Molecular marker of maize male sterility gene zmms2085 and application thereof
Patent Information
- Application Number
- CN202210836434.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-15
- Publication Date
- 2026-09-08
- Estimated Expiration
- 2042-07-15
AI Technical Summary
人工去雄相对容易,可以使用机械去雄、化学杀雄等方法,但是这些策略也存在一些问题:一方面使用这些方法大大增加了制种的成本,另一方面因人工去雄的不彻底或不及时,会降低杂交种的纯度,造成生产上的大面积减产,最终造成经济损失
[0027] This invention is the first to discover a male sterility mutant gene in maize. Specifically, the male sterility mutant gene in maize is characterized by the insertion of two GA bases after the 1890th base of the 5th exon in the coding region of the wild-type B73 Zm00001eb261800 gene.
Smart Images

Figure HDA0003748538960000011 
Figure HDA0003748538960000012 
Figure HDA0003748538960000013
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant biotechnology, and more specifically, to a molecular marker for the maize male sterility gene zmms2085 and its application. Background Technology
[0002] Corn plays a crucial role in grain production in China and worldwide. In 2013, China's total corn output reached 215 million tons, accounting for 35% of total grain output, surpassing rice for the first time to become the largest grain crop. Corn is a prime example of utilizing heterosis, with the key to hybrid breeding and seed production technology lying in the demasting of the female parent. Artificial demasting is relatively easy, using methods such as mechanical demasting and chemical emasculation. However, these strategies also have some problems: on the one hand, using these methods significantly increases the cost of seed production; on the other hand, incomplete or untimely artificial demasting can reduce the purity of hybrid seeds, causing large-scale yield reductions and ultimately economic losses. Therefore, improving the purity of hybrid seeds is an urgent problem to be solved in current corn production, and using male-sterile lines for seed production is one of the most effective ways to improve the quality of hybrid seeds.
[0003] Nuclear male-sterile (NMS) materials in maize are a valuable germplasm resource, of paramount importance to maize hybrid production. However, for a long time, due to problems such as the inability to propagate and maintain homozygous NMS lines, these materials have not been effectively utilized in practical production. With the continuous discovery of new NMS materials, maize breeders have conducted extensive research and application attempts, such as developing grain color marker systems, yellow-green seedling linkage marker systems, and multi-filament linkage marker systems by utilizing the close linkage between marker traits and sterility. However, due to problems such as incomplete linkage between marker traits and sterility, difficulty in identifying marker traits, and delayed identification time, the application of these methods and attempts with NMS materials in maize production has not been widely adopted.
[0004] DNA molecular markers are specific DNA fragments that can reflect genomic genetic differences between individuals or populations. For genetic differences in small fragments with known nucleotide sequences in the genome, insertion or deletion types can generally be detected using specific primer PCR markers, such as STS (sequence-tagged site) markers, primer amplification blocked mutation system PCR markers, CAPS (cleaned amplified polymorphism sequences) markers, and dCAPS (derived cleaned amplified polymorphic sequences) markers, etc. (Guan Feng, Ai Juntao, Yang Liguo. A new method for SNP detection: PCR technology of four primer amplification blocked mutation system. Chemistry of Life, 2004, 24(6): 514-516; Wang Zhonghua, RedusMARC, Jia Yulin. Establishment of co-dominant molecular markers of maize resistance to rice blast gene Pi-ta. Chinese Journal of Maize Science, 2005, 19(6): 483-488; Delayed inheritance of purple pericarp in maize and Pb gene) Development of functional markers. Chinese Journal of Maize Science, 2014, 28(6): 605-611; Zhang Yadong, Zhou Lihui, Zheng Jia, et al. 2016, A PCR molecular marker method for identifying allele variations of maize kernel length gene qGL3, patent number: CN103882145B; Ding Dan, Zhang Yadong, Zheng Jia. Design and application of functional markers for maize kernel length genes GS3 and qGL3. Jiangsu Journal of Agricultural Sciences, 2014, 30(6): 1191-1197).
