane) counts the spikes on each dendrite and calculates the number of spikes per 10 μm for each neuron.

[0313] Antibody B increased the number of spinous processes in hippocampal neurons. Figure 20 This result shows that antibody B has the activity to stabilize the spinous processes of hippocampal neurons.

[0314] Example 11: Enhanced human EphA4 cleavage activity of humanized anti-EphA4 monoclonal antibody

[0315] For antibody B obtained in Example 1, the following steps were performed to evaluate its cleavage-enhancing activity against human EphA4.

[0316] Rat hippocampal neurons were prepared as described in Reference Example 1(B). The human EphA4-HA protein expression vector was introduced into rat hippocampal neurons via nuclear transfection (Lonza) and seeded in 96-well culture dishes coated with poly-L-lysine (Folken). The seeded rat hippocampal neurons were treated with antibody B (6.7, 20, and 67 nM) and γ-selectase inhibitor compound E (50 nM, Enzo Life Sciences). After approximately 24 hours, the cells were washed with PBS (Wacopur Chemicals), and SDS sample buffer (Limri sample buffer (Bio-Rad Laboratories) and 5% 2-mercaptoethanol (Bio-Rad Laboratories)) was added to recover the cells, followed by boiling for 5 minutes. SDS-PAGE was performed on the sample, and Western blotting was performed using a rat anti-HA monoclonal antibody (Roche), quantifying band intensity and calculating the EphA4 C-terminal fragment / full-length EphA4 value.

[0317] Antibody B enhances the cleavage of human EphA4 in hippocampal neurons. Figure 21 ).

[0318] Example 12: The effect of humanized anti-EphA4 monoclonal antibody on increasing the number of spikes in hippocampal neurons. The involvement of MMP and ADAM

[0319] Rat hippocampal neurons were prepared as described in Reference Example 1(B). The EGFP gene was introduced into a subset of rat hippocampal neurons using nuclear transfection (Lonza Group) and seeded into 24-well plates (Folken Company) containing poly-L-lysine-coated coverslips (Matsunami Glass Industry).

[0320] Spiral counting of rat hippocampal neurons was performed following these steps. Day 13 rat hippocampal neurons inoculated with EGFP were seeded in 24-well plates (Folken Technologies) (with coverslips coated with poly-L-lysine (Matsunami Glass Industries)) and treated for 24 hours with a control antibody (human IgG2; Sigma) or antibody B (20 nM) and DMSO (Sigma) or MMP and the ADAM inhibitor GM6001 (2.5 μM, MedChemExpress). The coverslips were then transferred to 2% PFA (Waccoolek) / 4% sucrose (Waccoolek) / PBS and incubated for 20 minutes to fix the cells. After removing the fixative and washing the cells three times with PBS, 0.25% Triton X-100 (Waccoolek) / PBS was added, and the cells were permeabilized for 15 minutes. After removing 0.25% Triton X-100 / PBS, the coverslips were transferred to 2% BSA (Sigma) / 0.25% Triton X-100 / OPTI-MEM (Gibco) and blocked for one hour, followed by 1.5 hours of reaction with anti-GFP antibody (Nacalai Tesque). After removing the first antibody solution and washing three times with PBS, the second antibody was allowed to react for one hour. After removing the second antibody solution and washing three times with PBS, Prolong Gold anti-fluorescence attenuation mounting medium (Molecular Probes) was added for mounting, and observation was performed using an LSM800 (Zeiss). The above experiments were performed three times, and for each experiment, neurons were extracted from two coverslips and analyzed using image analysis software. (Bitplane) counts the spikes on each dendrite and calculates the number of spikes per 10 μm for each neuron.

[0321] Simultaneous treatment with GM6001 inhibited the increase in the number of spikes in hippocampal neurons via antibody B. Figure 22 This result shows that antibody B has the activity of stabilizing spinous processes in hippocampal neurons via MMP and ADAM.

[0322] Example 13: The effect of humanized anti-EphA4 monoclonal antibody on inhibiting tau phosphorylation in vivo.

