Preparation and application of recombinant lactic acid bacteria immunological preparation of chicken interleukin 2, 17B and 26

Abstract

The application discloses preparation and application of a recombinant lactic acid bacteria immunological preparation of chicken interleukin 2, 17B and 26. The application provides a fusion protein comprising chicken interleukin 2, chicken interleukin 17B and chicken interleukin 26, and provides a recombinant lactic acid bacteria capable of expressing the fusion protein. The fusion protein and the recombinant lactic acid bacteria provided by the application have an immune promotion function, and are of great significance for effectively preventing and controlling viral and bacterial infectious diseases.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the preparation and application of recombinant lactic acid bacteria immunomodulators containing chicken interleukin-2, 17B, and 26. Background Technology

[0002] Intensive livestock and poultry farms are the main source of livestock products on the market. With global population growth, the demand for livestock and poultry products is also increasing year by year.

[0003] Chickens are typically raised in intensive environments conducive to opportunistic pathogen infections. A major problem in poultry farming is declining productivity due to disease, necessitating the use of significant resources to maintain animal health. Vaccines and antibiotics (especially antibiotics) are primarily used to control disease. Traditional inactivated and live attenuated vaccines are insufficiently effective against certain pathogens, including traditional IBV vaccines due to their variability. Therefore, novel vaccines such as DNA vaccines, RNA vaccines, and multi-epitope vaccines have become a hot topic in vaccine research.

[0004] However, traditional adjuvants do not significantly enhance humoral and cellular immunity in these novel vaccines. Currently, the most commonly approved adjuvants for veterinary vaccines are aluminum gel adjuvants and oil emulsion adjuvants. Aluminum hydroxide (Aluminum) adjuvants are widely used in many veterinary and human vaccines due to their safety profile; however, aluminum gel adjuvants are almost incapable of inducing cell-mediated immunity, particularly cytotoxic T-cell responses, which is a significant drawback for their use in vaccines against intracellular parasites and certain viruses. Furthermore, aluminum gel adjuvants tend to induce IgE-mediated immune responses and may promote IgE-mediated allergic reactions. The use of oil emulsion adjuvants is limited by their side effects and adverse reactions; for example, the oil emulsion adjuvant CFA can cause inflammation, ulceration, fever, and allergic reactions at the injection site. The appearance quality of poultry meat is crucial for the poultry industry, and these adverse reactions at the injection site caused by aluminum gel and oil emulsion adjuvants in immunized chickens can affect the appearance quality of the meat, cause animal discomfort, and be detrimental to animal welfare. Therefore, the poultry vaccine industry needs effective adjuvants that meet the requirement of neither causing suffering to poultry nor reducing the quality of poultry meat. Furthermore, the overuse of antibiotics in livestock and poultry farming poses a significant threat to the environment and human survival. Therefore, there is an urgent need to find additives or therapeutic drugs to replace antibiotics in livestock and poultry farming. Cytokines (CKs) are low-molecular-weight soluble proteins synthesized and secreted by immune cells and some non-immune cells. After binding to specific receptors, cytokines can activate gene expression in the cytokine network and regulate immune function. Therefore, cytokines are considered highly effective and safe immunomodulatory molecules with few side effects. Summary of the Invention

[0005] This invention claims protection for the preparation and application of recombinant lactic acid bacteria immunomodulators containing chicken interleukin-2, 17B, and 26.

[0006] Firstly, this invention claims protection for a fusion protein.

[0007] The fusion proteins claimed in this invention include chicken interleukin-2, chicken interleukin-17B, and chicken interleukin-26.

[0008] Further, the fusion protein may be: the protein shown in SEQ ID No. 1, or the protein shown in positions 28-432 of SEQ ID No. 1, or the protein shown in positions 28-438 of SEQ ID No. 1.

[0009] Secondly, the present invention claims protection for nucleic acid molecules encoding the fusion protein described in the first aspect above.

[0010] Furthermore, the nucleic acid molecule may be any of the following: (b1) DNA molecules with coding regions as shown in SEQ ID No. 2 or positions 82-1296 of SEQ ID No. 2 or positions 82-1314 of SEQ ID No. 2; (b2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (b1) and encodes the fusion protein; (b3) A DNA molecule that has at least 99%, 95%, 90%, 85% or 80% homology with the DNA molecule defined in (b1) or (b2) and encodes the fusion protein.

[0011] SEQ ID No. 2 encodes the protein shown in SEQ ID No. 1. The first 27 amino acid residues of SEQ ID No. 1 form the signal peptide SpUsp45, the 28th to 149th amino acid residues form chicken interleukin-2, the 150th to 164th amino acid residues form a flexible linker, the 165th to 336th amino acid residues form chicken interleukin-17B, the 337th to 351st amino acid residues form a flexible linker, the 352nd to 432nd amino acid residues form chicken interleukin-26, and the 433rd to 438th amino acid residues form a 6×His tag.

[0012] Thirdly, the present invention claims protection for any of the following biological materials: (c1) An expression cassette containing the nucleic acid molecules described in the second aspect above; (c2) A recombinant vector containing the nucleic acid molecules described in the second aspect above; (c3) Transgenic cell lines containing the nucleic acid molecules described in the second aspect above; (c4) Recombinant bacteria containing the nucleic acid molecules described in the second aspect above; The fermentation products of the recombinant bacteria described in (c5) and (c4); Total cell protein of the recombinant bacteria described in (c6) and (c4); (c7) The complete protein consists of chicken interleukin-2, chicken interleukin-17B and chicken interleukin-26.

[0013] Furthermore, the recombinant bacteria is a recombinant bacteria capable of expressing the fusion protein described in the first aspect above, and may be a recombinant lactic acid bacteria.

