A chrysosporium strain and a method for preparing a compound having insecticidal activity by fermenting the same

Abstract

The application provides a Chrysosporium sp. strain, which is preserved in the China General Microbiological Culture Collection Center (CGMCC) and has a preservation number of CGMCC NO.40210. The strain is subjected to solid fermentation, and a compound with excellent insecticidal activity can be prepared by extracting, separating and purifying the fermentation product; the preparation steps are simple, the implementation is convenient, the large-scale industrial production is easy, and the application prospect is wide.

Description

Technical Field

[0001] This invention relates to a strain of Aureobasidium and a method for preparing insecticidal compounds by fermentation. Background Technology

[0002] Pests and diseases have always been a significant factor affecting my country's food security. Currently, the main methods for pest and disease control are chemical and biological control. Chemical control primarily relies on synthetic pesticides such as neurotoxic insecticides, insect growth regulators, and oxidative phosphorylation insecticides. While existing synthetic pesticides offer advantages such as broad spectrum of activity, rapid effect, strong emergency response, and low price, they also pose serious problems including environmental pollution, pesticide residues, easy development of resistance, poor selectivity, and severe ecological damage. Biopesticides, on the other hand, are environmentally friendly, highly efficient, low-toxicity, and biodegradable, and their gradual replacement of synthetic pesticides is an inevitable direction for modern pesticide development. Microbial bioactive substances have always played a crucial role in the research and development of novel biopesticides. Currently, pesticides developed directly or as lead-type products of microbial secondary metabolites include abamectin, spinosad, emamectin benzoate, lingnanmycin, S-inducer, milpimethanil, and bromonitrile. However, most of these biopesticides also target vertebrates, thus posing certain risks and hazards to humans. Therefore, the search for green, safe, and highly effective insecticidal compounds is of practical and scientific significance for the development and application of novel biological pesticides.

[0003] Chrysosporium is a genus of fungi in the class Hylocereus. There are 22 species of Chrysosporium, with rapid colony growth and diverse morphologies, appearing waxy, fluffy, or powdery. Currently, there are reports of some cases caused by Chrysosporium infection (Jing Dongyun, Wang Xuejun, Wang Ling. A case of toe infection caused by Chrysosporium [J]. Chinese Journal of Dermatology and Venereology, 2018, 32(12):1411-1412.DOI:10.13735 / j.cjdv.1001-7089.201708031.); there is also a Chinese patent application (publication number CN1237207A) that discloses a method for obtaining a neutral / alkaline cellulase composition from cultures of Chrysosporium, especially Chrysosporium lucknowense. However, there are currently no reports on the study of insecticidal active substances in the fermentation products of Chrysosporium. Summary of the Invention

[0004] The purpose of this invention is to provide a new strain of *Aureobasidium* and a method for isolating insecticidal compounds from the fermentation products of this strain.

[0005] This invention provides a Chrysosporium sp. strain, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.40210.

[0006] The present invention also provides the use of the above-mentioned *Aureobasidium* strain and / or its fermentation products in reagents for preparing compounds of Formula I, or pharmaceutically acceptable salts thereof, or solvates thereof:

[0007]

[0008] in,

[0009] R1 and R2 are each independently selected from hydrogen or hydroxyl groups.

[0010] R3 is selected from hydrogen or halogen.

[0011] R4 is selected from methyl or hydroxymethyl.

[0012] Furthermore, the aforementioned halogen is chlorine.

[0013] The present invention also provides a method for preparing the compound of Formula I, or a pharmaceutically acceptable salt thereof, or a solvate thereof, comprising the step of fermenting with a strain of Aureobasidium to obtain a fermentation product;

[0014]

[0015] in,

[0016] R1 and R2 are each independently selected from hydrogen or hydroxyl groups.

[0017] R3 is selected from hydrogen or halogen.

[0018] R4 is selected from methyl or hydroxymethyl.

[0019] Furthermore, the aforementioned halogen is chlorine.

[0020] Furthermore, the above-mentioned compound is any one of the following:

[0021]

[0022] The present invention also provides a method for preparing the above-mentioned compound, comprising the step of fermenting and culturing the *Aureobasidium* strain according to claim 1 to obtain the fermentation product.