[0323] The effect of tau transgenic mice (rTg4510) on inhibiting tau phosphorylation in vivo was evaluated using the following steps. Tau transgenic mice (rTg4510) were 20 to 26 weeks old and administered antibody B subcutaneously twice weekly at a dose of 100 mg / kg (10 mL / kg). A control group received PBS (Wacopur Chemicals) subcutaneously at 10 mL / kg. Three and a half days after the last administration, mice were anesthetized with a mixture of 2%–2.5% isoflurane inhalation anesthetic (Intervet) and three types of anesthetics (4.0 mg / kg midazolam (Asteras Pharmaceuticals), 0.3 mg / kg metopril (Zenya Kogyo Co., Ltd.), and 5.0 mg / kg Vetorphale (Meiji Seika Pharmaceutical Co., Ltd.) and a mixture containing 3 units / mL heparin (Ajinomoto Co., Ltd.) and 1% phosphatase inhibitor (Nacalai). Mouse brain hemispheres were perfused under anesthesia with PBS (Wacopure Chemicals) from Tesque Pharmaceuticals. The collected brain hemispheres were fixed at 4°C and simultaneously immersed overnight in 2% paraformaldehyde (TAAB) / 0.1M phosphate buffer (Wacopure Chemicals) with shaking. The brain hemispheres were then replaced with 10% sucrose (Wacopure Chemicals) / 0.1M phosphate buffer (Wacopure Chemicals) and subsequently 20% sucrose / 0.1M phosphate buffer (Wacopure Chemicals) and then embedded in tissue-Tek. OCT compound (Sakura Precision Technology, Nippon Co., Ltd.) / 20% sucrose was used to freeze the tissue in an aluminum block cooled with liquid nitrogen. 7 μm thick brain hemisphere sections were produced using a CM1860 cryostat (Leica). The sections were adhered to silane-coated slides (Taketo Pure Chemicals Co., Ltd.), air-dried in cold air, and then placed in sealed bags and stored at -80°C. Slides used for immunostaining were removed from -80°C, air-dried in cold air, washed with PBS (Wacopur Chemicals Co., Ltd.), and then immersed in a 1% BSA (Sigma-Aldrich) / 10% normal donkey serum (Jackson Immunological Research Laboratory) / 0.5% Triton X-100 (Wacopur Chemicals Co., Ltd.) / PBS solution for one hour of blocking, followed by allowing the antiphosphorylated tau antibody AT8 (Fujirebio Europe NV) to react overnight at room temperature. After washing three times with PBS, the secondary antibody was allowed to react for one hour. After washing three times with PBS, Prolong... Gold anti-fluorescence attenuation mounting medium (Molecular Probes) was placed on a glass slide and sealed, and observed using an LSM700 (ZEISS). The area of ​​AT8 positive signal in the CA1 radiation layer of the hippocampus was measured using the image analysis software Metamorph, and the proportion of the AT8 positive signal area to the total area was calculated.

[0324] Antibody B reduced the signal of phosphorylated tau in the CA1 region of the hippocampus. Figure 23This result shows that antibody B has the activity to inhibit the progression of tau pathology in tau transgenic mice (rTg4510).

Claims

1. Use of anti-EphA4 antibody in the manufacture of pharmaceutical compositions for the treatment of Alzheimer's disease, wherein... The anti-EphA4 antibody comprises a heavy chain and a light chain, and includes: (a) Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO. 44; (b) Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 27; (c) Heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO. 28; (d) The light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO. 29; (e) The light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO. 30; and (f) The light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO.

31.

2. The use according to claim 1, wherein the anti-EphA4 antibody is humanized.

3. The use according to claim 1, wherein The variable region of the heavy chain consists of the amino acid sequence shown in SEQ ID NO. 45, and The variable region of the light chain consists of the amino acid sequence shown in SEQ ID NO.

46.

4. The use according to claim 3, wherein The constant regions of the heavy chain and the light chain contain amino acid sequences derived from human antibodies.

5. The use according to claim 4, wherein The constant region of the heavy chain is the constant region of human IgG.

6. The use according to claim 5, wherein The constant region of human IgG is the constant region of human IgG2.

7. The use according to claim 6, wherein The constant region of the human IgG2 contains the amino acid sequence shown in SEQ ID NO.

47.

8. The use according to claim 4, wherein The constant region of the light chain is the constant region of human Igκ.

9. The use according to claim 8, wherein The constant region of the human Igκ contains the amino acid sequence shown in SEQ ID NO.

48.

10. Use of anti-EphA4 antibody in the manufacture of pharmaceutical compositions for the treatment of Alzheimer's disease, wherein... The anti-EphA4 antibody comprises heavy and light chains. The heavy chain consists of the amino acid sequence shown in SEQ ID NO. 59, and The light chain consists of the amino acid sequence shown in SEQ ID NO.

60.

11. The use according to claim 10, wherein The heavy chain is missing a C-terminal lysine residue.

Citation Information

Patent Citations

  • Module-combined multi-purpose gap heat-supply device

    CN2497221Y

  • Flyback converter with a variable frequency discontinuous mode and valley sensing

    US11451154B2

  • Methods for increasing protein titers

    US20100297697A1

  • Human monoclonal antibodies against EPHA4 and their use

    WO2016019280A1

  • Epha4 inhibitors as neuroprotective agents

    CN105473591A