A cell strain stably expressing cas9 protein and a preparation method and application thereof

Abstract

The application belongs to the field of biological medicine, and discloses a cell strain stably expressing Cas9 protein and a preparation method and application thereof. The application integrates a Cas9 gene sequence into an AAVS1 site in a cell genome through homologous recombination by using CRISPR / Cas9 technology, so that the cell stably expresses Cas9 protein and avoids risks caused by random integration. The cell strain prepared by the application can be used for further gene editing, and provides a powerful tool for research and development in the fields of tumor pathological research and anti-tumor drugs.

Description

Technical Field

[0001] This invention belongs to the field of life sciences and relates to a cell line that stably expresses Cas9 protein, its preparation method and application, and more particularly to an A549 cell line that stably expresses Cas9 protein, its preparation method and application. Background Technology

[0002] Clustered regularly interspersed short palindromic repeats (CRISPR) are the immune system of bacteria and archaea against viral or bacteriophage invasion. They integrate foreign DNA sequences into CRISPR sequences. CRISPR-associated proteins (Cas), possessing endonuclease activity, form a complex with the sgRNA (formed by annealing complementarity of crRNA and tracrRNA) in the CRISPR system. This complex specifically cleaves the foreign sequence through the PAM sequence of the sgRNA, achieving a defensive effect. There are three types of CRISPR / Cas systems: I, II, and III. Compared to the other types, type II CRISPR / Cas9 requires only one Cas9 protein to exert its defensive function, making it the most widely used. In 2012, Emmanuelle Charpentier and Jennifer A. Doudna discovered that the CRISPR / Cas9 system can efficiently edit genomes. In 2013, Feng Zhang and George Church almost simultaneously achieved gene editing in mammalian cells using the CRISPR / Cas9 system. Subsequently, the CRISPR / Cas9 system gradually enabled gene editing in various cells and organisms.

[0003] Based on the sequence characteristics of crRNA and tracrRNA, sgRNAs that specifically recognize target genes can be designed. Transforming a plasmid vector carrying the sgRNA sequence and the Cas9 gene sequence into the cells to be edited can achieve gene editing. However, because the Cas9 gene sequence is too long (4106 bp), the plasmid vector is too large, often resulting in low transfection efficiency and gene editing failure. In recent years, researchers have first transformed the Cas9 gene into cells to construct cell lines that stably express the Cas9 protein, and then transformed the corresponding sgRNA sequence as needed to achieve gene editing.

[0004] Plasmid vectors can be classified into viral vectors and non-viral vectors based on their origin. Commonly used viral vectors include lentiviral vectors and adeno-associated virus (AAV) vectors. Lentiviral vectors randomly integrate into the target cell genome, stably expressing sgRNA and Cas9, but potentially causing unknown alterations to the target cell genome. AAV vectors, in the presence of replicase, directionally integrate into the AAVS1 site on chromosome 19; in the absence of replicase, they integrate randomly into the target cell genome, similar to lentiviral vectors. However, the maximum loading capacity of AAV vectors is 4.7 kbp, which includes its own elements, making it difficult to carry a Cas9 gene sequence of more than 4 kbp. In addition, viral vectors generate viral particles during cell transfection, posing a high operational risk. Non-viral plasmids offer a high level of safety. Through plasmid design, the Cas9 sequence can be integrated into the gene insertion safe site of the target cell genome via homologous recombination (e.g., AAVS1 is commonly used in human cells, and Rosa26 is commonly used in mouse cells). This ensures stable expression of the Cas9 gene while avoiding random sequence insertion, without affecting normal cellular activities. However, transfection using non-viral plasmids and the conventional transfection reagent PEI suffers from extremely low transfection efficiency. Especially for sequences longer than 10 kDa and when transfecting multiple plasmids simultaneously, the transfection efficiency is only around 10%. Adding cationic substances to the transfection system can synergistically bind PEI to DNA molecules and carry them into the cell. Lauroyl arginine ethyl ester hydrochloride (LAE) is a cationic compound with a molecular weight of 421, commonly used as a preservative in food and cosmetics. Currently, there are no known applications of LAE in plasmid transfection. This invention discovers that adding LAE to the transfection system can significantly improve the efficiency of dual plasmid co-transfection using the PEI method. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a cell line that stably expresses Cas9 protein, its preparation method and application, to solve the problems of low transfection efficiency when transfecting multiple large plasmids at the same time and the difficulty in transfecting and editing cells due to the excessive length of the Cas9 gene sequence when performing gene editing.

