Primers and method for identifying seed purity of chinese cabbage for spring planting

Abstract

The application discloses a primer and a method for identifying seed purity of Chinese cabbage for spring seedling, and belongs to the technical field of biology. The primer can be applied to identification of hybrid purity of Chinese cabbage for spring seedling, so that the problems of long period, heavy workload, great influence of environmental factors, great influence of experience factors and the like caused by direct field observation method for seed purity in the prior art are overcome, the seed purity of the hybrid of Chinese cabbage for spring seedling can be quickly and accurately identified within 1-2 hours, the method has the advantages of rapidness, stability, no influence of environment and the like, is favorable for efficient and accurate quality control of the Chinese cabbage seed for spring seedling, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer and method for identifying the purity of Chinese cabbage seeds for Chunfu seedling cultivation. Background Technology

[0002] Seedling Chinese cabbage, also known as non-heading Chinese cabbage, is a common leafy green vegetable belonging to the Brassica genus of the Brassicaceae family. The edible parts are the stems and leaves, which are rich in protein, minerals, fiber, various vitamins, and carbohydrates. It has benefits such as promoting metabolism, anti-aging, aiding digestion, and regulating bowel movements. The optimal growing temperature for seedling Chinese cabbage is 16-20℃. While it prefers cool temperatures, it also exhibits good heat tolerance. Due to its short growth cycle, small plant size, high yield, and high demand, it is widely cultivated in most parts of my country and is one of the most common vegetable crops in the south. Currently, seedling Chinese cabbage is mostly produced using self-incompatible lines. However, due to various reasons such as low self-incompatibility, incomplete removal of hybrid plants, and insufficient seed production intervals, the resulting seeds may contain a certain amount of non-varietal hybrids or self-pollinated seeds. This leads to a decrease in seed purity, affecting the quality, yield, and marketability of the seedling Chinese cabbage, and may even result in the seed batch failing to meet purity standards and losing its commercial value.

[0003] Seed purity is a crucial indicator of seed quality, and rapid and accurate identification of seed purity is of paramount importance to seed producers, sellers, and buyers. Traditional seed purity assessments are conducted in the field, requiring observation of one or more traits at certain stages of crop growth to determine seed purity. This method suffers from drawbacks such as long testing periods, high workload, and susceptibility to environmental and empirical influences. In recent years, with the development of biotechnology, molecular markers based on DNA polymorphism have become powerful tools for analyzing genetic diversity. Due to their advantages such as short testing cycles, high accuracy, good stability, and immunity to external factors, they have gradually become the preferred method for seed purity assessment and variety authenticity verification.

[0004] Chunfu seedling Chinese cabbage is a new variety independently bred by Wuxi Puwei Agricultural Technology Co., Ltd. It features rapid growth, large leaf spread, round and thick leaves, short petioles, hairless leaves, yellowish-green leaves with few fibers, and a plant height of approximately 20cm. It can be harvested 25-30 days after emergence, and is crisp and refreshing with strong disease resistance and heat tolerance. Previously, seed purity was tested by direct field observation of growth traits. However, with the increase in planting area and seed demand, a rapid testing method is needed to determine the seed purity of this variety. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides primers and a method for identifying the purity of Chunfu Miao Chinese cabbage seeds. This overcomes the problems of long cycles, heavy workload, and susceptibility to environmental and empirical factors in existing methods for identifying seed purity through direct field observation. The invention enables rapid and accurate identification of the purity of Chunfu Miao Chinese cabbage hybrid seeds within 1-2 hours, and has broad application prospects.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A primer for identifying the purity of Chinese cabbage seeds for Chunfu seedling cultivation, comprising an upstream primer. SSR57-F and downstream primer SSR57-R, wherein, The upstream primer SSR57-F is: GGGCGAAAGAACTTGCAGAG; The downstream primer SSR57-R is: AGCACCAGCAAGACTTGTGA.

[0007] A method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings, comprising: (1) Extract genomic DNA from the sample of Chinese cabbage used for seedling cultivation in Chunfu; (2) Perform PCR amplification using the primers described above; (3) The amplification products from step (2) were separated by electrophoresis using an 8% polyacrylamide gel and stained with silver. (4) Statistical results: The purity of Chinese cabbage seeds for Chunfu seedlings was calculated as follows: Seed purity (%) = (Total number of seeds tested - Number of non-hybrid seeds - Number of foreign hybrid seeds) / Total number of seeds tested × 100%; The step (2) described above uses a 10µl reaction system: 5µl of 2×Taq Master Mix, 0.5µl each of 10µM upstream and downstream primers, 1.5µl of genomic DNA, and 2.5µl of 0.1µM Tris-HCl at pH=8.0; The PCR reaction procedure uses a touch-down approach and consists of six stages: First stage: Pre-denaturation at 95℃ for 5 minutes; Second stage: denaturation at 94℃ for 45 seconds; annealing at 68-58℃ for 6 cycles, decreasing by 2℃ for 1 minute each cycle; extension at 72℃ for 1 minute. Third stage: denaturation at 94℃ for 30 seconds; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ for 1 minute each cycle; extension at 72℃ for 1 minute. Fourth stage: denaturation at 94℃ for 30 seconds; annealing at 50℃ for 30 seconds; extension at 72℃ for 1 minute; repeat this stage 20 times. Fifth stage: Extend at 72℃ for 7 minutes; Stage 6: Keep warm at 4℃.

