Borneol-modified carboxymethyl chitosan nanoparticles and applications thereof

Abstract

The application discloses a brij modified carboxymethyl chitosan nanoparticle and application thereof, which has good water solubility and good biocompatibility and biodegradability, increases gene transfection efficiency, can well protect small molecule drugs curcumin and rosmarinic acid and gene drugs pDNA, prevent early leakage, prolong the residence time of the small molecule drugs in the body, increase the blood-brain barrier permeability of the composite particles, increase the drug into the brain, achieve the protection of dopaminergic neurons and treat Parkinson's disease. After the nanoparticle drug is injected into the Parkinson's mouse, the curcumin, the rosmarinic acid and the nucleic acid drug have potential effects of improving the motor ability and nerve injury of the mouse. Further research finds that the nanoparticle drug does not cause obvious damage to the main organs of the mouse, such as the heart, the liver, the spleen, the lung and the kidney.

Description

Technical Field

[0001] This invention belongs to the field of biomaterials technology. More specifically, it relates to borneol-modified carboxymethyl chitosan nanoparticles and their applications. Background Technology

[0002] Parkinson's disease (PD) is a progressive neurodegenerative disease of unknown etiology with a complex pathogenesis. It is the second most common neurodegenerative disease after Alzheimer's disease, characterized by a decrease in dopamine neurons in the substantia nigra pars compacta, striatal dopamine depletion, the appearance of Lewy bodies, and glial cell proliferation; degeneration and necrosis of dopamine neurons in the substantia nigra pars compacta of the midbrain lead to a reduction in the production of the neurotransmitter dopamine (DA).

[0003] This results in a series of symptoms in patients, including bradykinesia, rigidity, resting tremor, and postural instability. Clinically, it is characterized by bradykinesia, rigidity, resting tremor, and postural instability. Studies have shown that the pathogenesis of this disease includes the following aspects: abnormal regulation of α-synuclein, immune inflammation, oxidative stress, mitochondrial dysfunction, and gastrointestinal-related dysfunction.

[0004] Currently, treatments for Parkinson's disease include drug therapy, surgical treatment, stem cell therapy, and gene therapy. Surgical treatments include deep brain stimulation (DBS) and gastrointestinal surgery, which are high-risk, invasive, and prone to complications. Stem cell therapy involves the development of transplantation techniques using embryonic stem cells, neural stem cells, mesenchymal stem cells, and induced pluripotent stem cells, but the techniques are not yet mature. Gene therapy includes RNAi gene silencing and gene editing, but these methods face challenges related to the blood-brain barrier and bioavailability. Drug therapy, which is the most important and commonly used treatment for early-stage Parkinson's disease, includes levodopa, dopamine receptor agonists, and anticholinergic drugs, but these also face challenges related to the blood-brain barrier and bioavailability.

[0005] The blood-brain barrier (BBB) ​​consists of three layers: cerebral microvascular endothelial cells, the basement membrane, numerous pericytes embedded in the basement membrane, astrocytes, tight junctions, and microglia. Multiple endogenous transport proteins exist in BBB-related cells, selectively allowing nutrients and minerals to enter while restricting the entry of foreign substances. The BBB is an indispensable physiological barrier for maintaining normal brain function. It effectively separates brain capillaries from tissue cells and maintains central nervous system homeostasis by strictly limiting the entry and exit of various compounds and preventing the invasion of harmful macromolecules and pathogens in the bloodstream. The tight junctions formed between cerebral microvascular endothelial cells are the main material basis of the BBB, while certain enzyme systems on the endothelial cells also play an important role in protecting and maintaining BBB function. The BBB strictly restricts the transport of substances into the brain through tight junctions and enzyme barriers; it only allows lipid-soluble small molecules with a molecular weight less than 500 Da to pass through, while 98% of small molecules and almost 100% of macromolecules cannot cross the BBB into brain tissue. Therefore, the existence of the blood-brain barrier severely affects drug delivery in the central nervous system, posing a serious challenge to the delivery of brain-targeted drugs.

[0006] The blood-brain barrier (BBB) ​​is a major obstacle to the treatment of Parkinson's disease. Only lipid-soluble nanoparticles with sufficiently small sizes can cross the BBB via passive diffusion. Most nanoparticles enter the brain via receptor- and adsorption-mediated endocytosis, primarily mediated by lactoferrin (Lf) receptors. Furthermore, focused ultrasound-induced opening of the BBB is also a strategy for drug delivery overcoming the BBB. Therefore, in the use of nanomaterials for drug therapy, there is an urgent need to explore methods for using nanocarriers to treat brain diseases, specifically addressing the BBB.