[0005] ZmMS2085 is a novel maize male sterility gene cloned by Hainan Bolian Gene Technology Co., Ltd. Currently, no corresponding molecular markers or detection kits have been developed. Given the enormous potential commercial value and application prospects of recessive nuclear male sterility materials in breeding, molecular markers that co-segregate with the recessive nuclear male sterility phenotype based on the base sequence of the zmms2085 mutant, and are simple to operate, rapid in typing, flexible in use, and inexpensive, will allow for the efficient and rapid utilization of this male sterility gene. Summary of the Invention
[0006] The purpose of this invention is to efficiently and rapidly utilize the cloned novel male sterility gene to provide a molecular marker for the maize male sterility gene zmms2085.
[0007] Maize material 2085 is a mutant material controlled by a single gene (zmms2085) that exhibits male pollen abortion but normal male organs. This material was obtained by Hainan Bolian Rice Gene Technology Co., Ltd. in June 2015 at the Hunan Academy of Agricultural Sciences after cobalt-60 irradiation of Jingkenuo 2000. The mutant has an insertion of two GA bases after position 1890 of exon 5 in the coding region of the Zm00001eb261800 gene on chromosome 6, causing a frameshift mutation thereafter. This male-sterile line exhibits stable fertility, regulated only by the nuclear-encoded single gene and unaffected by light and temperature conditions. The fertility-restoring gene for this male-sterile line is widely distributed in maize germplasm resources, and fertility can also be restored through wild-type gene conversion. Male fertility can also be restored through wild-type gene conversion, making it of significant application value in agricultural production.
[0008] In a first aspect, the molecular marker of the maize male sterility gene zmms2085 provided by the present invention is obtained by primer amplification using nucleotide sequences as shown in SEQ ID NO:1-2.
[0009] In this invention, the maize male sterility gene zmms2085 is the wild-type B73 gene Zm00001eb261800, where two GA bases are inserted after the 1890th base of the 5th exon.
[0010] Secondly, the present invention provides a specific primer set for detecting the maize male sterility gene zmms2085, the specific primer set containing nucleotide sequences as shown in SEQ ID NO: 1-2.
[0011] The primer combination described above in this invention was designed and screened to target the two GA bases inserted after position 1890 of exon 5 in the coding region of the wild-type Zm00001eb261800 gene on chromosome 6. The forward primer 2085_F1 has the nucleotide sequence shown in SEQ ID NO: 1; the reverse primer 2085_R1 has the nucleotide sequence shown in SEQ ID NO: 2. When amplifying the wild-type genome using 2085_F1 and 2085_R1, a 61 bp band is generated; when amplifying the mutant genome, a 63 bp band is generated.
[0012] Thirdly, the present invention seeks protection for reagents or kits containing the above-described specific primer combinations.
[0013] As understood by those skilled in the art, this invention seeks protection for the use of the aforementioned molecular markers, specific primer combinations, reagents, or kits in identifying the genotype of the maize male sterility gene zmms2085.
[0014] And the application of the above-mentioned molecular markers, specific primer combinations, reagents, or kits in screening or cultivating male-sterile maize mutants.
[0015] And the application of the aforementioned molecular markers, specific primer combinations, reagents, or kits in the improvement of maize germplasm resources.
[0016] And the application of the aforementioned molecular markers, specific primer combinations, reagents, or kits in maize breeding.
[0017] This invention provides a method for detecting the genotype of the maize male sterility gene zmms2085 and its presence in a specific maize germplasm resource. First, genomic DNA is extracted from the sample to be tested. Then, PCR is performed using the forward primer shown in SEQ ID NO: 1 and the reverse primer shown in SEQ ID NO: 2. The size of the PCR amplification product is analyzed. If only a 63bp band appears in the amplification product, it indicates that the sample has the homozygous mutant genotype zmms2085; if only a 61bp band appears, it indicates that the sample is the homozygous wild-type genotype ZmMS2085; if both 63bp and 61bp bands appear simultaneously, it indicates that the sample is heterozygous.