[0014] Furthermore, the recombinant lactic acid bacteria is obtained by introducing the recombinant vector described in (c2) into the recipient lactic acid bacteria, wherein the recipient lactic acid bacteria is *Lactobacillus plantarum*. In a specific embodiment of the present invention, the *Lactobacillus plantarum* is *Lactobacillus plantarum* NC8.

[0015] In a specific embodiment of the present invention, the recombinant vector is a recombinant plasmid (named pMG36e-ChIL2 / 17B / 26) obtained by replacing the small fragments in the SalⅠ and SphⅠ restriction enzyme recognition sequences of the pMG36e vector with the double-stranded DNA molecule shown in SEQ ID No. 2.

[0016] In a specific embodiment of the present invention, the recombinant bacteria is a recombinant Lactobacillus plantarum obtained by introducing the recombinant vector (i.e., the pMG36e-ChIL2 / 17B / 26) into Lactobacillus plantarum NC8.

[0017] Fourthly, the present invention claims protection for the use of the fusion protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above, in any of the following: (d1) Preparation of immune-boosting agents; (d2) as an immune stimulant.

[0018] Fifthly, the present invention claims protection for a complete set of products for the prevention and / or treatment of infectious bronchitis in chickens.

[0019] The complete product for the prevention and / or treatment of infectious bronchitis in chickens claimed in this invention contains an IBV vaccine and an immune booster; the immune booster is the fusion protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above.

[0020] Sixthly, the present invention claims protection for the use of IBV vaccines and immune boosters in the preparation of products. The function of the products is to prevent and / or treat infectious bronchitis in chickens; the immune booster is the fusion protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the biological material described in the third aspect above.

[0021] In the foregoing related aspects, in a specific embodiment of the present invention, the IBV vaccine is an IBV H120 vaccine.

[0022] In the foregoing related aspects, the specific use of the immune stimulant may be to enhance the immune capacity of animals. The animals are poultry, such as chickens. Furthermore, the improvement of animal immunity can specifically manifest itself in at least one of the following ways: M1 enhances the activity of animal immune cells; M2 inhibits the proliferation of infectious bronchitis virus in chickens; M3, improves animal development, growth, and weight gain; M4 promotes humoral immunity, mucosal immunity, and / or cellular immunity; M5 reduces the titer of infectious bronchitis virus (IBV) in target organs of animals.

[0023] In M4, the promotion of humoral immunity is manifested in all or part of the following: promoting the secretion of IBV-specific antibodies in serum; promoting the secretion of chicken-derived cytokines IL-2, IL-4, IL-6 and IFN-γ.

[0024] In M4, the promotion of mucosal immunity is manifested in all or part of the following: promoting the increase of total mucosal antibody sIgA content; promoting the increase of IBV-specific mucosal antibody sIgA level.

[0025] In M4, the promotion of cellular immunity is manifested in all or part of the following: promoting CD4+ in peripheral blood lymphocytes. + T cells and CD8 + Increase the percentage of T cells; increase the expression of immune-related genes (such as IL-22, TLR3, TLR7, TGF-β4 and BCL-6).

[0026] The animal in question may specifically be a bird, such as a chicken.

[0027] The immune cells may be macrophages, such as HD11 cells.

[0028] The fusion protein ChIL2 / 17B / 26 molecule and the fermentation product of recombinant bacteria expressing the ChIL2 / 17B / 26 gene provided by this invention have the following effects: promoting the proliferation of animal lymphocytes; the lymphocyte content in animals treated with NC8-ChIL2 / 17B / 26 can be increased by more than 5%. Figure 10 It significantly inhibits the growth of pathogenic microorganisms; the amount of pathogenic microorganisms reduced by more than 20% after applying NC8-ChIL2 / 17B / 26. Figure 13 It promotes the secretion of specific antibodies (IgG, IgA) and non-specific sIgA. The levels of specific antibodies and disease-specific antibodies in animals treated with NC8-ChIL2 / 17B / 26 can increase by 40%-60%. Figure 7 and Figure 9 ); promotes the expression of immune-related genes, thereby improving the animal's immune resistance to infection, and increasing growth and weight gain by more than 5%. Figure 6 Experiments have shown that the NC8-ChIL2 / 17B / 26 of this invention can promote lymphocyte proliferation, inhibit the growth of pathogenic microorganisms, promote the secretion of specific antibodies, promote the secretion of mucosal antibodies, and improve the immunity and survival rate of animals. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the structure of the recombinant plasmid pMG36e-ChIL2 / 17B / 26.

[0030] Figure 2 To detect the mRNA level of recombinant strain NC8-ChIL2 / 17B / 26.

[0031] Figure 3 Protein level detection for recombinant strain NC8-ChIL2 / 17B / 26.

[0032] Figure 4 To investigate the effect of the fusion protein ChIL2 / 17B / 26 on the activity of chicken macrophages infected with chicken infectious bronchitis virus.

[0033] Figure 5 The results show the effect of the fusion protein ChIL2 / 17B / 26 on the proliferation titer of IBV in HD11 cells.

[0034] Figure 6 Immunomodulatory effects of recombinant strain NC8-ChIL2 / 17B / 26 on chicken infectious bronchitis virus vaccine – changes in weight gain.

[0035] Figure 7 Immunomodulatory effect of recombinant strain NC8-ChIL2 / 17B / 26 against chicken infectious bronchitis virus vaccine – IBV-specific antibody detection (humoral immunity).

[0036] Figure 8 Immunomodulatory effects of recombinant strain NC8-ChIL2 / 17B / 26 on chicken infectious bronchitis virus vaccine: detection of chicken-derived cytokines IL-2 (a), IL-4 (b), IL-6 (c) and IFN-γ (d) (humoral immunity).