[0006] One of the objectives of this invention is to provide a cell line that can stably express Cas9 protein; the cell line is A549 Cas9-copGFP-1, with accession number CCTCC NO:C202264.

[0007] The A549 cell line that stably expresses Cas9 protein as described in this invention was deposited on June 21, 2022, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China (299 Bayi Road, Wuchang District, Wuhan, Hubei Province), with the accession name: A549 Cas9-copGFP-1 and accession number: CCTCC NO: C202264.

[0008] Another object of the present invention is to provide a method for preparing a cell line that stably expresses the Cas9 protein, the method comprising: transfecting cells with the Cas9 gene in the presence of PEI and LAE.

[0009] Another objective of this invention is to provide applications of the above-mentioned cell lines in the life sciences, particularly in gene editing.

[0010] Another object of the present invention is to provide a method for improving transfection efficiency, wherein the method is performed by adding LAE.

[0011] Compared with the prior art, the beneficial technical effects of the present invention are as follows:

[0012] This invention is the first to utilize LAE to improve the transfection efficiency of PEI method for non-viral plasmids by up to 4.28 times.

[0013] This invention is the first to prepare a cell line that stably expresses the Cas9 protein in A549 cells, and the Cas9 gene sequence is inserted into the AAVS1 safe site in the A549 genome.

[0014] The present invention successfully knocked out the copGFP gene using the above-mentioned cell line. Attached Figure Description

[0015] Figure 1 The plasmid map of AAVS1-sgRNA-Cas9, which is the AAS1 site cleavage plasmid.

[0016] Figure 2 A plasmid map of the AAVS1-Cas9 donor plasmid.

[0017] Figure 3 Fluorescence micrographs of A549 Cas9 recombinant polyclonal antibodies after transfection with plasmids of different concentrations of LAE.

[0018] Figure 4 Cell viability of A549 cells after 48 hours of treatment with different concentrations of puromycin.

[0019] Figure 5 A schematic diagram of the primer combination for PCR verification of Cas9 gene knock-in AAVS1 site.

[0020] Figure 6 PCR verification results for the knock-in of the AAVS1 site in the A549 Cas9 recombinant polyclonal Cas9 gene.

[0021] Figure 7 This is a schematic diagram of the serial dilution method for isolating monoclonal antibodies.

[0022] Figure 8 Fluorescence micrographs of A549, A549 Cas9 monoclonal 1#, and A549 Cas9 monoclonal 2#.

[0023] Figure 9 PCR verification results for the knock-in of the AAVS1 site into A549 Cas9 monoclonal 1# and A549 Cas9 monoclonal 2#.

[0024] Figure 10 The results of Cas9 protein expression in A549, A549 Cas9 monoclonal 1#, and A549 Cas9 monoclonal 2# were obtained by Western blotting.

[0025] Figure 11 The results are for the detection of A549 Cas9 monoclonal 2#STR.

[0026] Figure 12 The results of Cas9 protein expression in A549 Cas9 monoclonal 2# after passage to the 3rd, 10th, and 50th generations are shown.

[0027] Figure 13 This is a fluorescence micrograph of the copGFP gene knocked out using A549 Cas9 monoclonal 2#. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to the specific embodiments and accompanying drawings. The scope of protection of the present invention is not limited to the following embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims. The processes, conditions, reagents, experimental methods, etc., for implementing the present invention, except as specifically mentioned below, are all common knowledge and general knowledge in the art, and the present invention does not have any particular limitations.

[0029] This invention provides a cell line stably expressing Cas9 protein, wherein the cell line is A549 Cas9-copGFP-1, with accession number CCTCC NO: C202264. In this invention, the genome of the A549 Cas9-copGFP-1 cell line contains the Cas9 gene sequence. The genome of the A549 Cas9-copGFP-1 cell line also contains the puromycin resistance gene sequence and the copGFP gene sequence.