[0018] The reference sequence for the 61bp band is shown in SEQ ID NO: 3, and the reference sequence for the 63bp band is shown in SEQ ID NO: 4. Those skilled in the art should understand that, due to differences in maize varieties, the predicted PCR product sequence when designing primers can only serve as a reference sequence. The sequences of products amplified from different varieties may be completely identical to the reference sequence, or they may have some base differences. However, such differences usually do not affect the use of the label.
[0019] Furthermore, the PCR reaction system was as follows: 5 μL of Kangwei Century's 2×Flash PCR MasterMix (Dye), 0.5 μL each of one forward and two reverse primers (10 μM), 50 ng of template DNA, and ddH2O added to 10 μL;
[0020] The PCR reaction conditions were: 94℃ for 2 min; 94℃ for 20 s, 56℃ for 20 s, 72℃ for 30 s, for a total of 35 cycles, followed by 72℃ for 5 min, and finally 16℃ for 1 min.
[0021] In an embodiment of the present invention, the length of PCR amplification products is determined by PAGE gel electrophoresis. The PAGE gel electrophoresis conditions are: 6% PAGE gel, U = 2000V, I = 200mA, P = 85W, electrophoresis for 1 hour.
[0022] Fourthly, the present invention requests protection of a method for detecting the genotype of the maize male fertility regulating gene ZmMS2085, wherein after extracting genomic DNA from the sample to be tested, PCR is performed using the primer combination shown in SEQ ID NO: 1-2, the PCR amplification product is subjected to PAGE gel electrophoresis, and the genotype of ZmMS2085 is determined based on the electrophoretic bands.
[0023] Preferably, if a 61bp band is generated, the ZmMS2085 genotype of the sample to be tested is wild-type; if a 63bp band is generated, the ZmMS2085 genotype of the sample to be tested is wild-type.
[0024] Fifthly, the present invention also claims protection for a method for detecting the male sterility gene zmms2085 in maize. After extracting genomic DNA from the sample to be tested, PCR is performed using the primer combination shown in SEQ ID NO: 1-2. The size of the PCR amplification product is analyzed, and the presence of the male sterility gene zmms2085 in maize is inferred based on the size of the PCR product.
[0025] Preferably, if the PCR amplification product is 63 bp, then the sample to be tested contains the male sterility gene zmms2085.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] This invention is the first to discover a male sterility mutant gene in maize. Specifically, the male sterility mutant gene in maize is characterized by the insertion of two GA bases after the 1890th base of the 5th exon in the coding region of the wild-type B73 Zm00001eb261800 gene.
[0028] This invention designs and develops a molecular marker with a short amplification fragment and high specificity based on the two GA bases inserted after the 1890th base of exon 5 in the coding region of the wild-type B73 Zm00001eb261800 gene. Using this marker, genotyping of the maize male sterility gene zmms2085 can be completed through simple PCR, predicting whether maize is male sterile. This invention has advantages such as simple operation, rapid genotyping, accurate results, and low cost, improving the efficiency of trait selection and meeting the needs of large-scale marker-assisted selection. Attached Figure Description
[0029] Figure 1 This is a schematic diagram of the primer design for the molecular marker in Example 1.
[0030] Figure 2 This is the co-separation verification of the design markers in Example 1.
[0031] Figure 3This is a PAGE gel electrophoresis image of the ZmMS2085 genotype of maize variety / line identified using the molecular markers of this invention, as shown in Example 2. Lanes 1-24 are respectively zmms2085, B104, Chang72, Mo17, Ye478, Zheng58, HuangC, Huangzao4, Dan340, P178, P138, Zong3, Zong31, Jing92, Jing724, Ye107, 8112, 87-1, K12, DH351, Jundan20, Xianyu335, Jingke968, and Chuandan99. The PCR product size is labeled on the right side of the gel image.