[0023] Furthermore, the above preparation method includes the following steps:

[0024] (1) Inoculate the strain of Aureobasidium into the fermentation medium and culture to obtain the fermentation product;

[0025] (2) Add ethyl acetate to the fermentation product obtained in step (1), mix and extract, and filter to obtain the extract;

[0026] (3) The extract obtained in step (2) is concentrated under reduced pressure to obtain crude extract;

[0027] (4) The crude extract obtained in step (3) is subjected to silica gel column chromatography. The eluent is composed of petroleum ether and ethyl acetate. The eluent is eluted in a gradient manner according to the volume ratio of petroleum ether to ethyl acetate of 15:1, 10:1, 5:1, 3:1, 1:1 and 0:1. The eluent A with a volume ratio of petroleum ether to ethyl acetate of 1:1 and / or the eluent B with a volume ratio of 0:1 are collected.

[0028] Furthermore, the fermentation medium in step (1) consists of the following components in parts by weight: 85-95 parts rice, 0.1-0.5 parts peptone; and / or the culture conditions are constant temperature static culture at 25°C for 20-30 days;

[0029] Preferably, the fermentation medium consists of the following components in parts by weight: 90 parts rice, 0.3 parts peptone; and / or the culture conditions are constant temperature static culture at 25°C for 25 days.

[0030] Further, the extraction conditions in step (2) are 55-65℃ for 3-5 hours and the number of extractions is 1-3 times; preferably, the extraction conditions are 60℃ for 4 hours and the number of extractions is 3 times.

[0031] Furthermore, step (4) also includes the step of separating and purifying eluent A and / or eluent B to obtain the compound;

[0032] The separation and purification steps of the above eluent A are as follows: after eluent A is concentrated, it is used as a mobile phase with a mixture of dichloroethane and methanol in equal volume ratio to obtain 6 components A1-A6 by column chromatography. A3 and / or A4 are prepared by semi-preparative liquid chromatography to obtain the compound. Preferably, the column chromatography is Sephadex LH-20 column chromatography.

[0033] The separation and purification steps of the above eluent B are as follows: the compound is prepared by semi-preparative liquid chromatography using eluent B.

[0034] Furthermore, compound 3 was prepared from A3 by semi-preparative liquid chromatography under the following conditions: isocratic elution with 74% v / v methanol-water and retention time of 44–45 min.

[0035] And / or the A4 was prepared by semi-preparative liquid chromatography to obtain compound 1, under the following conditions: isocratic elution with 50% acetonitrile-water, retention time 36-37 min;

[0036] And / or the A4 was prepared by semi-preparative liquid chromatography to obtain compound 2, under the following conditions: isocratic elution with 50% acetonitrile-water, retention time 46-47 min;

[0037] And / or the eluent B was used to prepare compound 4 by semi-preparative liquid chromatography under the following conditions: isocratic elution with 40% acetonitrile-water and retention time of 27-28 min;

[0038] Compound 5 was prepared by semi-preparative liquid chromatography using eluent B and / or by 40% acetonitrile-water isocratic elution for a retention time of 58–59 min.

[0039] The beneficial effects of the present invention are as follows: (1) The strain of *Aureobasidium* of the present invention can ferment to produce a new compound, which has stable properties and significant insecticidal activity.

[0040] (2) The compound of the present invention is produced by solid-state fermentation of fungi. It can be obtained by extracting the fermentation product with ethyl acetate and then separating and purifying it by silica gel column chromatography and high performance liquid chromatography. The separation steps are simple, convenient to implement, easy to industrialize and produce on a large scale, and have broad application prospects.

[0041] Preservation of biological materials:

[0042] The strain Chrysosporium sp. used in this invention was deposited on June 13, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China), with the collection number CGMCC NO.40210.

[0043] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0044] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0045] Figure 1 Compound 1 of the present invention 1 H NMR spectrum.

[0046] Figure 2 Compound 1 of the present invention 13 C NMR spectrum.

[0047] Figure 3This is a high-resolution mass spectrum of compound 1 of the present invention.

[0048] Figure 4 Compound 2 of the present invention 1 H NMR spectrum.