[0030] The present invention also provides a method for preparing a cell line that stably expresses Cas9 protein, the method comprising: transfecting cells with the Cas9 gene in the presence of PEI and LAE.

[0031] In the method described in this invention, the concentration of LAE is 2–30 μg / mL, and can be 2–5, 5–8, 8–10, 10–15, 15–20, 20–25, or 25–30 μg / mL. Preferably, the concentration of LAE is 2–20 μg / mL; more preferably, it is 5–10 μg / mL, and can be 5, 6, 7, 8, 9, or 10 μg / mL; even more preferably, it is 10 μg / mL.

[0032] In the method described in this invention, the cells transfected with the Cas9 gene can be any suitable cells, as long as they can be further used as tools for subsequent gene editing and other purposes. In a preferred embodiment, the transfected cells are human alveolar adenocarcinoma basal epithelial cells; more preferably, the cells transfected with the Cas9 gene are A549 cells.

[0033] In the method of this invention, cells are selected by puromycin after transfection; preferably, the concentration of puromycin is 0.0625 μg / mL to 8 μg / mL; more preferably, the method includes: treating cells with 2 μg / mL puromycin for 48 h after transfection, and then continuously culturing cells under 1 μg / mL puromycin conditions. The method of this invention, by adding LAE, can greatly improve transfection efficiency; in one embodiment, it improves transfection efficiency by 4.28 times.

[0034] In a preferred embodiment of the method described in this invention, the Cas9 gene is spCas9.

[0035] In the method described in this invention, the Cas9 gene sequence is inserted into the AAVS1 gene in the A549 cell genome.

[0036] In the method described in this invention, the puromycin resistance gene sequence is inserted into the AAVS1 gene in the A549 cell genome.

[0037] In the method described in this invention, the copGFP gene sequence is inserted into the AAVS1 gene in the A549 cell genome.

[0038] In one embodiment, the method for preparing a cell line stably expressing Cas9 protein provided by the present invention includes the following steps:

[0039] S1. Design and construct vectors that can express sgRNA, Cas9 protein expression genes, AAVS1 gene homologous sequences, antibiotic selection marker genes, and fluorescent marker genes;

[0040] S2. Transfer the vector into cells;

[0041] S3. Screening for positive cell lines using antibiotics and fluorescence;

[0042] S4. After establishing a single-clone cell line, the single-clone cell line is obtained through identification.

[0043] The present invention also provides a cell line that stably expresses Cas9 protein, prepared by the method described above.

[0044] This invention also provides the use of the cell lines that stably express Cas9 protein as described above in gene editing. For example, using the aforementioned cell lines that stably express Cas9 protein as tool cells for subsequent gene editing operations yields the gene-edited cell line. Since the cell lines themselves can express Cas9 protein, only the corresponding sgRNA fragment needs to be introduced to rapidly edit the target gene, allowing for the study of the target gene's effects on organisms. This has scientific significance and market value for finding disease treatment targets and establishing animal models.

[0045] This invention also provides a method for improving gene transfection efficiency, wherein the method involves transfecting cells with genes in the presence of LAE; preferably, the method involves transfecting cells with genes in the presence of PEI and LAE. The method of this invention, by adding LAE, can significantly improve transfection efficiency, such as increasing it by 4.28 times.

[0046] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0047] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0048] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0049] Experimental Materials and Methods

[0050] (1) Cells, bacterial strains and plasmids

[0051] The A549 cells were obtained from the National Model and Special Experimental Cell Resource Bank, accession number: SCSP-503. A549 cells from other sources can also be used in this invention. *E. coli* trans-5α (Full-Gold #CD201-01); plasmids AAVS1-sgRNA-Cas9 and AAVS1-Cas9 donor were constructed from GeneCopoeia. Plasmid maps can be found in [link to relevant documentation]. Figure 1 , Figure 2 The plasmid copGFPsgRNA in pCDN3.1 (containing G418 resistance) was constructed by Anshengda Company, and the plasmid vector was pCDN3.1 (containing G418 resistance). The copGFPsgRNA sequence is as follows:

[0052] TAATTAAGGTACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCAT ATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTACGAGGCCGGCCGCGTGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAATTCGCTAGCTAGGTC(SEQ ID NO.1).