[0037] Figure 9 Immunomodulatory effects of recombinant NC8-ChIL2 / 17B / 26 against chicken infectious bronchitis virus vaccine: detection of total sIgA and IBV-specific sIgA (mucosal immunization). (a) Total sIgA in the trachea; (b) Total sIgA in the small intestine; (c) IBV-specific sIgA in the trachea; (d) IBV-specific sIgA in the small intestine.

[0038] Figure 10 Immunomodulatory effects of recombinant NC8-ChIL2 / 17B / 26 against chicken infectious bronchitis virus vaccine—CD4+ in peripheral blood lymphocytes + T cells (a) and CD8 + Changes in T cells (b) (cellular immunity).

[0039] Figure 11 Immunomodulatory effects of recombinant NC8-ChIL2 / 17B / 26 against chicken infectious bronchitis virus vaccine: expression of immune-related genes (cellular immunity). (a) Gene expression in the trachea; (b) Gene expression in the cecal tonsils; (c) Gene expression in the spleen.

[0040] Figure 12 The results of agarose gel electrophoresis of the standard plasmid pUC57-M41 are shown.

[0041] Figure 13 Immunomodulatory effects of recombinant strain NC8-ChIL2 / 17B / 26 against chicken infectious bronchitis virus vaccine: Viral load detection in tracheal lymph nodes (A), kidney (B), lung (C), spleen (D), bursa of Fabricius (E), and liver (F) (challenge protection test). Detailed Implementation

[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0044] The concentrations of ChIL2 / 17B / 26 (protein concentrations) were detected using the His Tag ELISA Detection Kit (Nanjing Genscript Biotech Co., Ltd., Cat. No.: L00436).

[0045] pMG36e vector: Biovector Corporation, catalog number BiovectorpMG36e.

[0046] HD11 cells (chicken macrophages): Shanghai Zeye Biotechnology Co., Ltd.

[0047] DMEM growth medium: DMEM basal medium containing 10% fetal bovine serum with inactivated complement at 56 °C and 0.1% penicillin-streptomycin antibiotics. Maintenance medium: DMEM basal medium containing 2% fetal bovine serum with inactivated complement at 56 °C and 0.1% penicillin-streptomycin antibiotics.

[0048] Lactobacillus plantarum NC8: It is described in the literature “Comparison of the effects of intranasal and oral administration of Lactobacillus plantarum NC8 on chick T lymphocytes; Liu Yuying, Yang Wentao, Zhao Liang, Yang Guilian, Wang Chunfeng; Chinese Journal of Veterinary Medicine 2017 (Vol. 53) No. 1”. It is available to the public from the applicant and can only be used to repeat the experiments of this invention and may not be used for other purposes.

[0049] Infectious Bronchitis Virus in Chickens Beaudette strain (IBV B strain), recorded in the document "InfectiousBronchitis Virus Infection Induces Apoptosis during Replication in ChickenMacrophage HD11 Cells; (IF=3.465)”, which is available to the public from the applicant, may only be used for repeating experiments of the present invention and may not be used for other purposes.

[0050] The Infectious Bronchitis Virus M41 strain (IBV M41 strain), described in the literature "Construction of a reverse genetic strain of Infectious Bronchitis Virus M41 strain; Li Ran, Xu Jigang, Wu Xuan, Ji Gaosheng, Yang Xin, Wang Hongning; Basic Science, Chinese Journal of Animal Husbandry and Veterinary Medicine, 2015, Vol. 31, No. 5", is available to the public from the applicant and may only be used for repeating experiments of this invention and may not be used for other purposes.

[0051] The primer sequences for real-time quantitative PCR used in the following examples are shown in Table 1.

[0052] Table 1. Primer sequences for real-time quantitative PCR

[0053] Example 1: Preparation of recombinant bacteria I. Design of the fusion protein ChIL2 / 17B / 26 and its encoding gene The amino acid sequence of the fusion protein ChIL2 / 17B / 26 is shown in SEQ ID No. 1. In SEQ ID No. 1, amino acid residues 1-27 form the signal peptide SpUsp45, amino acid residues 28-149 form chicken interleukin-2, amino acid residues 150-164 form a flexible linker, amino acid residues 165-336 form chicken interleukin-17B, amino acid residues 337-351 form a flexible linker, amino acid residues 352-432 form chicken interleukin-26, and amino acid residues 433-438 form a 6×His tag.

[0054] The gene encoding the fusion protein ChIL2 / 17B / 26 was named the ChIL2 / 17B / 26 gene.

[0055] The DNA molecule shown in SEQ ID No. 2 encodes the protein shown in SEQ ID No. 1. In SEQ ID No. 2, positions 1-81 encode the signal peptide SpUsp45, positions 82-447 encode chicken interleukin-2, positions 448-492 encode a flexible linker, positions 493-1008 encode chicken interleukin-17B, positions 1009-1053 encode a flexible linker, positions 1054-1296 encode chicken interleukin-26, positions 1297-1314 encode a 6×His tag, and positions 1315-1317 are stop codons.

[0056] II. Construction of Recombinant Plasmids The small fragments in the SalⅠ and SphⅠ restriction enzyme recognition sequences of the pMG36e vector were replaced with the double-stranded DNA molecule shown in SEQ ID No. 2 to obtain the recombinant plasmid pMG36e-ChIL2 / 17B / 26. The recombinant plasmid pMG36e-ChIL2 / 17B / 26 has been verified by sequencing. A schematic diagram of the structure of the recombinant plasmid pMG36e-ChIL2 / 17B / 26 is shown below. Figure 1 .

[0057] III. Preparation of Recombinant Bacteria The recombinant plasmid pMG36e-ChIL2 / 17B / 26 was introduced into Lactobacillus plantarum NC8 to obtain recombinant Lactobacillus plantarum, which was named recombinant strain NC8-ChIL2 / 17B / 26.