[0049] Figure 5 Compound 2 of the present invention 13 C NMR spectrum.

[0050] Figure 6 This is a high-resolution mass spectrum of compound 2 of the present invention.

[0051] Figure 7 Compound 3 of the present invention 1 H NMR spectrum.

[0052] Figure 8 Compound 3 of the present invention 13 C NMR spectrum.

[0053] Figure 9 This is the high-resolution mass spectrum of compound 3 of the present invention.

[0054] Figure 10 Compound 4 of the present invention 1 H NMR spectrum.

[0055] Figure 11 Compound 4 of the present invention 13 C NMR spectrum.

[0056] Figure 12 This is a high-resolution mass spectrum of compound 4 of the present invention.

[0057] Figure 13 Compound 5 of the present invention 1 H NMR spectrum.

[0058] Figure 14 Compound 5 of the present invention 13 C NMR spectrum.

[0059] Figure 15 This is a high-resolution mass spectrum of compound 5 of the present invention. Detailed Implementation

[0060] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0061] The strain Chrysosporium sp. used in this invention is a Chrysosporium species deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.40210.

[0062] Example 1: Identification of the Chrysosporium sp. strain of the present invention

[0063] The strain Chrysosporium sp. of this invention was isolated from Pixian broad bean paste. It was transferred onto PDA slant medium at 4°C and stored in a refrigerator. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.40210.

[0064] Based on the DNA sequence of the internal transcribed spacer (ITS) (SEQ ID NO.1):

[0065] GTACCTGCGGAAGGATCATTACAGTGCCCCCGCGGCAGGCCCGCGTCTCCCGCCCCGAAAGGGGTGTGTTTCGATGGCCGCTGCCGCAACCGGCCCCACACTTGTCTACCTAACCTGTTGCCTCGGCGAGCCCGCCCCCCGCCCCCCCTAAAACAGGGGGCGAGGGGC CGCCGGAGGAGGGGAAGCCGCCCCGGCTCCCTCGCTTCTGGCCCGCGCTCGCCGGAGGACCAAATCAAAAAACCTGATAATTTAGTGACGTCTGAGTGAGAAATTACGAATAAATCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC GAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCCCGGCTTGTGTTTTGGGCGGCCGTCCCGCGTGGACGCGCCCCAATGG CAGTGACGGCAGCCGCGACTCCGGCGCCCGAGTGAATGGAGGTAAAAAAACCACCGCTCGTAGGCGCAGGCCGGCTCCGGTCTTCTTTAACTAGAACGGGGAGTAAGATCCCCAATCGGTTGACCTCGGATCAGGTAGGGATACCCGACTGAACTTAAGCATATCAA

[0066] NCBI BLAST analysis identified the strain as *Chrysosporium* sp. The sequence homology with known strains was less than 100%, confirming that the strain of this invention is a novel *Chrysosporium* sp. strain.

[0067] Example 2: Preparation of the compound of the present invention

[0068] I. Fermentation of Microbial Strains

[0069] 1. Inoculate the strain Chrysosporium sp. onto PDA medium slant and culture at 25°C in the dark for 7 days to obtain slant seed culture.

[0070] 2. Inoculate the slanted seeds into an Erlenmeyer flask containing fermentation medium and incubate at a constant temperature of 25°C for 25 days.

[0071] Preparation method of fermentation medium: Take 90g of rice, soak it in water for 24h, filter out the water with gauze, put it into a 500mL Erlenmeyer flask, add 0.3g of peptone, mix well, and sterilize (121℃, 30min).

[0072] II. Extraction, Separation and Purification of the Compounds of this Invention

[0073] (1) Add 300 mL of ethyl acetate to the fermented Erlenmeyer flask, heat in a water bath at 60 °C for 4 h, and filter to obtain the extract. Extract three times, combine the filtrates, and concentrate under vacuum to obtain the extract.