[0008] In the above method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings, step (1) is as follows: Take the hypocotyl and place it in a 2ml centrifuge tube; add a steel ball with a diameter of 3mm and 300µl of DNA extraction solution; place it on a grinder and grind it at a frequency of 50Hz for 15s; centrifuge at 10000rpm for 1min and take it out for later use.

[0009] In the above method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings, step (3) involves using an 8% polyacrylamide gel to detect the amplification product by electrophoresis: 1.5 µl of amplification product is added to each well, and electrophoresis is performed. Electrophoresis is stopped when the electrophoresis indicator is 2 cm from the bottom of the gel. The gel is carefully removed, and 1000 ml of staining solution containing 1.2 g AgNO3 is poured in. The gel is then placed on a shaker and stained for 3 min. The staining solution is poured out, a small amount of distilled water is added for quick rinsing, and then a color developing solution is added for color development. The color developing solution consists of 15 g NaOH and 15 ml formaldehyde, and the volume is adjusted to 1000 ml. The solution is stained until bands appear. The product is then rinsed with distilled water.

[0010] In the above method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings, in step (4), the purity of Chinese cabbage seeds for Chunfu seedlings is calculated. The gel obtained in step (3) is placed on a white light box, and the results are photographed and statistically analyzed. Seeds with both parental and parental banding patterns are hybrids, seeds with either parental or parental banding patterns are non-hybrids, and seeds with other banding patterns are foreign hybrids.

[0011] The above technical solution has the following advantages or beneficial effects: This invention provides primers and a method for identifying the purity of Chunfu seedling Chinese cabbage seeds. By using primers applicable to the purity identification of Chunfu seedling Chinese cabbage hybrids, it overcomes the problems of long cycle, large workload, and great influence from environmental and empirical factors caused by the direct field observation method for seed purity identification in existing technologies. Thus, it can quickly and accurately identify the seed purity of Chunfu seedling Chinese cabbage hybrids within 1-2 hours. It has the advantages of being fast, stable, and unaffected by the environment, which is conducive to the efficient and accurate quality control of Chunfu seedling Chinese cabbage seeds and has broad application prospects. Attached Figure Description

[0012] Figure 1 This is an electrophoresis image of the SSR57 amplification products of Chunfu Chinese cabbage hybrid and parental lines provided in Example 1 of the present invention. Detailed Implementation

[0013] The present invention will be further described below with reference to specific embodiments, but these are not intended to limit the invention. The male and female parents of Chunfu seedling-grown Chinese cabbage can be obtained from the Chinese cabbage research group of Wuxi Puwei Agricultural Technology Co., Ltd., and Chunfu seedling-grown Chinese cabbage hybrids are commercially available.

[0014] Example 1:

[0015] I. Materials Ten seeds each of the parent Chinese cabbage of Chunfu seedlings and 100 randomly selected Chunfu Chinese cabbage hybrid seeds harvested from the seed production base were placed in germination boxes at a constant temperature of 26℃ and sampled after the cotyledons were fully expanded.

[0016] II. Primer Screening First, DNA was extracted from one single plant from each parent parent. 192 pairs of SSR primers were screened to select markers with differences. Then, 48 single plants of hybrids were used to verify the differential markers. SSR57 was selected as having obvious differences and being easy to interpret, and can be used for hybrid purity identification.

[0017] SSR57 consists of upstream primer SSR57-F and downstream primer SSR57-R, wherein The upstream primer SSR-F is: GGGCGAAAGAACTTGCAGAG; The downstream primer SSR-R is: AGCACCAGCAAGACTTGTGA.

[0018] III. Extraction of Genomic DNA Remove the hypocotyl and place it in a 2ml centrifuge tube; add a 3mm diameter steel ball and 300µl of DNA extraction buffer; place it on a grinder and grind at 50Hz for 15s; centrifuge at 10000rpm for 1min, and remove for later use.

[0019] IV. PCR Amplification and Detection Reaction system: 5µl of 2×Taq Master Mix, 0.5µl each of 10µM / 5µl forward and reverse primers, 1.5µl of genomic DNA, and 2.5µl of 0.1µM / 5µl Tris-HCl at pH=8.0.