[0058] The pMG36e vector was introduced into Lactobacillus plantarum NC8 to obtain recombinant Lactobacillus plantarum, which was named recombinant strain NC8-P.

[0059] Meanwhile, Lactobacillus plantarum expressing single-cytokine genes was set up as a control, named recombinant bacteria NC8-ChIL2, NC8-ChIL17B and NC8-ChIL26.

[0060] The recombinant strain NC8-ChIL2 is a recombinant Lactobacillus plantarum obtained by introducing the recombinant plasmid pMG36e-ChIL2 into Lactobacillus plantarum NC8. The recombinant plasmid pMG36e-ChIL2 is obtained by replacing the small fragments in the SalⅠ and SphⅠ restriction enzyme recognition sequences of the pMG36e vector with the double-stranded DNA molecule shown in SEQ ID No. 3.

[0061] The recombinant strain NC8-ChIL17B is a recombinant Lactobacillus plantarum obtained by introducing the recombinant plasmid pMG36e-ChIL17B into Lactobacillus plantarum NC8. The recombinant plasmid pMG36e-ChIL17B is obtained by replacing the small fragments in the SalⅠ and SphⅠ restriction enzyme recognition sequences of the pMG36e vector with the double-stranded DNA molecule shown in SEQ ID No. 4.

[0062] The recombinant strain NC8-ChIL26 is a recombinant Lactobacillus plantarum obtained by introducing the recombinant plasmid pMG36e-ChIL26 into Lactobacillus plantarum NC8. The recombinant plasmid pMG36e-ChIL26 is obtained by replacing the small fragments in the SalⅠ and SphⅠ restriction enzyme recognition sequences of the pMG36e vector with the double-stranded DNA molecule shown in SEQ ID No. 5.

[0063] IV. mRNA Level Detection 1. Pick a single colony of the test bacteria (recombinant bacteria NC8-ChIL2 / 17B / 26 or NC8-P or Lactobacillus plantarum NC8) and inoculate it into 1 mL of liquid MRS medium containing 10 μg / mL erythromycin. Incubate at 37 °C overnight. Then, inoculate 1% of the culture into liquid MRS medium containing 10 μg / mL erythromycin and incubate for 12 h-16 h. Centrifuge at 4 °C and 4000 g for 10 min and collect the bacterial pellet.

[0064] 2. mRNA level detection The bacterial cells obtained in step 1 were used to extract RNA, which was then reverse transcribed to obtain cDNA. Using the cDNA as a template, PCR amplification was performed using a primer pair consisting of Pe-F and Pe-R, followed by agarose gel electrophoresis. See the electrophoresis diagram below. Figure 2 Lane M represents the DL2000 DNA Marker, lane 1 represents *Lactobacillus plantarum* NC8, lane 2 represents recombinant strain NC8-P, and lane 3 represents recombinant strain NC8-ChIL2 / 17B / 26. Only lane 3 shows a specific amplified band of approximately 1300 bp. Lanes 4, 5, and 6 represent recombinant strains NC8-ChIL2, NC8-ChIL17B, and NC8-ChIL26, respectively, and specifically amplified bands of 468 bp, 618 bp, and 345 bp, respectively.

[0065] Pe-F: ATGAAAAAAAAGATTATCTCAGC (Tm: 53℃); Pe-F: TTAGTGGTGGTGGTGGTGG (Tm: 56°C).

[0066] V. Protein Level Detection 1. Inoculate the activated test bacteria (recombinant bacteria NC8-Ch2 / IL17B / 26, NC8-ChIL2, NC8-ChIL17B, NC8-ChIL26, or NC8-P) at a volume ratio of 1:100 into liquid MRS medium containing 10 μg / mL erythromycin. Incubate at 37 ℃ and 180 rpm for 24 h with shaking. Then centrifuge at 10000 g for 5 min and collect the bacterial cells. Next, treat with lysozyme (working concentration of lysozyme: 1 mg / mL). Then sonicate and centrifuge to collect the supernatant, which is the total protein solution. The total protein solution obtained from recombinant bacteria NC8-ChIL2 / 17B / 26 is named NC8-ChIL2 / 17B / 26 protein solution (protein content is based on total protein). The total protein solution obtained from recombinant bacteria NC8-ChIL2 is named NC8-ChIL2 protein solution (protein content is based on total protein). The total protein solution obtained from recombinant strain NC8-ChIL17B is named NC8-ChIL17B protein solution (protein content is based on total protein). The total protein solution obtained from recombinant strain NC8-ChIL26 is named NC8-ChIL26 protein solution (protein content is based on total protein). The total protein solution obtained from recombinant strain NC8-P is named NC8-P protein solution (protein content is based on total protein).

[0067] 2. Take the total protein solution obtained in step 1, perform polyacrylamide gel electrophoresis, and then perform Western blotting (using His-tag mouse IgG monoclonal antibody as the primary antibody). The results are shown in [Figure 1]. Figure 3 Lane M represents the standard protein marker, lane C represents the empty vector control NC8-P, and lane G1 represents NC8-ChIL2 / 17B / 26. Electrophoresis results for lane G1 showed a positive protein band of approximately 48.23 kDa, consistent with the predicted size of the fusion protein ChIL2 / 17B / 26. The NC8-P protein solution did not show the predicted positive protein band. Lanes G5, G6, and G7 represent the recombinant bacteria NC8-ChIL2, NC8-ChIL17B, and NC8-ChIL26, respectively, and specifically detected positive protein bands of 20 kDa, 14 kDa, and 10 kDa, respectively, all consistent with the predicted protein sizes.