[0032] Figure 4 This is the technical roadmap for hybridization and conversion in Example 3. Detailed Implementation
[0033] The following embodiments are provided to facilitate a better understanding of the present invention, but do not limit the scope of its application. All technical and scientific terms used in the following embodiments, unless otherwise specified, have the same meaning as commonly understood by those skilled in the art. Unless otherwise indicated, the techniques used or mentioned in this invention are standard techniques recognized by those skilled in the art. Unless otherwise specified, the test materials are all commonly used in the field of this invention. Unless otherwise specified, the test reagents used in the following embodiments were all purchased from conventional biochemical reagent stores.
[0034] The following description provides a more detailed account, but it is not intended to limit the scope of the invention.
[0035] Example 1: Primer design and amplification fragment analysis of the maize male sterility gene zmms2085
[0036] 1. Primer design
[0037] Primer combinations designed to distinguish between recessive nuclear male sterility phenotype and normal fertility phenotype were based on the sequence differences between wild-type B73's ZmMs1 and the mutant zmms2085: 2085_F1: AGGCTTCACACAATTCATCCC (SEQ ID NO:1) and 2085_R1: TTCTCCGTGGTACTTGCTTCGT (SEQ ID NO:2). Figure 1 ).
[0038] 2. Amplified Fragment Analysis
[0039] The recessive nuclear male sterility gene zmms2085 in maize was amplified using the above primer combination. The sterile material only amplified a single 63bp band, while the fertile material amplified a single 61bp band, or simultaneously amplified a 61bp and a 63bp band. Figure 2The nucleotide sequences of the 63bp and 61bp bands are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.
[0040] Example 2: Molecular marker identification of the ZmMS2085 genotype in maize varieties / lines
[0041] 1. Experimental materials
[0042] zmms2085, B104, Chang72, Mo17, Ye478, Zheng58, HuangC, Huangzao4, Dan340, P178, P138, Zong3, Zong31, Jing92, Jing724, Ye107, 8112, 87-1, K12, DH351, Jundan20, Xianyu335, Jingke968, Chuandan99.
[0043] 2. Extraction of maize genomic DNA
[0044] Genomic DNA was extracted from maize using the CTAB method. The specific steps are as follows: During the seedling stage, 3 cm long maize leaves were collected and ground in 800 μL of extraction buffer [1.5% (w / v) CTAB, 1.05 mol / L NaCl, 75 mmol / L Tris-HCl (pH 8.0), 15 mmol / L EDTA (pH 8.0)]. The mixture was collected in a 1.5 mL centrifuge tube. The tube was incubated at 65°C for 30 min, with occasional inversion mixing. 800 μL of chloroform:isoamyl alcohol (24:1 v / v) was added, and the mixture was inverted for 15 min. The tube was centrifuged at 12000 rpm for 10 min at room temperature. 450 μL of the supernatant was aspirated and transferred to a new 1.5 mL centrifuge tube. Two volumes of 95% ethanol were added, and the mixture was mixed. The tube was then precipitated at -20°C for 30 min. The tube was centrifuged at 12000 rpm for 15 min. The 95% ethanol was discarded, and the precipitate was washed with 75% ethanol. Discard the 75% ethanol, dry the product, and then add 100 μL of sterile ddH2O to dissolve the DNA.
[0045] 3. PCR amplification and detection
[0046] The DNA of the 24 maize varieties / lines described in this example was amplified by PCR using the specific primer combination (2085_F1, 2085_R1) obtained by screening in Example 1. The PCR reaction system was as follows: 5 μL of Kangwei Century 2×Flash PCRMasterMix (Dye), 0.5 μL each of one forward and two reverse primers of 10 μM, 50 ng of template DNA, and ddH2O added to 10 μL.