[0053] (2) Instruments and equipment

[0054] Water bath, CO2 constant temperature cell culture incubator, biosafety cabinet, PCR instrument, gel imaging instrument, protein electrophoresis system, high-speed centrifuge, pipette, nucleic acid electrophoresis system, microwave oven, shaker, autoclave.

[0055] (3) Reagents

[0056] PBS buffer (Sangon Biotech, #E607008), RIPA cell lysis buffer (Sangon Biotech, #C500005-0050), DMEM (Invitrogen, #11960044), F-12K (Invitrogen, #21127-022), Glutamax (Invitrogen, #35050061), fetal bovine serum (GIBCO), puromycin (Sola) rbir (P8230), neomycin (Sangon Biotech, #A600958-0100), ampicillin (Sangon Biotech, #A100339), PEI (Yisheng Biotech, #40815ES03), LAE (Maclean's, #E857058), BCA kit (Thermo Fisher Scientific, #23227), BSA (Sangon Biotech, #A600332-0100), Anti-CRISPR-Cas9 Antibody (abcam, #ab189380), β-Actin (13E5) Rabbit mAb (CST, #4970S), Endotoxin-free plasmid small-volume extract kit (Tiangen, DP118-02), Goat Anti-Rabbit IgG H&L (HRP) (abcam, #ab205718), Acrylamide / Methylenebisacrylamide 30% solution (Sangon Biotech, #B546018), TEMED (Sangon Biotech, #A100761-0025), TAE (Sangon Biotech, #B548101), SDS (Sangon Biotech, #A600485-0100), pH 6.8 Tris-HCl (Sangon Biotech, #C526034-0250), pH 8.8 Tris-HCl (Sangon Biotech, #C506033-0250), agarose (Sangon Biotech, #A620014-0100), running buffer (Sangon Biotech, #C520001-0500), trans buffer (Sangon Biotech, #B540152-0500).

[0057] (4) Cell Culture

[0058] The culture medium for A549 cells consisted of 89 v% F-12K medium, 10 v% FBS, and 1 v% glutamax; where v% represents the percentage of the total culture medium volume.

[0059] The culture medium for A549 cells transfected with plasmid consisted of 89 v% F12K medium, 10 v% FBS (Gbico), 1 v% glutamax, and a final concentration of 1 μg / mL puromycin, where v% represents the percentage of total culture medium volume.

[0060] Example 1: Plasmid transfection of A549 cells

[0061] 1.1 Plasmid transformation and amplification

[0062] Take two sterile EP tubes and add 50 μL of thawed competent *E. coli* trans5α to each. Gently add 10 μL of 50 ng AAVS1-sgRNA-Cas9 or AAVS1-Cas9 donor to each tube, mix gently, and incubate on ice for 40 min. Heat shock in a 42°C water bath for 45 seconds, then quickly transfer to an ice bath for 2 minutes. Add 200 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking for 1 hour to resuscitate the bacteria. Centrifuge the resuscitated bacteria at 1000 rpm for 3 min, discard some of the supernatant, and resuspend the *E. coli* in about 50 μL. Spread the resuspended bacteria onto LB agar plates containing 50 μg / mL AMP and LB agar plates without AMP, and incubate overnight at 37°C. Pick single colonies from the AMP-containing LB agar plates and place them in 200 mL of LB liquid medium containing 50 μg / mL AMP, and incubate at 37°C and 220 rpm for 16–24 h.

[0063] Plasmids were extracted from overnight bacterial culture using the Tiangen endotoxin-free plasmid mini-extraction kit, yielding AAVS1-sgRNA-Cas9 and AAVS1-Cas9 donors, respectively. The concentration of the extracted plasmids was determined using a UV spectrophotometer.