[0068] Example 2: Effect of fusion protein ChIL2 / 17B / 26 on the proliferation of chicken infectious bronchitis virus I. Effects of the fusion protein ChIL2 / 17B / 26 on the activity of chicken macrophage cell lines infected with chicken infectious bronchitis virus 1. After dispersing the HD11 cells that have confluently grown in T75 flasks with trypsin, seed them evenly into 96-well plates, approximately 1.0 × 10⁶ cells per well. 6Cells were cultured in DMEM growth medium until they reached 70%-80% confluence.

[0069] 2. After completing step 1, wash the cells twice with PBS buffer, then add IBV B strain (MOI=2) and continue culturing in DMEM growth medium for 1.5 h. Then add the NC8-ChIL2 / 17B / 26 protein solution or NC8-P protein solution or dilutions of NC8-ChIL2, NC8-ChIL17B, and NC8-ChIL26 protein solutions prepared in Example 1 and continue culturing for 24 h (the protein concentrations in the system are 200 ng / ml, 100 ng / ml, or 50 ng / ml, based on the total protein provided by the protein dilutions). A control group of IBV B strain was set up using an equal volume of PBS buffer instead of the protein dilutions.

[0070] 3. After completing step 2, add 20 μL of CCK-8 solution to each well and continue culturing for 0.5-4 hours. Set up blank control wells with only CCK8 and no cells.

[0071] 4. After completing step 4, measure the absorbance at 450 nm using a microplate reader. Based on OD... 450 The percentage of cell inhibition in each well was calculated; a lower ratio indicates better cell viability. Cell viability inhibition percentage (%) = (PBS control group OD) 450 -Experimental group OD 450 ) / (PBS control group OD 450 - Blank group OD 450 )×100.

[0072] Each process should have at least 3 duplicate holes.

[0073] See results Figure 4 In the figure, the mean value plus SD of each group is used; ** indicates p < 0.05; *** indicates p < 0.01; **** indicates p < 0.005; ns indicates no significant difference. The total protein concentration in the system was 200 ng / ml. Compared with the IBV group, the inhibition rate of NC8-ChIL2 / 17B / 26 cell viability was significantly reduced, and the cell viability was significantly promoted. p<0.01 As protein concentration decreased, the cell viability inhibition rate of the NC8-ChIL2 / 17B / 26 group increased, indicating that the inhibitory effect of the fusion protein ChIL2 / 17B / 26 on IBV is dose-dependent.

[0074] II. Effects of the fusion protein ChIL2 / 17B / 26 on the proliferation titer of IBV in HD11 cells 1. After dispersing the HD11 cells that have confluently grown in T75 flasks with trypsin, seed them evenly into 6-well plates, approximately 1.0 × 10⁶ cells per well. 6 Cells were cultured in DMEM growth medium until they reached 70%-80% confluence.

[0075] 2. After completing step 1, wash the cells twice with PBS buffer, then add IBV B strain (MOI=2) and continue culturing in DMEM growth medium for 1.5 h. Then add dilutions of the NC8-ChIL2 / 17B / 26, NC8-ChIL2, NC8-ChIL17B, NC8-ChIL26, or NC8-P protein solutions prepared in Example 1 and continue culturing for 24 h (the protein concentration in the system is 200 ng / ml, based on the total protein provided by the protein dilutions). A control group using an equal volume of PBS buffer instead of IBV B strain was set up.

[0076] Each process should have at least 3 duplicate holes.

[0077] 3. After completing step 2, repeatedly freeze and thaw the cells at -80℃ twice, collect the frozen and thawed cells and supernatant, which is the virus solution to be tested, and determine TCID. 50 Poisonous price.

[0078] The specific method for determining the viral titer was as follows: Virus solutions were serially diluted 10-fold and inoculated into 96-well plates containing approximately 70% confluent HD 11 cells, with six replicates per dilution. The plates were incubated at 37°C, and the number of diseased wells was recorded daily. After 72 hours of incubation, the final number of diseased wells was determined, and the TCID was measured using the Reed-Muench method. 50 After repeated measurements three times, statistical analysis was performed using one-way ANOVA multiple comparisons.

[0079] See results Figure 5 The graph shows the average value plus SD for each group; different lowercase letters indicate significant differences. P< 0.05 The same lowercase letter indicates that the difference is not significant. P>0.05 IgTCID in the PBS control group 50 The value was 0; compared with the IBV control group, all other experimental groups significantly inhibited IBV proliferation in HD11 cells. P<0.05 The inhibitory effect on IBV proliferation was not significantly different between the NC8-ChIL2 / 17B / 26 group and the NC8-ChIL2 and NC8-ChIL17B groups. P>0.05 ).

[0080] Example 3: Immunomodulatory effect of recombinant strain NC8-ChIL2 / 17B / 26 on chicken infectious bronchitis virus vaccine I. Preparation of NC8-ChIL2 / 17B / 26 bacterial culture The activated recombinant bacteria NC8-ChIL2 / 17B / 26 were inoculated into 50 ml of liquid MRS medium and incubated statically at 37 ℃ for 24 h. The cells were then collected by centrifugation at 4000 g for 10 min. The cells were washed twice with cold sterile PBS buffer and then resuspended in cold sterile PBS buffer to a concentration of 5 × 10⁻⁶. 9 CFU / mL was used to obtain NC8-ChIL2 / 17B / 26 bacterial culture, which was stored on ice for later use. The other single-gene recombinant lactic acid bacteria (NC8-ChIL2, NC8-ChIL17B and NC8-ChIL26) were prepared in the same way.

[0081] II. Preparation of NC8-P bacterial culture The activated recombinant bacteria NC8-P were inoculated into 50 ml of liquid MRS medium and incubated at 37 ℃ for 24 h. The cells were then collected by centrifugation at 4000 g for 10 min. The cells were washed twice with cold sterile PBS buffer and then resuspended in cold sterile PBS buffer to a concentration of 5 × 10⁻⁶. 9 The concentration of CFU / mL was used to obtain NC8-P bacterial culture, which was then stored on ice for later use.