[0020] The PCR reaction program used a touch-down approach and consisted of six stages: Stage 1: 95℃ pre-denaturation for 5 min. Stage 2: 94℃ denaturation for 45 s; annealing at 68-58℃ for 6 cycles, decreasing the temperature by 2℃ for 1 min each cycle; extension at 72℃ for 1 min. Stage 3: 94℃ denaturation for 30 s; annealing at 58-50℃ for 8 cycles, decreasing the temperature by 1℃ for 1 min each cycle; extension at 72℃ for 1 min. Stage 4: 94℃ denaturation for 30 s; annealing at 50℃ for 30 s; extension at 72℃ for 1 min; repeat this stage 20 times. Stage 5: Extension at 72℃ for 7 min. Stage 6: Incubation at 4℃.

[0021] Detection of amplification products: Add 1.5 µl of amplification product to each well and perform electrophoresis. Stop electrophoresis when the electrophoresis indicator is 2 cm from the bottom of the gel. Carefully remove the gel and pour in 1000 ml of staining solution containing 1.2 g AgNO3. Stain on a shaker for 3 min. Pour out the staining solution, add a small amount of distilled water for quick rinsing, and then pour in the developing solution (15 g NaOH, 15 ml formaldehyde, diluted to 1000 ml). Stain until bands appear. Rinse with distilled water.

[0022] V. Seed Purity Identification PCR testing was performed on hybrid seeds harvested from the seed production base using SSR57, and the results are shown below. Figure 1 The image clearly shows that SSR57 can clearly amplify both male-specific and female-specific bands. The hybrid exhibits both parental band types, and the results indicate that the purity of this batch of seeds is 92%.

[0023] Those skilled in the art should understand that variations can be implemented by combining existing technology and the above embodiments, and will not be elaborated here. Such variations do not affect the essence of the present invention, and will not be elaborated here.

[0024] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and any not described in detail should be understood as being implemented in a manner common to the art; any possible variations and modifications made by those skilled in the art without departing from the technical solution of the present invention, or equivalent embodiments with equivalent changes, do not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A method for identifying the purity of Chinese cabbage seeds for Chunfu seedling cultivation, characterized in that, include: (1) Extract genomic DNA from the seeds of Chinese cabbage used for seedling cultivation in Chunfu seedlings; (2) PCR amplification was performed using primer pairs, wherein the primer pairs included upstream primer SSR57-F and downstream primer SSR57-R, wherein, The upstream primer SSR57-F is: GGGCGAAAGAACTTGCAGAG; The downstream primer SSR57-R is: AGCACCAGCAAGACTTGTGA; (3) The amplification products from step (2) were separated by electrophoresis using an 8% polyacrylamide gel and stained with silver. (4) Statistical results: The purity of Chinese cabbage seeds for Chunfu seedlings was calculated as follows: Seed purity (%) = (Total number of seeds tested - Number of non-hybrid seeds - Number of foreign hybrid seeds) / Total number of seeds tested × 100%; Step (2) uses a 10µl reaction system: 5µl of 2×Taq Master Mix, 0.5µl each of 10µM upstream and downstream primers, 1.5µl of genomic DNA, and 2.5µl of 0.1µM Tris-HCl at pH=8.0; The PCR reaction procedure uses a touch-down approach and consists of six stages: First stage: Pre-denaturation at 95℃ for 5 minutes; Second stage: denaturation at 94℃ for 45 seconds; annealing at 68-58℃ for 6 cycles, decreasing by 2℃ for 1 minute each cycle; extension at 72℃ for 1 minute. Third stage: denaturation at 94℃ for 30 seconds; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ for 1 minute each cycle; extension at 72℃ for 1 minute. Fourth stage: denaturation at 94℃ for 30 seconds; annealing at 50℃ for 30 seconds; extension at 72℃ for 1 minute; repeat this stage 20 times. Fifth stage: Extend at 72℃ for 7 minutes; Stage 6: Insulate at 4℃; In step (4), the purity of Chinese cabbage seeds for Chunfu seedlings is calculated. The gel obtained in step (3) is placed on a white light box, and the results are photographed and statistically analyzed. Seeds with both parental bands are hybrids, seeds with only parental or maternal bands are non-hybrids, and seeds with other bands are foreign hybrids.

2. The method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings as described in claim 1, characterized in that, Step (1) is as follows: Remove the hypocotyl and place it in a 2ml centrifuge tube; add a 3mm diameter steel ball and 300µl DNA extraction solution; place it on a grinder and grind at a frequency of 50Hz for 15s; centrifuge at 10000rpm for 1min and take it out for later use.

3. The method for identifying the purity of Chinese cabbage seeds for Chunfu seedlings as described in claim 1, characterized in that, Step (3) Electrophoresis detection of amplification products using 8% polyacrylamide gel: Add 1.5µl of amplification product to each well and perform electrophoresis. Stop electrophoresis when the electrophoresis indicator is 2cm from the bottom of the gel. Carefully remove the gel and pour in 1000ml of staining solution containing 1.2g AgNO3. Place it on a shaker for staining for 3min. Pour out the staining solution, add a small amount of distilled water to rinse quickly, and then pour in the color developing solution for color development. The color developing solution consists of 15g NaOH and 15ml formaldehyde, and the volume is adjusted to 1000ml. Stain until bands appear. Rinse with distilled water.

Images