[0074] (2) The total extract was mixed with silica gel at a 1:1 ratio and then dry-loaded for silica gel column chromatography (using 200-300 mesh silica gel). Gradient elution was performed using petroleum ether and ethyl acetate at volume ratios of 15:1, 10:1, 5:1, 3:1, 1:1, and 0:1. Eluent A (1:1) and eluent B (0:1) were collected. Eluent A was concentrated and then subjected to Sephadex LH-20 column chromatography (dichloroethane:methanol = 1:1, v / v) to obtain six fractions, A1-A6. Compound 3 was prepared from A3 by semi-preparative liquid chromatography (30 mL / min, 74% methanol-water, v / v, 44.4 min). Compound 1 was prepared from A4 by semi-preparative liquid chromatography (30 mL / min, 50% acetonitrile-water, v / v, 36.4 min); compound 2 was prepared from A4 by semi-preparative liquid chromatography (30 mL / min, 50% acetonitrile-water, v / v, 46.2 min). Compound 4 was prepared from eluent B by semi-preparative liquid chromatography (10 mL / min, 40% acetonitrile-water, v / v, 27.2 min); compound 5 was prepared from eluent B by semi-preparative liquid chromatography (10 mL / min, 40% acetonitrile-water, v / v, 58.1 min).

[0075] 1. Compound 1

[0076] HRESIMS:m / z 583.2554[M+H] + ; 1 H NMR (400MHz, DMSO-d6): δ H4.14(1H,s,H-3),6.81(1H,s,H-4),6.66(1H,dd,6.8,2.1,H-6),6.79(1H,d,6.4,H-7),3.04(1H,q,7.4,H-11),1.19(3H,d,7 .5,H-12),1.63(3H,s,H-13,overlap),0.91(3H,s,H-14),7.37(1H,s,H-1'),5.91(1H,d,8.2,H-4'),5.67(1H,d,8.2,H-5'), 7.39(1H,d,4,H-8'),7.11(1H,m,H-9',overlap),7.11(1H,m,H-10',overlap),7.57(1H,m,H-11'),1.56(3H,s,H-13'),1.64 (3H,s,H-14',overlap),3.70(3H,s,3-OMe),6.44(1H,s,2-OH),5.20(1H,s,3a-OH),9.22(1H,s,5-OH),11.43(1H,s,7'-NH). 13 C NMR (150MHz, DMSO-d6): δ C 85.5(C-2),82.6(C-3),85.0(C-3a),137.9(C-3b),115.3(C-4),147.8(C-5),115.2(C-6),123.6(C-7),141.3(C-7a ),93.6(C-8a),164.1(C-9),62.4(C-10),41.5(C-11),10.9(C-12),23.8(C-13),25.6(C-14),113.5(C-1'),126.3(C -2'), 139.3(C-4'), 122.1(C-5'), 36.1(C-6'), 147.8(C-6a'), 134.1(C-7a'), 111.9(C-8'), 121.7(C-9'), 120.6(C-10'), 116.5(C-11'), 129.6(C-11a'), 104.4(C-11b'), 162.1(C-12'), 27.9(C-13'), 27.2(C-14'), 59.8(3-OMe). The spectrum is as follows: Figures 1-3 As shown.

[0077] The molecular formula of compound 1 is determined to be C13. 33 H 34 N4O6 has the following structure:

[0078]

[0079] 2. Compound 2

[0080] HRESIMS: m / z 616.2166 [M+H] + and 619.2152 [M+2+H] + ; 1 ¹H NMR (400 MHz, DMSO-d₆): δ H 4.17 (1H, s, H-3), 6.84 (1H, s, H-4), 6.69 (1H, d, 7.1, H-6), 6.83 (1H, d, 6.7, H-7), 3.07 (1H, q, 7.9, H-11), 1.22 (3H, d, 7.6, H-12), 1.66 (3H, s, H-13, overlap), 0.94 (3H, s, H-14), 7.33 (1H, s, H-1), 5.95 (1H, d, 8.2, H-4'), 5.72 (1H, d, 8.2, H-5'), 7.42 (1H, s, H-8'), 7.14 (1H, d, 8.6, H-10'), 7.62 (1H, d, 8.6, H-11'), 1.58 (3H, s, H-13'), 1.67 (3H, s, H-14', overlap), 3.72 (3H, s, 3-OMe), 6.51 (1H, s, 2-OH), 5.23 (1H, s, 3a-OH), 9.25 (1H, s, 5-OH), 11.61 (1H, s, 7'-NH). 13 ¹³C NMR (150 MHz, DMSO-d₆): δ C 85.8 (C-2), 82.6 (C-3), 85.0 (C-3a), 137.9 (C-3b), 115.3 (C-4), 147.8 (C-5), 115.2 (C-6), 123.6 (C-7), 141.3 (C-7a), 93.6 (C-8a), 164.1 (C-9), 62.4 (C-10), 40.7 (C-11), 10.9 (C-12), 23.8 (C-13), 25.6 (C-14), 112.8 (C-1'), 127.0 (C-2'), 139.2 (C-4'), 122.4 (C-5'), 36.1 (C-6'), 148.6 (C-6a'), 134.4 (C-7a'), 111.4 (C-8'), 126.1 (C-9'), 120.9 (C-10'), 118.2 (C-11'), 128.4 (C-11a'), 104.6 (C-11b'), 162.0 (C-12'), 27.8 (C-13'), 27.0 (C-14'), 59.8 (3-OMe). The spectrum is as shown in Figures 4-6As shown.