[0007] In recent years, drug delivery systems have been widely used in the diagnosis and treatment of diseases, attracting increasing attention in the fields of medicine and biology. Nanotechnology has demonstrated unique advantages in solving these problems. Nanomaterials are not only excellent carriers for delivering drugs and genes, but some nanomaterials also exhibit neuroprotective effects. Nanoparticles have a compact structure, and drugs can be bound to them through encapsulation or covalent binding. Nanoparticles can protect unstable drugs, improve their water solubility, prolong the circulation time of drugs in the blood, and overcome the inherent defects of certain drugs. Existing nanodelivery systems include lipid-based nanoparticles, polymer nanoparticles, inorganic nanoparticles, and natural nanoparticles.

[0008] The emergence and gradual development of nanoparticle drug delivery systems (NPDDS) have brought tremendous opportunities for brain-targeted drug delivery across the blood-brain barrier. The rapid development of nanotechnology has enabled the design and construction of various biomedical nanoplatforms for disease diagnosis and treatment. The small size, high specific surface area, and structural modification of nanomaterials can enhance the targeting performance of NPs, enabling them to carry drugs to the target site, precisely release drugs, achieve better therapeutic effects, reduce drug toxicity and side effects, effectively improve the permeability of biological membrane barriers, selectively distribute drugs to tissues and organs, and prolong the drug circulation time in the bloodstream, providing new ideas for the treatment of many major diseases. In recent decades, nanoparticles used as drug delivery systems have generally been submicron-sized particles (3–200 nm), including polymers (such as polymer nanoparticles, micelles, or dendritic polymers), lipids (liposomes), proteins (albumin, transferrin), viruses (viral nanoparticles), organometallic compounds (nanotubes, MOFs), and even cell-derived nanoparticles (such as erythrocytes, tumor cells, and stem cells). Summary of the Invention

[0009] To address the shortcomings of existing technologies, this invention provides borneol-modified carboxymethyl chitosan nanoparticles and their applications.

[0010] The first objective of this invention is to provide a method for preparing carboxymethyl chitosan nanoparticles modified with borneol.

[0011] A second objective of this invention is to provide nanoparticles prepared by the above-described preparation method.

[0012] A third objective of this invention is to provide the use of the aforementioned nanoparticles in the preparation of drugs for treating and / or improving Parkinson's disease.

[0013] The above-mentioned objective of this invention is achieved through the following technical solution:

[0014] Borneol (BO), a precious traditional Chinese medicine, is used to clear the mind and refresh the spirit, and is often used for conditions such as delirium due to febrile diseases and syncope due to stroke. Studies have shown that borneol can increase blood-brain barrier permeability under physiological conditions and decrease it under pathological conditions. Furthermore, borneol can protect against neuronal damage after cerebral ischemia. In recent years, more and more researchers have used borneol as a permeation enhancer to improve drug transport efficiency into the brain and increase drug distribution. Modern pharmacological studies show that borneol can promote the opening of the physiological blood-brain barrier without causing pathological damage to the brain, and has a certain protective effect on the brain and the blood-brain barrier. This invention uses small-molecule borneol as a carrier to modify molecules and studies its application in the transport of drug-loaded nanoparticles across the blood-brain barrier.

[0015] Rosmarinic acid (RA) is a water-soluble natural phenolic acid compound. Rosmarinic acid can increase neuronal activity, prevent abnormal increases in ROS levels and caspase-3 activity, and improve the progression of Parkinson's disease by downregulating apoptosis pathways and combating oxidative stress. Furthermore, it has multiple effects on the nervous system, including anti-anxiety, antidepressant, analgesic, antioxidant, antimutagenic, and neuroprotective properties.

[0016] Curcumin (Cur) is a polyphenolic compound extracted from the rhizome of the turmeric plant. It has unique advantages in reversing neurodegenerative diseases. On the one hand, it can exert a neuroprotective effect by inhibiting the generation of free radicals and promoting the scavenging of free radicals. On the other hand, curcumin can inhibit the formation of α-synuclein oligomers induced by overexpression or mutation of the α-synuclein gene, and it can be used as a drug for the treatment of Parkinson's disease.

[0017] Carboxymethyl chitosan (DMAP) is an amphoteric polyelectrolyte that is modified by carboxylation of chitosan, making it contain both positively charged amino groups and negatively charged carboxyl groups. It has good biocompatibility and greatly improved water solubility, and is widely used in tissue engineering and drug delivery.

[0018] Therefore, this invention claims protection for a method for preparing borneol-modified carboxymethyl chitosan nanoparticles, comprising the following steps:

[0019] Preparation of HCR conjugates: Hyaluronic acid, curcumin and rosmarinic acid react to generate HCR conjugates;

[0020] Preparation of BC conjugate: Borneol reacts with 3,3′-dithiodipropionic acid to obtain an intermediate; then, the intermediate reacts with carboxymethyl chitosan to generate BC conjugate;

[0021] Preparation of BC / P / HCR nanoparticles: HCR conjugate, BC conjugate and plasmid were mixed and reacted to obtain BC / P / HCR nanoparticles.