[0064] 1.2 Cell transfection

[0065] A549 cells were seeded in 6-well plates. When the cell density reached 40-50%, each well was replaced with 2 mL of complete culture medium. Group A served as a negative control without LAE, while groups B, C, and D were treated with LAE at final concentrations of 5, 10, and 15 μg / mL, respectively. 100 μL of serum-free F-12K medium, 2 μg each of AAVS1-sgRNA-Cas9 plasmid and AAVS1-Cas9 donor plasmid were gently mixed to prepare a plasmid dilution buffer. Immediately, 5 μL of 1 mg / mL PEI transfection reagent was added to 100 μL of the plasmid dilution buffer and gently mixed. The cells were incubated at room temperature for 10-25 min. The incubation product was then added to each well of a 6-well plate at a volume of 100 μL. After gentle mixing, the cells were incubated at 37°C in a 5% CO2 incubator. After 24 hours, the medium was changed and white light and fluorescence images of each group of cells were taken under a microscope. The transfection efficiency of each group was counted and calculated. Transfection efficiency = number of green fluorescent cells / number of cells in white light image * 100%.

[0066] The results are as follows Figure 3As shown in Table 1, the transfection efficiency using PEI alone was only 7.58%. Adding 5, 10, and 15 μg / mL LAE resulted in transfection efficiencies of 23.75%, 32.37%, and 32.48%, respectively, increasing the efficiency by 3.13 times, 4.27 times, and 4.28 times. Since increasing the LAE concentration from 10 μg / mL to 15 μg / mL only increased the transfection efficiency from 32.37% to 32.48%, the optimal LAE concentration is 10 μg / mL.

[0067] Table 1 Transfection efficiency of different concentrations of LAE

[0068]

[0069] Example 2: A549 recombinant polyclonal antibodies were obtained by screening with puromycin.

[0070] 2.1 Determination of lethal concentration of puromycin against A549 recombinant polyclonal antibodies

[0071] (1) A549 recombinant polyclonal cells that are growing well in the culture medium are seeded into 96-well plates at a density of 3000 cells per well and then placed in an incubator at 37°C and 5% CO2.

[0072] (2) After the cells adhered to the plate, puromycin was added to each well of the 96-well plate, so that the final concentrations of each group were 0.0625, 0.125, 0.25, 0.5, 1, 2 and 4 μg / mL respectively.

[0073] (3) Place the 96-well plate in a 37℃, 5% CO2 incubator and incubate for 48h.

[0074] (4) Add 10 μL of CCK8 solution to each well of the 96-well plate and incubate the 96-well plate in a 37°C, 5% CO2 incubator for 4 h.

[0075] (5) Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the absorbance of the sample at 450 nm.

[0076] The results are as follows Figure 4 As shown, by Figure 4 It was found that treatment with 2 μg / mL puromycin for 48 h could kill 97.62% of A549 cells. Therefore, A549Cas9 recombinant polyclonal cells transfected with 2 μg / mL puromycin were incubated for 48 h for screening.

[0077] 2.2 Screening and enrichment of A549 recombinant polyclonal clones

[0078] After A549 cells or A549Cas9 recombinant polyclonal cells reached confluence, they were digested with 0.25% trypsin and transferred to 6cm culture dishes. Once the cells adhered, 2μg / mL puromycin was added for selection over 48 hours. Because the growth rate of transfected A549 cells was too slow when continuously cultured with 2μg / mL puromycin, it was changed to 1μg / mL puromycin for continuous culture (the control group consisted of A549 cells). After 5 days, all cells in the control group died and floated, while some cells in the transfected group still survived. The surviving cells from the transfected group were passaged into T25 flasks, and after confluence, they were passaged 1:3. One-fifth of the cells were used for gene knock-in validation.

[0079] 2.3 Validation of A549 recombinant polyclonal AAVS1 site gene knock-in

[0080] The validation PCR was performed to verify whether the DNA fragment loaded in the donor vector was specifically integrated into the AAVS1 site. The primer combination for the validation PCR was set at both ends of the 5' AAVS1 recombinant arm (5'AAVS1-HA-L) and the 3' AAVS1 recombinant arm (AAVS1-HA-R) (e.g., ...). Figure 5 (As shown). The 5' end PCR product is 1.1 kDa, and the 3' end PCR product is 1.2 kDa. The primer sequences are as follows:

[0081] 3' end verification primer:

[0082] Forward Primer:5'-AAGCTCATCTGGTCTCCCTTCC-3'(SEQ ID NO.2)

[0083] Reverse Primer:5'-TCCTGGGATAACCCGAAGAG-3'(SEQ ID NO.3)

[0084] 5' end verification primer:

[0085] Forward Primer:5'-CCGGAACTCTGCCCTCTAAC-3'(SEQ ID NO.4)

[0086] Reverse Primer:5'-AGTAGGAAAGTCCCATAAGGTCA-3'(SEQ ID NO.5)

[0087] Using QuickExtract TM DNA Extraction Solution 1.0 was used to extract the genomes of A549 and A549 Cas9 polyclonal DNA, respectively. 50 μL of QuickExtract was added to the cell pellet. TMDNA Extraction Solution 1.0, after vortexing and mixing, is heated at 65°C for 6 minutes and then at 98°C for 2 minutes to obtain the cell genome.

