Erysipelothrix rhusiopathiae and use thereof

Abstract

The application belongs to the technical field of veterinary biological products, and discloses a natural attenuated strain of erysipelas type 2 and application thereof. The natural attenuated strain of erysipelas type 2 ZJ09 strain of the application is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 20231917. The ZJ09 strain of the application has strong drug resistance, the potency of the attenuated vaccine prepared from the ZJ09 strain is not affected by antibiotics under feeding conditions, and the immunogenicity is good; the live bacteria amount required for the attenuated vaccine prepared from the ZJ09 strain to produce immunization potency is far lower than that of an existing commercial vaccine strain, so the ZJ09 strain can be used as a candidate strain of a swine erysipelas attenuated vaccine, and has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of veterinary biological products technology, specifically to a type of Erysipelothrix rhusiopathiae and its applications. Background Technology

[0002] Erysipelothrix erysipelas (also known as swine erysipelas bacillus) is an important zoonotic pathogen that can cause erysipelas in humans and various animals. Swine erysipelas is an acute, febrile infectious disease characterized by septicemia, skin rashes, endocarditis, and suppurative arthritis. It is a major bacterial disease in large-scale pig farms in my country, causing serious economic losses to the country's pig industry.

[0003] Swine erysipelas vaccines are available in inactivated and live attenuated forms. Live attenuated vaccines can stimulate humoral and cellular immunity, thus offering better efficacy. Currently, commercially available live attenuated vaccine strains include GC42 and G4T10. In actual production, pig farms use a large number of different types of antibiotics to prevent and treat bacterial diseases. However, when using live attenuated vaccines, antibiotics must be discontinued to prevent them from interfering with the replication of the live attenuated vaccine in the animal's body, thereby affecting its effectiveness.

[0004] Currently, there are no reports in China of attenuated live vaccine strains for swine erysipelas that are resistant to multiple antibiotics. Therefore, developing an attenuated live vaccine strain with high safety, good immunogenicity, and strong drug resistance has broad market application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide a type 2 strain of Erysipelothrix erythropoiesis. The Erysipelothrix erythropoiesis type 2 strain ZJ09 of this invention has strong drug resistance, good safety and good immunogenicity, and can be used as a strain for preparing a live attenuated vaccine for swine erysipelas, showing good application prospects.

[0006] Meanwhile, the present invention also provides a live attenuated vaccine for swine erysipelas, wherein the live attenuated vaccine contains the ZJ09 strain of Erysipelothrix erythropoiesis.

[0007] Preferably, the content of Erysipelothrix rhusiopathiae ZJ09 strain in the attenuated live vaccine of the present invention is 5.0 x 10⁻⁶. 7 CFU.

[0008] Preferably, the content of Erysipelothrix erythropoiesis ZJ09 strain in the attenuated live vaccine of the present invention is 5.0 x 10⁻⁶. 8 CFU.

[0009] Finally, the present invention also provides the application of Erysipelothrix erythropoiesis type 2 strain in the preparation of a live attenuated vaccine for swine erysipelas.

[0010] To achieve the above objectives, the present invention provides the following technical solution: Erysipelothrix rhusiopathiae strain ZJ09 is deposited at the China Center for Type Culture Collection, address: No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, accession number: CCTCC NO: M 20231917.

[0011] Erysipelothrix erysipelothrix strain ZJ09 was isolated from the synovial fluid of healthy pigs. Serotyping identified it as type 2. When incubated on TSA agar plates containing 10% newborn calf serum at 37°C for 48 hours, the bacteria formed smooth, well-defined colonies with blue fluorescence. Gram-positive colonies were observed. Transmission electron microscopy revealed that strain ZJ09 had blunt, rounded ends and varied lengths, exhibiting typical characteristics of *Erysipelothrix erysipelothrix*.

[0012] Antibiotic susceptibility testing of Erysipelothrix rhusiopathiae strain ZJ09 showed that the bacterium was highly resistant to seven antibiotics, including chlortetracycline, erythromycin, clindamycin, ciprofloxacin, enrofloxacin, cefotaxime, and amoxicillin.

[0013] Safety test results of Erysipelothrix rhusiopathiae strain ZJ09 in piglets showed that intramuscular injection of 1.0 x 10⁻⁶ ppm... 10 After CFU administration, the experimental piglets remained healthy and did not exhibit any clinical symptoms related to swine erysipelas. Dissection of the pigs and preparation of pathological sections of tissues and organs showed no tissue lesions in any of the sections, indicating that the strain has good safety.