[0047] The PCR reaction conditions were: 94℃ for 2 min; 94℃ for 20 s, 56℃ for 20 s, 72℃ for 30 s, for a total of 35 cycles, followed by 72℃ for 5 min, and finally 16℃ for 1 min.
[0048] The amplified products were detected by 6% PAGE gel electrophoresis under the following conditions: U = 2000V, I = 200mA, P = 85W, for 1 hour. After electrophoresis, the gel was stained with 0.1% AgNO3 and observed and photographed under a viewing lamp.
[0049] 4. Results and Analysis
[0050] Using the primer combination of the molecular markers from Example 1 of this invention to amplify these 24 varieties / lines, it was found that only zmms2085 amplified a 63bp band, while all other varieties / lines only amplified a 61bp band (see Example 1). Figure 3 This result indicates that no maize germplasm exhibits the same variation as the recessive male-sterile line 2085 under natural conditions, and also confirms the accuracy and reliability of the molecular markers of this invention in identifying the genotype of the maize male-sterile gene zmms2085.
[0051] Example 3: Transplanting maize with the ZmMS2085 gene
[0052] The zmms2085 mutant was crossed, backcrossed, and self-crossed with the male-fertile recipient variety B104. Molecular markers were used for selection based on the ZmMS2085 gene and genetic background during this process, ultimately obtaining a male-sterile line carrying the homozygous ZmMS2085 mutant gene in the recipient background. Figure 4 The specific implementation steps are as follows:
[0053] 1. The F1 generation is obtained by crossing the recipient parent, such as B104, as the male parent with zmms2085.
[0054] 2. Use F1 as the female parent and the recipient parent, such as B104, to backcross and obtain BC1F1.
[0055] 3. Plant BC1F1 seedlings and use the SEQ ID NO:1 (2085_F1) and SEQ ID NO:2 (2085_R1) to detect the ZmMS2085 genotype. Select plants with the ZmMS2085 heterozygous genotype, i.e., those that can simultaneously amplify 61bp and 63bp bands.
[0056] 4. Using a set of molecular markers (such as 100 or 200, etc.) that are polymorphic between the ZmMS2085 mutant and the recurrent parent genome and are evenly distributed (can be, but not limited to, SSR, SNP, INDEL, EST, RFLP, AFLP, RAPD, SCAR, etc.), the genetic background of the single plants selected in step 3 is identified, and plants with high genotype similarity to the recurrent parent (such as greater than 88% similarity, or 2% selection rate, etc.) are selected.
[0057] 5. Use the plants selected in step 4 and the recipient parent, such as B104, to backcross and obtain BC2F1.
[0058] 6. Plant BC2F1, repeat steps 3 and 4, select plants with ZmMS2085 genotype heterozygotes and high genetic background recovery rate (e.g., greater than 98%, or 2% selection rate), and harvest them from crossbred BC2F2.
[0059] 7. Plant BC2F2, repeat steps 3 and 4, and select the ZmMS2085 heterozygous plants with the highest genetic background homozygosity. Harvest these plants from the cross BC2F3. The ZmMS2085 heterozygous plants that segregate from the BC2F3 progeny are the ZmMS2085 recessive male sterile line. BC2F3 is used to preserve the germplasm resources of the ZmMS2085 recessive nuclear male sterile line.
[0060] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. Application of specific primer combinations in marker-assisted breeding of male sterility in maize; Its features are, The specific primer combination is a nucleotide sequence as shown in SEQ ID NO: 1-2; When the target maize DNA is amplified using the above primer combination, the material that can only produce a 63bp band is sterile, the material that can produce a 61bp band, or both a 61bp and a 63bp band, is fertile. The nucleotide sequence of the 61bp band is shown in SEQ ID NO: 3, and the nucleotide sequence of the 63bp band is shown in SEQ ID NO: 4.
Citation Information
Patent Citations
A PCR molecular marker method for identifying allelic variation of rice grain length gene qgl3
CN103882145B