[0088] PCR amplification of the 3' and 5' recombination arms at the recombination sites was performed using Rapid Taq Master Mix 2*. The PCR system is as follows:

[0089]

[0090] The above samples were subjected to PCR using a Bio-Rad PCR instrument, and the procedure is as follows:

[0091]

[0092] The PCR products were subjected to agarose gel electrophoresis using a Tiangen D15000+2000 DNA Marker at 120V for 30 minutes. The electrophoretic gel was photographed using a Tianneng chemiluminescence imaging system.

[0093] The results are as follows Figure 6 As shown, A549 cells, used as a negative control, did not amplify the specific verification fragment. However, A549Cas9 polyclonal cells amplified the specific verification fragment using either the 5' end verification primer combination or the 3' end verification primer combination, and the fragment size was correct. This indicates that the plasmid fragment was correctly inserted into the AAVS1 site in A549Cas9 polyclonal cells.

[0094] Example 3: Screening and scaling up A549 Cas9 monoclonal antibodies

[0095] 3.1 Sequential dilution method for isolating monoclonal cells

[0096] like Figure 7 As shown, cells were dispersed in 96-well plates using a serial dilution method, resulting in one cell per well. The wells in the first column of the 96-well plate were numbered A1, B1, C1, D1, E1, F1, G1, and H1, respectively, and the wells in the second column were numbered A2, B2, C2, and so on. The specific procedure was as follows: Add 100 μL of culture medium to each well in the first column of the sterile 96-well plate, leaving well A1 empty. Add 200 μL of cell suspension to well A1, and take 100 μL of this suspension and mix it with the culture medium in well B1, avoiding the formation of air bubbles during mixing. Continue with the same 1:2 dilution in the first column until well H1 completes the first dilution step. Then, bring the volume of each well in the first column to 200 μL with culture medium. Mix the cell suspension in the first column, and take 100 μL of each well in the first column and add it to the wells in the second column. Gently mix with a pipette. Repeat this 1:2 dilution to column 12 to complete the second dilution step, and bring the volume of each well to 200 μL with culture medium. Incubate the plate at 37°C.

[0097] 3.2 Observation of green fluorescence in monoclonal cells using fluorescence microscopy

[0098] After 8 days of culture, wells containing monoclonal colonies were labeled under a microscope. Once the monoclonal colonies had grown, they were sequentially transferred into 24-well plates, 6-well plates, and finally T25 culture flasks, yielding two A549 Cas9 monoclonal cell lines: A549 Cas9 monoclonal 1# and A549 Cas9 monoclonal 2#. The A549 cells and A549 Cas9 monoclonal cells were photographed using a fluorescence microscope. The results are as follows: Figure 8 As shown, A549 cells do not fluoresce green, while A549 Cas9 monoclonal 1# and A549 Cas9 monoclonal 2# cells show green fluorescence.

[0099] Example 4: Identification of A549 Cas9 Monoclonal Cells

[0100] After the A549 Cas9 monoclonal T25 flasks reached confluence, the cells were digested with 0.25% trypsin and centrifuged. One-third of the cell pellet was used for passage, one-third for subsequent genome extraction, and one-third for subsequent total protein extraction.

[0101] 4.1 Validation of A549 Cas9 monoclonal AAVS1 site gene knock-in

[0102] Using wild-type A549 as a control, the cell genome extraction technology and PCR technology described in section 2.3 were used to verify the insertion of recombinant fragments into the AAVS1 site in A549 Cas9 monoclonal cells.