[0081] The molecular formula of compound 1 is determined to be C13. 33 H 33 N4O6Cl has the following structure:

[0082]

[0083] 3. Compound 3

[0084] HRESIMS:m / z 617.2110[M+H] + And 619.2276[M+2+H] + ; 1 H NMR (400MHz, Methanol-d4): δ H 4.27(1H,s,H-3),6.98(1H,d,7.5,H-4),7.02(1H,t,7.5,H-5),6.78(1H,d,6.7,H-6),3.26(1H ,q,7.9,H-11),1.34(3H,d,7.6,H-12),1.80(3H,s,H-13),1.03(3H,s,H-14),7.56(1H,s,H-1) ,5.97(1H,d,8.2,H-4'),5.67(1H,d,8.2,H-5'),7.38(1H,d,1.9,H-8'),7.11(1H,dd,8.5,1.9 ,H-10'),7.71(1H,d,8.5,H-11'),1.63(3H,s,H-13'),1.78(3H,s,H-14'),3.87(3H,s,3-OMe). 13 C NMR (150MHz, Methanol-d4): δ C87.3(C-2),84.8(C-3),86.7(C-3a),136.1(C-3b),127.1(C-4),117.0(C-5),117.8(C-6),149.8(C-7),142.6(C-7a ),95.7(C-8a),166.1(C-9),61.2(C-10),42.8(C-11),11.3(C-12),24.4(C-13),25.9(C-14),116.6(C-1'),130.3(C -2'), 141.4(C-4'), 122.5(C-5'), 37.7(C-6'), 150.3(C-6a'), 128.9(C-7a'), 112.4(C-8'), 136.1(C-9'), 122.4(C-10'), 119.4(C-11'), 129.8(C-11a'), 106.6(C-11b'), 165.2(C-12'), 28.2(C-13'), 27.5(C-14'), 61.2(3-OMe). The spectrum is as follows: Figures 7-9 As shown.

[0085] The molecular formula of compound 3 is determined to be C. 33 H 33 N4O6Cl has the following structure:

[0086]

[0087] 4. Compound 4

[0088] HRESIMS:m / z 583.2554[M+H] + ; 1 H NMR (400MHz, Methanol-d4): δ H4.30(1H,s,H-3),6.97(1H,s,H-4),6.76(1H,dd,6.3,2.6,H-6),6.99(1H,d,H-7,overlap),3.35(1H,dd,5.9,3.6,H -11),3.93(1H,dd,11.3,5.3,H-12a),4.37(1H,dd,11.2,8.8,H-12a),1.86(3H,s,H-13),1.1.07(3H,s,H-14),7.69 (1H,s,H-1'),5.98(1H,d,8.1,H-4'),5.68(1H,d,8.1,H-5'),7.39(1H,m,H-8',overlap),7.15(1H,m,H-9',overla p),7.15(1H,m,H-10',overlap),7.76,(1H,m,H-11'),1.65(3H,s,H-13'),1.77(3H,s,H-14'),3.88(3H,s,3-OMe). 13 C NMR (150MHz, Methanol-d4): δ C 87.3(C-2),84.8(C-3),86.7(C-3a),139.0(C-3b),117.6(C-4),149.8(C-5),117.6(C-6),126.5(C-7),142.4(C-7a ),93.6(C-8a),166.0(C-9),65.0(C-10),50.2(C-11),60.6(C-12),24.6(C-13),26.4(C-14),116.9(C-1'),126.0(C -2'), 141.5(C-4'), 122.3(C-5'), 37.7(C-6'), 149.7(C-6a'), 135.9(C-7a'), 112.6(C-8'), 122.3(C-9'), 123.2(C-10'), 118.1(C-11'), 131.7(C-11a'), 106.4(C-11b'), 165.2(C-12'), 28.3(C-13'), 27.6(C-14'), 61.2(3-OMe). The spectrum is as follows: Figures 10-12 As shown.