[0082] III. SPF Chicken Grouping and Immunization SPF chicks were obtained from SPF White Leghorn chicken embryos purchased from Beijing Boehringer Ingelheim Viton Biotechnology Co., Ltd. The SPF chicks were transferred to SPF isolators for feeding and immunization. The IBV vaccine, officially IBV H120 vaccine (IBVH120 oral attenuated live vaccine, lyophilized formulation), was manufactured by Sichuan Huapai Biotechnology Group Co., Ltd. Usage: Dilute with sterile PBS buffer to 10... 8 EID 50 / mL, prepare fresh and use immediately, store on ice, and the single dose per chicken is 200μL.

[0083] The test bacterial suspensions were either NC8-ChIL2 / 17B / 26, NC8-ChIL2, NC8-ChIL17B and NC8-ChIL26 bacterial suspensions prepared in step one or NC8-P bacterial suspensions prepared in step two.

[0084] Immunization schedule: At 7 days of age, administer the test bacterial solution and IBV H120 vaccine orally; at 14 days of age, administer the test bacterial solution orally; at 21 days of age, administer the test bacterial solution and IBV H120 vaccine orally; at 28 days of age, administer the test bacterial solution orally; at 34 days of age, administer the test bacterial solution orally.

[0085] The grouping is shown in Table 2. Each group consists of 10 SPF chicks, and male and female chicks are randomly assigned to the four groups equally.

[0086] Table 2. SPF Chicken Grouping

[0087] The evaluation should be conducted according to the indicators in Table 3.

[0088] Table 3. Evaluation Indicators for Immunostimulation Effect

[0089] IV. Evaluation Results of Each Indicator 1. Weight gain changes Net weight gain was calculated based on the chicks' weight on day 0 (weight before the first vaccination) and their weight on day 28 after the first vaccination. Results are shown below. Figure 6 In the figure, the average value of each group is shown as the average value plus the standard deviation (SD); different lowercase letters indicate significant differences. P<0.05 The same lowercase letter indicates that the difference is not significant. P>0.05 At 28 days after the first vaccination, chicks in the NC8-ChIL17B+IBV group gained more body weight than chicks in the NC8-P+IBV group. P<0.05 On day 0, there was no significant difference in the weight of chicks among the groups. P>0.05 This indicates that the growth status of chicks in each experimental group was similar, meeting the experimental requirements; after 28 days of oral administration, the final weight and net weight gain of the NC8-ChIL2 / 17B / 26 group were significantly higher than those of the other experimental groups. P<0.05 This indicates that the recombinant lactic acid bacteria NC8-ChIL2 / 17B / 26 has a significant promoting effect on the growth performance of chicks.

[0090] 2. Humoral immune indicators Blood was collected via the subwing vein on day 0 (before the first immunization) and on days 7, 14, 21 and 28 after the first immunization. The serum was collected after standing at 37 °C for 1 hour, then placed at 4 °C overnight, centrifuged and stored at -20 °C.

[0091] The IBV-specific antibody ELISA kit (IDEXX, catalog number 99-09262) was used for detection. Results are shown below. Figure 7 The results were statistically analyzed as the mean S / P value plus SD for each group. The threshold was 0.2. S / P = [A650 value of sample – A650 value of NC] / [A650 value of sample – A650 value of NC]. Multiple comparisons were performed using the Tukey method; different lowercase letters indicate significant differences (…). P< 0.05 The same lowercase letter indicates that the difference is not significant. P>0.05On day 7 post-immunization, the IBV-specific antibody titer in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in all other experimental groups except the IBV control group. P<0.05 On day 14 post-immunization, the IBV-specific antibody titer in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in all other experimental groups except the NC8-ChIL2+IBV group. P<0.05 On days 21 and 28 post-immunization, the IBV-specific antibody titers in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in the PBS group, IBV group, NC8-P+IBV group, and NC8-ChIL26+IBV group. P<0.05 Furthermore, on day 14 after the initial immunization, the level of IBV-specific antibodies in the NC8-ChIL2 / 17B / 26+IBV group reached its peak.

[0092] The concentration changes of cytokines IL-2, IL-4, IL-6, and IFN-γ in serum samples were detected on day 0 (before immunization on the day of the first immunization) and on days 14 and 28 after the first immunization using ELISA kits corresponding to the chicken cytokines IL-2, IL-4, IL-6, and IFN-γ (Shanghai Youxuan Biotechnology Co., Ltd., IL-2 catalog number YX-091202C, IL-4 catalog number YX-091204C, IL-6 catalog number YX-091206C, IFN-γ catalog number YX-090617C). Results are shown below. Figure 8 . Figure 8 In the figure, concentrations are shown as the mean + SD for each group; different lowercase letters indicate significant differences ( ). P<0.05 The same lowercase letter indicates that the difference is not significant. P >0.05 On day 0, there were no significant differences in the serum concentrations of IL-2, IL-4, IL-6, and IFN-γ among the groups. P>0.05 On days 14 and 28 post-immunization: serum IL-2 and IL-4 concentrations in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in the PBS group, IBV group, NC8-P+IBV group, and NC8-ChIL26+IBV group; on day 28 post-immunization, serum IL-6 concentration in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in the PBS group, IBV group, and NC8-P+IBV group. P<0.05 ), while there was no significant difference compared to other experimental groups ( P> 0.05 On day 14 post-immunization, the serum IFN-γ concentration in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in the PBS group, and the concentrations in the NC8-P+IBV group and the NC8-ChIL2+IBV group were also significantly higher. P<0.05 ), while there was no significant difference compared to other experimental groups (P>0.05 On day 28 post-immunization, the serum IFN-γ concentration in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in the PBS group, and the concentrations in the IBV group and NC8-P+IBV group were also significantly higher. P< 0.05 ), while there was no significant difference compared to other experimental groups ( P>0.05 ).