[0014] High-dose immunization group of Erysipelothrix rhusiopathiae strain ZJ09 (each dose contains 5.0 x 10^9 live bacteria) 8 CFU), low-dose immunization group of Erysipelothrix erythropoiesis strain ZJ09 (each dose contains 5.0 x 10^9 live bacteria). 7 The results of the immune challenge test on piglets (including CFU and control group piglets) showed that all immunized piglets developed a protective effect of no less than 80% against the virulent strain of Erysipelothrix erythrosalis.

[0015] Low-dose immunization group of Erysipelothrix rhusiopathiae strain ZJ09 (each dose contains 5.0 x 10^9 live bacteria) 7 CFU), commercial vaccine G4T10 strain immunization group (each dose contains 5.0 x 10 live bacteria according to the instructions). 8 CFU), commercially available GC42 strain vaccine immunization group (each dose contains 7.0 x 10^9 live bacteria according to the instructions). 8(CFU), along with control piglets under the same conditions, were divided into a normal feed supplementation group and an antibiotic feed supplementation group. The results showed that when piglets fed with normal feed were challenged with the virus, all three immunization groups could produce protection of no less than 80%. When piglets fed with antibiotic feed were challenged with the virus, immunization with the attenuated vaccine prepared from the ZJ09 strain produced 100% protection, while immunization with attenuated vaccines of commercially available G4T10 and GC42 strains produced only 40% protection.

[0016] The beneficial effects of this invention are: The ZJ09 strain of Erysipelothrix erythropoiesis of the present invention has good immunogenicity and high drug resistance. Therefore, the attenuated vaccine prepared from this bacterium has good safety and higher efficacy. Moreover, the use of this attenuated vaccine does not conflict with the use of antibiotics and has good application prospects. Attached Figure Description

[0017] Figure 1 This is a Gram staining image of the Erysipelothrix erythropoiesis strain ZJ09 in this invention.

[0018] Figure 2 This is a transmission electron microscope image of the Erysipelothrix erythropoiesis strain ZJ09 from this invention. Detailed Implementation

[0019] To better explain the present invention, the main contents of the present invention are further illustrated below with reference to specific embodiments, but the contents of the present invention are not limited to the following embodiments.

[0020] Example 1: Isolation and Identification of Strains Since 2020, our laboratory has obtained a total of 311 samples of suspected swine erysipelas infection material and isolates from healthy pigs in pig farms that had previously experienced the disease, collected from five provinces in China (Zhejiang, Henan, Anhui, Jiangsu, and Hunan). After homogenization, these samples were plated on TSA agar plates containing 10% newborn calf serum and incubated at 37°C for 48 hours. Suspected colonies (smooth, with regular edges and blue fluorescence) were selected for colony PCR identification. The 16S rRNA gene of the bacteria was amplified and sequenced. The amplification method is as follows: Required primers: 27F: 5′–AGAGTTTGATCCTGGCTCAG–3′ 1492R: 5′–GGTTACCTTGTTACGACTT–3′ Reaction program: 94°C pre-denaturation for 5 min; 94°C for 1 min, 55°C for 1 min, 72°C for 1 min; 30 cycles, 72°C extension for 10 min.

[0021] Loading buffer was added to the PCR stock solution, and agarose gel electrophoresis was performed. After electrophoresis, the gel was visualized using a gel imaging system. PCR stock solutions with the correct amplified band size (1353 bp) were sequenced using the same primers as the amplification primers. After sequencing, the sequences were uploaded and compared online (https: / / blast.ncbi.nlm.nih.gov / Blast.cgigenebank). If the sequence showed the highest similarity to the uploaded 16S rRNA sequence of *Erysipelothrix rhusiopathiae*, the bacterium was identified as *Erysipelothrix rhusiopathiae*. For correctly identified bacteria, 15% sterile glycerol was added to the bacterial culture, mixed well, and stored at -70°C.

[0022] Based on the above methods, 311 test materials were identified, and a total of 39 clinical isolates of Erysipelothrix erythropoietinus were obtained.