[0089] The molecular formula of compound 4 is determined to be C. 33 H 34 N4O7 has the following structure:

[0090]

[0091] 5. Compound 5

[0092] HRESIMS:m / z 633.2109[M+H] + And 635.2097[M+2+H] + ; 1 H NMR (400MHz, Methanol-d4): δ H 4.28(1H,s,H-3),6.96(1H,s,H-4),6.75(1H,dd,7.0,1.2H-6),6.98(1H,d,H-7,overlap),3.33(1H,dd,5. 9,3.7,H-11),3.90(1H,dd,11.3,,4.9,H-12),4.36(1H,dd,11.2,8.8,H-12),1.84(3H,s,H-13),1.06(3H,s ,H-14),7.58(1H,s,H-1),5.98(1H,d,8.2,H-4'),5.69(1H,d,8.2,H-5'),7.39(1H,d,1.7,H-8'),7.13(1H, dd,8.5,1.8,H-10'),7.72(1H,d,8.6,H-11'),1.63(3H,s,H-13'),1.76(3H,s,H-14'),3.87(3H,s,3-OMe). 13 C NMR (150MHz, Methanol-d4): δ C 87.2(C-2),84.7(C-3),86.6(C-3a),138.9(C-3b),116.9(C-4),149.8(C-5),117.5(C-6),126.6(C-7),142.4(C-7a ),93.6(C-8a),166.0(C-9),65.0(C-10),50.2(C-11),60.6(C-12),24.6(C-13),26.4(C-14),116.7(C-1'),126.9( C-2'),141.4(C-4'),122.4(C-5'),37.7(C-6'),150.4(C-6a'),136.0(C-7a'),112.4(C-8'),128.9(C-9'),122.6( C-10'),119.4(C-11'),130.3(C-11a'),106.6(C-11b'),165.0(C-12'),28.2(C-13'),27.5(C-14'),61.2(3-OMe).

[0093] The molecular formula of compound 5 is determined to be C. 33 H33 N4O7Cl has the following structure:

[0094]

[0095] The following experimental examples demonstrate the beneficial effects of the present invention.

[0096] Experimental Example 1: Insecticidal Experiment of the Compound of the Present Invention

[0097] Materials: 3rd instar silkworms, fresh mulberry leaves; bollworm eggs, artificial feed (provided by the State Key Laboratory of Plant Pathogen Biology, Institute of Plant Protection, Chinese Academy of Agricultural Sciences).

[0098] Each compound to be tested was dissolved in acetone and diluted to 100, 10, 1, 0.1, and 0.01 μg / mL.

[0099] Silkworm experiment: 3g of fresh mulberry leaves were weighed and placed in a petri dish. 3mL of acetone solution containing the test compound was sprayed onto the mulberry leaves. After the acetone evaporated, 30 third-instar silkworms were placed in the dish. The mortality of the silkworms was observed after 24 hours. Rotenone was used as a positive control.

[0100] Cotton bollworm experiment: Cotton bollworm eggs were placed in a 28℃ incubator for 1-2 days. After hatching into larvae, they were placed in a culture box and raised until the 3rd instar. Then, 3g of feed was weighed and cut into 1cm pieces. 3 A cubic block was prepared, and 3 mL of acetone solution containing the test compound was sprayed onto the feed. After the solvent evaporated, 30 third-instar cotton bollworms were introduced. The mortality of the cotton bollworms was observed after 24 hours. Rotenone was used as a positive control.