[0093] 3. Mucosal immune indicators On day 28 after the initial immunization, some experimental chickens were euthanized by collecting blood from their hearts. Fresh trachea and intestines (including Pierre lymph nodes), 8 cm each, were taken and placed on ice. They were repeatedly rinsed with 1 mL of cold PBS buffer containing protease inhibitors, followed by centrifugation at 10,000 g for 10 min at 4°C. The supernatant was collected as the rinsing solution containing mucosal antibodies and stored at -20°C for later use.

[0094] The total sIgA antibody concentration in the rinsing fluid was detected using a chicken sIgA antibody detection kit (based on the direct sandwich ELISA principle).

[0095] Method for detecting IBV-specific mucosal antibody sIgA titer: The obtained rinsing solution was added to an ELISA plate coated with IBV-specific antigen (Shanghai Youxuan Biotechnology Co., Ltd., catalog number YX-090814C) (100 μL per well), with each sample repeated in triplicate. The plate was incubated at 37 ℃ for 1 h, washed 5 times, and after the last drying, 1:2000 diluted HRP-labeled goat anti-chicken IgA antibody (100 μL per well) was added. The plate was incubated at 37 ℃ for 1 h, washed 5 times, dried, and then the substrate chromogenic solution was added. After incubation at room temperature for 10 min, the absorbance (OD) at 630 nm was read using an ELISA reader. 630 .

[0096] See results Figure 9 . Figure 9 In the study, total sIgA concentration (a, b) and IBV-specific sIgA titer (c, d) were used; mucosal antibody concentrations and titers were shown as mean ± SD for each group; Tukey multiple comparisons were used for statistical analysis; different lowercase letters indicate significant differences. P< 0.05 The same lowercase letter indicates that the difference is not significant. P>0.05 In the trachea, the total sIgA in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in the PBS group and IBV group. P<0.05 The group was significantly different from other experimental groups. P>0.05 In the trachea, the IBV-specific sIgA content in the NC8-ChIL2 / 17B / 26+IBV group was significantly higher than that in the other experimental groups. P<0.05In the gut, the total sIgA and IBV-specific sIgA in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in the other experimental groups. P<0.05 ).

[0097] 4. Cellular immune indicators (1) CD4 in peripheral blood lymphocytes + T cells and CD8 + Changes in T cells On days 14 and 28 after the first immunization, venous blood was collected from the wing veins of the experimental chicken flock using a syringe with sodium citrate added at a ratio of 1:9. After mixing, the blood was placed on ice, and peripheral blood lymphocytes (PBLCs) were isolated using the TBD Chicken Peripheral Blood Lymphocyte Separation Kit.

[0098] Peripheral blood lymphocytes were collected and analyzed using FACScan flow cytometry (the obtained experimental data were analyzed using FlowJO 7.6.1 software). CD4+ cells in the peripheral blood lymphocytes were obtained. + T cells and CD8 + T cell count. Results are shown in... Figure 10 In the figure, Tukey's multiple comparisons were used for statistical analysis; **** indicates P < 0.001. On day 28 post-primary vaccination, CD4 counts in chicks of the NC8-ChIL2 / 17B / 26+IBV group were... + T cells and CD8 + T cell counts were significantly higher in both the NC8-P+IBV group and the NC8-ChIL26+IBV group. P<0.05 ).

[0099] (2) Changes in the expression of immune-related genes in various tissues of immunized chickens (QPCR) On the 28th day after the first vaccination, four experimental chickens in each group were culled by blood collection from the heart. The condition of the chickens' tissues and organs was observed to assess safety, and the trachea, kidney, and cecum tonsil were collected and immediately frozen in liquid nitrogen.

[0100] 0.1 g of tissue was added to 1 mL of pre-cooled PBS buffer, homogenized, and 200 μL of the homogenate was added to Trizol solution to extract RNA, which was then reverse transcribed to obtain cDNA. Real-time quantitative PCR was performed using the cDNA as a template (primers are shown in Table 1) to analyze the immunomodulatory effect of the tested bacteria on the IBV vaccine at the cellular immune level.

[0101] Figure 11 In the analysis, Tukey's multiple comparisons were used; different colors indicate significant differences. P<0.05 The same color indicates that the difference is not significant. P>0.05The results showed that in the trachea, the expression levels of IL-22, TLR3, TLR7, TGF-β4, and BCL-6 in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in other groups. P<0.05 In the cecal tonsils, the expression levels of IL-1β, IL-22, TLR3, TGF-β4, and BCL-6 in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in other groups. P<0.05 In spleen tissue, the expression levels of IL-1β, IL-22, TLR3, TLR7, TGF-β4, and BCL-6 in the NC8-ChIL2 / 17B / 26+IBV group were significantly higher than those in other groups. P<0.05 ).

[0102] 5. Virus challenge protection test At 35 days of age, the chickens were challenged with IBV M41 strain. After weighing the immunized flock, they were challenged with IBV M41 strain via simultaneous nasal drops, ocular drops, and oral administration. The challenge dose was 1 mL EID per bird. 50 10 5.8 The IBV strain M41 was used. The flock was observed morning and evening, noting feeding and drinking habits, and the presence of IBV infection symptoms such as coughing and wheezing. Ten days after challenge, all chickens were weighed and culled. Histopathological changes in IBV target organs were observed, and tissue samples were collected. Tissue samples included lungs, liver, spleen, kidneys, bursa of Fabricius, and tracheal lymph nodes (TLN).