[0023] Example 2: Drug susceptibility testing of the strain The minimum inhibitory concentration (MIC) of seven antimicrobial agents (chlortetracycline, erythromycin, clindamycin, ciprofloxacin, enrofloxacin, cefotaxime, and amoxicillin) against 39 strains of *Erysipelothrix rhusiopathiae* was determined using the microdilution method. Specifically, freshly cultured bacterial suspension was added to each well of a microdilution plate coated with different concentrations of antimicrobial agents, along with two positive control wells, at a concentration of 100 µL / well. For the two negative control wells, 100 µL of TSB liquid medium containing 10% newborn calf serum was added. The plates were incubated at 37°C for 48 h until both positive control wells became turbid, while the two negative control wells remained clear. The turbidity of the test wells coated with different concentrations of the seven antimicrobial agents was observed and recorded. The lowest concentration of antimicrobial agent in the unturbid test wells was determined as the MIC of that antimicrobial agent against the target bacteria. Each group was performed in triplicate. The results showed that only strain ZJ09 exhibited high-level resistance to all seven antimicrobial agents. The minimum inhibitory concentrations (MICs) of chlortetracycline, erythromycin, clindamycin, ciprofloxacin, enrofloxacin, cefotaxime, and amoxicillin against this bacterium were 32 μg / mL, 16 μg / mL, 32 μg / mL, 4 μg / mL, 4 μg / mL, 4 μg / mL, and 4 μg / mL, respectively. The results are shown in Table 1.

[0024]

[0025] Example 3: Identification and culture of Erysipelothrix rhusiopathiae strain ZJ09 The colony morphology, Gram staining, serotype and electron microscopy morphology of Erysipelothrix rhusiopathiae strain ZJ09 were identified.

[0026] Colony morphology: When the ZJ09 strain of Erysipelothrix erythropoiesis was spread on a TSA solid medium plate containing 10% newborn calf serum, the bacteria grew well and formed smooth, well-defined colonies with blue fluorescence.

[0027] Gram staining: Erysipelothrix rhusiopathiae strain ZJ09 was examined under a Gram stain and found to be a Gram-positive small bacillus. (See attached image) Figure 1 .

[0028] Serotype identification: Agar diffusion test was performed on Erysipelothrix erythropoiesis strain ZJ09 using type 1 and type 2 standard positive sera. The results showed that the high-pressure antigen of Erysipelothrix erythropoiesis strain ZJ09 reacted with type 2 standard positive sera but not with type 1 standard positive sera. The results indicated that the serotype of Erysipelothrix erythropoiesis strain ZJ09 was type 2.

[0029] Electron microscopy morphology: *Erysipelothrix erysipelothrix* strain ZJ09 was spread on TSA solid medium plates containing 10% newborn calf serum and incubated at 37°C for 48 h. Colonies were washed off with phosphate-buffered saline (PBS), fixed sequentially with 1.5% glutaraldehyde and 1% osmium tetroxide, and then dehydrated with acetone. Transmission electron microscopy (TEM) observation of the dehydrated samples revealed that the ZJ09 strain had blunt, rounded ends and varied lengths, exhibiting typical characteristics of *Erysipelothrix erysipelothrix*. Figure 2 .

[0030] Example 4: Safety test of Erysipelothrix rhusiopathiae strain ZJ09 Erysipelothrix rhusiopathiae strain ZJ09 was spread on TSA solid agar plates containing 10% newborn calf serum and incubated at 37°C for 48 h. A single colony was then picked and inoculated into 5 mL of TSB liquid agar containing 10% newborn calf serum and incubated at 37°C with shaking for 12 h. Viable cell counts were performed on the cultured solution, and the solution was concentrated accordingly to achieve a viable cell count of 5.0 x 10⁻⁶ per mL. 8 CFU, 2.0x10 9 CFU, 5.0x10 9 CFU, 1.0x10 10 CFU. Twenty 28-day-old piglets were randomly divided into four groups of five. Each group received an intramuscular injection of 1 mL of one of the four bacterial solutions containing different live bacteria counts. The piglets were observed for 28 days. Results showed that all piglets survived without exhibiting any clinical symptoms related to swine erysipelas. After 28 days, the piglets were dissected, and histopathological sections of the tissues and organs were prepared. The results showed that no tissue lesions were observed in any of the histopathological sections. This indicates that the *Erysipelothrix rhusiopathiae* strain ZJ09, at a concentration of 1.0 x 10⁻⁶, is effective. 10 The live bacteria count of CFU showed good safety after inoculation into piglets.