[0101] Table 1 Insecticidal activity results

[0102]

[0103] Note: A represents the LD for silkworms. 50 B represents the LD50 against bollworm. 50 .

[0104] The experimental results above (Table 1) show that compounds 1-3 have excellent insecticidal activity and their insecticidal activity against 3rd instar silkworms and cotton bollworms is stronger than that of the positive control (rotenone).

[0105] In summary, this invention provides a novel *Aureobasidium* strain and a method for producing a new compound through fermentation of this strain. This compound, a natural product produced by solid-state fermentation of fungi, exhibits excellent insecticidal activity. It can be obtained by extracting the fermentation product with ethyl acetate, followed by separation and purification using silica gel column chromatography, Sephadex LH-20 column chromatography, and semi-preparative liquid chromatography. The separation process is simple, convenient, and suitable for large-scale industrial production, demonstrating broad application prospects.

Claims

1. A strain of Aureospora ( Chrysosporium sp. ), characterized in that, It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.40210.

2. Use of the *Aureobasidium* strain of claim 1 and / or its fermentation products in the preparation of any of the following compounds, or pharmaceutically acceptable salts thereof, or solvates thereof: 、 、 。 3. A method for preparing a compound, characterized in that, The step includes fermenting the *Aureobasidium* strain according to claim 1 to obtain the fermentation product. The compound is any one of the following: 、 、 ； The preparation method includes the following steps: (1) The strain of Aureobasidium was inoculated into the fermentation medium and the fermentation product was obtained by culturing. (2) Add ethyl acetate to the fermentation product obtained in step (1), mix and extract, and filter to obtain the extract; (3) Concentrate the extract obtained in step (2) under reduced pressure to obtain crude extract; (4) The crude extract obtained in step (3) was subjected to silica gel column chromatography. The eluent was composed of petroleum ether and ethyl acetate. The eluent was eluted in a gradient manner according to the volume ratio of petroleum ether to ethyl acetate of 15:1, 10:1, 5:1, 3:1, 1:1 and 0:

1. The eluent A with a volume ratio of petroleum ether to ethyl acetate of 1:1 was collected. Step (4) further includes the step of separating and purifying the eluent A to obtain the compound; The separation and purification steps of the eluent A are as follows: after the eluent A is concentrated, it is used as a mobile phase by column chromatography with a mixture of dichloroethane and methanol in equal volume ratio to obtain 6 components A1-A6. A3 and / or A4 are prepared by semi-preparative liquid chromatography to obtain the compound. The separation and purification steps of the eluent B are as follows: the compound is prepared by semi-preparative liquid chromatography using eluent B; The A3 was prepared by semi-preparative liquid chromatography to obtain compound 3 under the following conditions: isocratic elution with 74% v / v methanol-water and retention time of 44-45 min. And / or the A4 was prepared by semi-preparative liquid chromatography to obtain compound 1, under the following conditions: isocratic elution with 50% acetonitrile-water, retention time 36-37 min; Compound 2 was prepared from A4 by semi-preparative liquid chromatography under the following conditions: isocratic elution with 50% acetonitrile-water and retention time of 46-47 min.

4. The preparation method according to claim 3, characterized in that, The column chromatography used was Sephadex LH-20 column chromatography.

5. The preparation method according to claim 3, characterized in that, The fermentation medium in step (1) consists of the following components in parts by weight: 85-95 parts rice, 0.1-0.5 parts peptone; and / or the culture conditions are constant temperature static culture at 25℃ for 20-30 days.

6. The preparation method according to claim 5, characterized in that, The fermentation medium in step (1) consists of the following components in parts by weight: 90 parts rice, 0.3 parts peptone; and / or the culture conditions are constant temperature static culture at 25°C for 25 days.

7. The preparation method according to claim 3, characterized in that, The extraction conditions in step (2) are 55-65℃ for 3-5 hours, and the number of extractions is 1-3 times.

8. The preparation method according to claim 7, characterized in that, The extraction conditions in step (2) are 60℃ for 4 hours and the extraction is performed 3 times.

Images