[0103] The results are as follows Figure 9 As shown, A549 cells, used as a negative control, did not amplify the specific validation fragment. For A549Cas9 monoclonal clone 1# and A549Cas9 monoclonal clone 2#, the specific validation fragment was amplified using either the 5' end validation primer combination or the 3' end validation primer combination, and the fragment size was correct. This indicates that the plasmid fragment was correctly inserted into the AAVS1 site in A549Cas9 monoclonal clone 1# and A549Cas9 monoclonal clone 2#.

[0104] 4.2 Detection of recombinant monoclonal Cas9 protein expression by Western blotting

[0105] 100 μL of pre-cooled RIPA (containing 1 v% protease inhibitor cocktail and PMSF at a final concentration of 1 mM, where v% represents the volume percentage of total RIPA) was added to 2 × 10⁻⁶ cells. 6In A549, A549Cas9 monoclonal 1#, and A549Cas9 monoclonal 2# cell pellets, vortexing was used to completely disperse the pellets for total protein extraction. After centrifugation at 12000 rpm and 4℃ for 20 min, the supernatant was collected and quantified using a BCA kit. Each protein sample and one-fifth volume of a 5× loading mixture were boiled for 10 min. The target protein was separated by SDS-PAGE gel (4%-20% gradient gel), transferred to a PVDF membrane, blocked with 5% bovine serum albumin (BSA) or skim milk for 1 hour, and incubated overnight at 4℃ with rabbit Anti-CRISPR-Cas9 and β-actin primary antibodies. The membrane was washed three times with 1% PBST (0.5 mL Tween 20 + 500 mL PBS), incubated with HPR rabbit secondary antibody for 1 hour, washed three more times with 1% PBST, and then incubated with ECL chemiluminescence buffer for 2 min. The protein bands were then exposed and photographed using a Tianneng chemiluminescence image analysis system.

[0106] The results are as follows Figure 10 As shown, A549 cells, used as a negative control, do not express Cas9 protein, while A549 Cas9 monoclonal clone 1# and A549 Cas9 monoclonal clone 2# both express Cas9 protein. The Cas9 protein expression level in A549 Cas9 monoclonal clone 2# is significantly higher than that in A549 Cas9 monoclonal clone 1#. Therefore, A549 Cas9 monoclonal clone 2# was selected for further identification in this invention.

[0107] Example 5: STR identification of A549 Cas9 monoclonal 2#

[0108] To determine the genetic stability of A549 Cas9 monoclonal 2#, 10*10⁻⁶ cells were used. 6 Two A549 Cas9 monoclonal cells were sent to a third-party company for STR identification. Nine STR loci were genotyped using fluorescently labeled amplified product length polymorphism (FLP). Nine pairs of PCR primers were designed, forming a single panel for amplifying the nine polymorphic loci. Fluorescent labeling of the loci involved either 5' FAM or 5' VIC fluorescent labels on the primers. Primers were designed using the online Primer3 software (http: / / frodo.wi.mit.edu / cgi-bin / primer3 / primer3_www.cgi). After dilution, a small amount of the PCR product was mixed with an internal standard and directly subjected to capillary electrophoresis on an ABI 3730xl. Data were analyzed using GeneMapper 5.0 (Applied Biosystems).

[0109] The results are as follows Figure 11As shown, the obtained A549 Cas9 monoclonal 2# matches the STR results of A549 cells by 100%, indicating that there is no cross-contamination between cells in the obtained A549 Cas9 monoclonal 2#.

[0110] Example 6: Detection of the ability of A549 Cas9 monoclonal 2# to stably express Cas9 protein

[0111] To investigate the effect of passage number on the ability of A549 Cas9 monoclonal 2# to express Cas9 protein, i.e., to test whether the A549Cas9 monoclonal 2# cell line can continuously and stably express Cas9 protein, this example uses the method in 4.2 to perform Western blotting experiments on A549 Cas9 monoclonal 2# cells that have been passaged to the 3rd (F3), 10th (F10), and 50th (F50) generations, respectively.

[0112] The results are as follows Figure 12 As shown, A549 Cas9 monoclonal 2# was able to express Cas9 protein in F3, F10 and F50, and the protein expression level did not change with the increase of generations, indicating that A549 Cas9 monoclonal 2# has the ability to stably express Cas9 protein.