[0103] Tissue samples were immediately frozen in liquid nitrogen after collection. Then, 0.1 g of tissue sample was added to 0.5 μL of cold PBS buffer and homogenized. 200 μL of the tissue homogenate was added to 800 μL of Trizol solution to extract RNA, which was then reverse transcribed to obtain cDNA. 1 µL of cDNA (one-tenth of the total RNA) was used as a template. Based on the genomic sequences of IBV M41 (GenBank accession number AY851295.1) and IBVH120 (GenBank accession number FJ888351.1), gene fragments with significant base differences between IBV M41 and the vaccine IBV H120 were identified. Primers for identifying M41 and H120 were designed based on these differentially expressed gene fragments for RT-qPCR. Primer P... IBV -F / P IBV -R was synthesized by Chengdu Qingke Biotechnology.

[0104] P IBV -F 5'-ACGGATTCAGGGTGATGCTGAGG-3'; P IBV -R 5'-TTTGTTACTTGCCGGGTCTTGTAT-3'.

[0105] Primer P IBV -F / P IBV -R amplification of M41 yields a 105bp amplified band, but amplification of H120 does not yield the target band.

[0106] A standard plasmid was designed based on a specific DNA fragment sequence selected from the M41 strain genome. The backbone plasmid was pUC57, and after inserting the specific DNA fragment, it was named pUC57-M41. The standard plasmid pUC57-M41 was synthesized and sequenced by Chengdu Qingke Biotechnology. A standard curve equation was constructed using the standard plasmid. The standard curve equation is y = 3.2771x + 37.947, E = 102.0%, R0. 2 =0.9971.

[0107] The M41-specific DNA fragment sequence used to construct the standard plasmid is shown in SEQ ID No. 6.

[0108] The agarose gel electrophoresis results of the standard plasmids are shown in the figure. Figure 12 Lane 1 contains the standard plasmid pUC57-M41; lane 2 contains pUC57-M41 single enzyme digestion (Ndel); lane M contains DL4500 DNA Marker.

[0109] The viral load of IBV M41 in each tissue was detected, with six replicates for each sample.

[0110] The statistical method used was a multiple t-test, where different lowercase letters indicated significant differences. P<0.05 The same lowercase letter indicates that the difference is not significant. P>0.05 ).

[0111] See results Figure 13 In the tracheal lymph nodes, the IBV M41 copy number in the NC8-ChIL2 / 17B / 26+IBV group was significantly lower than that in the PBS group, IBV group, NC8-ChIL17B+IBV group, and NC8-ChIL26+IBV group. P<0.05 The viral copy number did not differ significantly among the NC8-P+IBV group, the NC8-ChIL2 / 17B / 26+IBV group, and the NC8-ChIL2+IBV group. P>0.05 In kidney and lung tissues, the IBV M41 copy number in the NC8-ChIL2 / 17B / 26+IBV group was significantly lower than that in the PBS group, and the IBV group and NC8-P+IBV group ( P<0.05The viral copy number differences between the NC8-ChIL2 / 17B / 26+IBV group and the NC8-ChIL2+IBV group, the NC8-ChIL17B+IBV group, and the NC8-ChIL26+IBV group were not significant. P>0.05 In the spleen, the IBV M41 copy number was significantly higher in the PBS group than in other groups. P<0.05 In the bursa of Fabricius and liver tissue, the copy number of IBV M41 in the NC8-ChIL2 / 17B / 26+IBV group was significantly lower than that in the PBS group, and the copy number in both the IBV group and the NC8-ChIL17B+IBV group was significantly lower. P<0.05 The viral copy number did not differ significantly among the NC8-P+IBV group, the NC8-ChIL2 / 17B / 26+IBV group, the NC8-ChIL2+IBV group, and the NC8-ChIL26+IBV group. P>0.05 ).

[0112] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A fusion protein comprising chicken interleukin-2, chicken interleukin-17B, and chicken interleukin-26; The fusion protein is the protein shown in SEQ ID No.

1.

2. A nucleic acid molecule encoding the fusion protein of claim 1.

3. The nucleic acid molecule as described in claim 2, characterized in that: The nucleic acid molecule is a DNA molecule with a coding region as shown in SEQ ID No.

2.

4. Any of the following biological materials: (c1) An expression cassette containing the nucleic acid molecule of claim 2 or 3; (c2) A recombinant vector containing the nucleic acid molecule of claim 2 or 3; (c3) A transgenic cell line containing the nucleic acid molecule of claim 2 or 3; (c4) Recombinant bacteria containing the nucleic acid molecule of claim 2 or 3; The fermentation products of the recombinant bacteria described in (c5) and (c4); Total cell protein of the recombinant bacteria described in (c6) and (c4).

5. The biomaterial as described in claim 4, characterized in that: The recombinant bacteria are recombinant lactic acid bacteria.

6. The biomaterial according to claim 5, characterized in that: The recombinant lactic acid bacteria are obtained by introducing the recombinant vector described in (c2) into lactic acid bacteria, and the lactic acid bacteria are Lactobacillus plantarum.

7. The biomaterial according to claim 6, characterized in that: The Lactobacillus plantarum is Lactobacillus plantarum NC8.

8. A complete product for the prevention and / or treatment of infectious bronchitis in chickens, characterized in that: The complete product contains an IBV vaccine and an immune booster; the immune booster is the fusion protein of claim 1, or the nucleic acid molecule of claim 2 or 3, or any of the biological materials of claims 4-7. The product in question is a medicine.

9. The complete set of products according to claim 8, characterized in that: The IBV vaccine mentioned is the IBV H120 vaccine.

10. The use of IBV vaccine and immune booster in the preparation of a drug; the function of the drug is to prevent and / or treat infectious bronchitis in chickens; the immune booster is the fusion protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or any of the biological materials of claims 4-7.

11. The application according to claim 10, characterized in that: The IBV vaccine mentioned is the IBV H120 vaccine.

Images