[0031] Example 5: Immunochaete test of Erysipelothrix rhusiopathiae strain ZJ09 The *Erysipelothrix erythropoiesis* strain ZJ09 was prepared into a bacterial suspension according to the method in Example 4, so that each milliliter of the suspension contained 5.0 x 10^9 viable bacteria. 7 CFU, 5.0x10 8 CFU was administered to 15 28-day-old piglets, divided into 3 groups of 5 piglets each. Two groups of piglets were selected and injected intramuscularly with CFU containing 5.0 x 10^6 live bacteria. 7 CFU, containing 5.0 x 10⁻⁶ live bacteria 8 1 mL of CFU bacterial suspension was administered to piglets in three groups (two immunized groups and one control group) 28 days later. All experimental piglets were subcutaneously injected with one symptomatic dose of Erysipelothrix rhusiopathiae type 2 C43-6 bacterial suspension (containing 2.0 x 10^6 live bacteria). 9 (CFU) After challenge, piglets were observed for 14 consecutive days, with daily temperature measurements. After 14 days, morbidity and mortality were recorded, and seemingly healthy experimental pigs were dissected to observe for organ and lymph node lesions. Results are as follows: All 5 control group piglets developed the disease, and 4 died. All immunized piglets survived within 14 days. The daily body temperature of all immunized piglets did not exceed 1.5°C above their basal body temperature during the 14-day period. After 14 days, immunized piglets were dissected, and no organ or lymph node lesions were observed. Results are shown in Table 2.

[0032]

[0033] Example 6: Immunochaete test of Erysipelothrix rhusiopathiae strain ZJ09 under antibiotic feeding conditions A live attenuated vaccine of strain ZJ09 was prepared, with each dose containing 5.0 x 10^9 live bacteria of strain ZJ09. 7 Forty 28-day-old piglets were selected and divided into 8 groups of 5 piglets each. Groups 1-4 were fed regular feed without antibiotics, while groups 5-8 were fed feed supplemented with amoxicillin (100g amoxicillin per ton of feed). Piglets in groups 1 and 5 were injected intramuscularly with 1mL of *Erysipelothrix erysipelas* strain ZJ09 (containing 5.0 x 10^9 live bacteria). 8 CFU), selected piglets from groups 2 and 6, were intramuscularly injected with one dose of porcine erysipelas live vaccine (G4T10 strain) (containing 5.0 x 10^6 live bacteria). 8 CFU), selected piglets from groups 3 and 7, were intramuscularly injected with one dose of swine erysipelas live vaccine (GC42 strain) (containing 7.0 x 10^6 live bacteria). 8 Groups 4 and 8 served as control groups. Twenty-eight days after immunization, all experimental pigs were subcutaneously injected with one symptomatic dose of highly virulent strain C43-8 of *Erysipelothrix erythropoiesis* (containing 2.0 x 10⁻⁶ live bacteria). 9(CFU), piglets were challenged with antibiotics and observed for 14 consecutive days, with daily temperature measurements. Morbidity and mortality were recorded after 14 days, and seemingly healthy pigs were dissected to observe for lesions in organs and lymph nodes. Results showed that when piglets were challenged with standard feed without antibiotics, all immunized groups developed at least 80% protection. When piglets were challenged with feed containing amoxicillin, those immunized with the ZJ09 strain attenuated live vaccine developed 100% protection, while those immunized with commercially available attenuated vaccines of the G4T10 and GC42 strains developed only 60% protection. Since the control group piglets were fed antibiotic-containing feed, there were no deaths. Two of the five control pigs showed no clinical symptoms or necropsy lesions and were considered healthy. Results are shown in Table 3.

[0034]

Claims

1. A type of Erysipelothrix rhusiopathiae ( Erysipelothrix rhusiopathiae ), characterized in that, The *Erysipelothrix erythroplasiae* strain described is a type 2 attenuated strain ZJ09, which has been deposited at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 20231917.

2. A live attenuated vaccine for swine erysipelas, characterized in that, The live attenuated vaccine contains the ZJ09 strain of Erysipelothrix erythrophagus as described in claim 1.

3. The attenuated live vaccine according to claim 2, characterized in that, The live attenuated vaccine contained 5.0 x 10⁹ *Erysipelothrix rhusiopathiae* strain ZJ09. 7 CFU.

4. The attenuated live vaccine according to claim 2, characterized in that, The live attenuated vaccine contained 5.0 x 10⁻⁶ strains of Erysipelothrix erythrophagus ZJ09. 8 CFU.

5. The use of Erysipelothrix rhusiopathiae as described in claim 1 in the preparation of a live attenuated vaccine for swine erysipelas.

Images