[0113] Example 7: Detection of A549 Cas9 Monoclonal 2# Gene Editing Capability

[0114] To test whether A549 Cas9 monoclonal 2# possesses CRISPR gene editing capability, a plasmid carrying copGFPsgRNA was transfected into it to achieve copGFP gene knockout in the cells. A549 Cas9 monoclonal 2# cells were seeded in 6-well plates. When the cell density reached 40-50%, each well was replaced with 2 mL of complete medium containing 10 μg / mL LAE. 100 μL of serum-free F-12K medium and 2 μg of plasmid copGFPsgRNA inpCDN3.1 (containing G418 resistance) were gently mixed to prepare a plasmid dilution. Immediately, 5 μL of 1 mg / mL PEI transfection reagent was added to 100 μL of the plasmid dilution and gently mixed. The cells were incubated at room temperature for 10-25 min. The incubation product was then added to each well of a 6-well plate at a volume of 100 μL. After gentle mixing, the cells were incubated at 37°C in a 5% CO2 incubator. After 24 hours, the medium was changed, and white light and fluorescence images of each group of cells were taken using a microscope.

[0115] The results are as follows Figure 13As shown, after A549 Cas9 monoclonal 2# cells were transfected with copGFPsgRNA, the number of cells expressing the green fluorescent protein copGFP decreased significantly, indicating that the copGFP gene was knocked out under the combined action of the Cas9 protein expressed in A549 Cas9 monoclonal 2# and copGFPsgRNA. Therefore, A549 Cas9 monoclonal 2# possesses CRISPR gene editing capabilities and can be used for gene editing.

[0116] In summary, the results indicate that the A549 cell line stably expressing Cas9 protein was successfully constructed. This cell line was deposited on June 21, 2022, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, Hubei Province, China. The preservation name of this A549 cell line stably expressing Cas9 protein is A549 Cas9-copGFP-1, and the accession number is CCTCC NO: C202264.

[0117] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. A method for preparing a cell line stably expressing Cas9 protein, characterized in that, The method involves transfecting cells with the Cas9 gene in the presence of PEI and lauroyl arginine ethyl hydrochloride (LAE), wherein the concentration of lauroyl arginine ethyl hydrochloride (LAE) is 2-20 μg / mL, and the cells transfected with the Cas9 gene are A549 cells.

2. The method as described in claim 1, characterized in that, It was obtained through selection using puromycin after transfection.

3. The method as described in claim 2, characterized in that, The concentration of the puromycin is 0.0625 μg / mL to 8 μg / mL.

4. The method as described in claim 1, characterized in that, The method includes: after transfection, treating cells with 2 μg / mL puromycin for 48 h, and then continuously culturing cells at 1 μg / mL puromycin.

5. The method as described in claim 1, characterized in that, The Cas9 gene is spCas9.

6. The method as described in claim 1, characterized in that, The method includes the following: i) Insert the Cas9 gene sequence into the AAVS1 gene in the A549 cell genome; ii) Insert the puromycin resistance gene sequence into the AAVS1 gene in the A549 cell genome; iii) Insert the copGFP gene sequence into the AAVS1 gene in the A549 cell genome.

7. A method for improving gene transfection efficiency, characterized in that, The method involves transfecting cells with the Cas9 gene in the presence of PEI and LAE, wherein the concentration of LAE is 2-20 μg / mL, and the cells transfected with the Cas9 gene are A549 cells.

8. The method as described in claim 7, characterized in that, It was obtained through selection using puromycin after transfection.

9. The method as described in claim 8, characterized in that, The concentration of the puromycin is 0.0625 μg / mL to 8 μg / mL.

10. The method as described in claim 7, characterized in that, The method includes: after transfection, treating cells with 2 μg / mL puromycin for 48 h, and then continuously culturing cells at 1 μg / mL puromycin.

11. The method as described in claim 7, characterized in that, The Cas9 gene is spCas9.

12. The method as described in claim 7, characterized in that, The method includes the following: i) Insert the Cas9 gene sequence into the AAVS1 gene in the A549 cell genome; ii) Insert the puromycin resistance gene sequence into the AAVS1 gene in the A549 cell genome; iii) Insert the copGFP gene sequence into the AAVS1 gene in the A549 cell genome.

Images