[0022] Preferably, the plasmid expresses targeted inhibition or targeted silencing of the GAPDH gene and / or GAPDH protein.

[0023] More preferably, the target sequence of the plasmid is a shRNA expression vector of CTCACTCAAGATTGTCAGCAA (SEQ ID NO:1).

[0024] More preferably, the shRNA expression vector is pGPU6 / Neo.

[0025] As a specific embodiment, the plasmid is a nucleotide sequence with the following nucleotide sequence inserted between the BbsⅠ and BamHI restriction sites on the pGPU6 / Neo vector: CACCGCTCACTCAAGATTGTCAGCAATTCAAGAGATTGCTGACAATCTTGAGTGAGTT TTTTG (SEQ ID NO:2).

[0026] As a specific embodiment, the plasmid is prepared by ligating an shRNA template to a linearized vector pGPU6 / Neo.

[0027] The sense strand of the shRNA template is: CACCGCTCACTCAAGATTGTCAGCAATTCAAGAGATTGCTGACAATCTTGAGTGAGTT TTTTG (SEQ ID NO:3);

[0028] The antisense strand of the shRNA template is: GATCCAAAAAACTCACTCAAGATTGTCAGCAATCTCTTGAATTGCTGACAATCTTGAG TGAGC (SEQ ID NO:4).

[0029] Preferably, in the preparation of the HCR conjugate, hyaluronic acid, curcumin and rosmarinic acid react to generate the HCR conjugate in the presence of catalysts DMAP and EDC.

[0030] Preferably, in the preparation of the HCR conjugate, hyaluronic acid, curcumin and rosmarinic acid undergo an esterification reaction to generate the HCR conjugate.

[0031] More preferably, in the preparation of HCR conjugate, EDC and DMAP activate the carboxyl group of hyaluronic acid, then mix with curcumin and react fully, then mix with rosmarinic acid and react fully, and finally purify to obtain the product.

[0032] More preferably, in the preparation of the HCR conjugate, EDC and DMAP activate the carboxyl group of hyaluronic acid, then mix it with curcumin and react it fully at 35-45°C for 20-30 hours, then mix it with rosmarinic acid and react it fully for 20-30 hours, and finally purify it to obtain the final product.

[0033] In a further preferred embodiment, in the preparation of the HCR conjugate, EDC and DMAP activate the carboxyl group of hyaluronic acid, then mix it with curcumin and react it thoroughly at 40°C for 24 hours, then mix it with rosmarinic acid and react it thoroughly for 24 hours, and finally purify it to obtain the final product.

[0034] Preferably, in the preparation of the HCR conjugate, the molar ratio of hyaluronic acid, curcumin and rosmarinic acid is 1:(0.5-1.5):(0.5-1.5).

[0035] More preferably, in the preparation of the HCR conjugate, the molar ratio of hyaluronic acid, curcumin and rosmarinic acid is 1:1:1.

[0036] Preferably, in the preparation of the BC coupling compound, borneol reacts with 3,3′-dithiodipropionic acid as an intermediate in the presence of the catalyst DMAP.

[0037] Preferably, in the preparation of the BC coupling, the molar ratio of borneol to 3,3′-dithiodipropionic acid is 1:(0.5-1.5).

[0038] More preferably, in the preparation of the BC coupling, the molar ratio of borneol to 3,3′-dithiodipropionic acid is 1:1.

[0039] Preferably, in the preparation of the BC conjugate, the mass ratio of the intermediate to carboxymethyl chitosan is 1:(0.5-1.5). More preferably, in the preparation of the BC conjugate, the mass ratio of the intermediate to carboxymethyl chitosan is 1:1.

[0040] Preferably, in the preparation of the BC conjugate, the intermediate reacts with carboxymethyl chitosan in the presence of DMAP, EDCl, and NHS to generate the BC conjugate.

[0041] Preferably, in the preparation of the BC conjugate, the intermediate undergoes a reverse dehydration condensation reaction with carboxymethyl chitosan to generate the BC conjugate.

[0042] Preferably, in the preparation of BC / P / HCR nanoparticles, the amounts of plasmid, HCR conjugate, and BC conjugate, calculated by mass, are 1:(10-20):(10-20).

[0043] More preferably, in the preparation of BC / P / HCR nanoparticles, the ratio of plasmid:HCR conjugate to BC conjugate is 1:15:15 by mass.

[0044] The nanoparticles prepared by the aforementioned method are also protected.

[0045] And the use of the nanoparticles in the preparation of drugs for treating and / or improving Parkinson's disease.

[0046] Preferably, the drug is used in medications for treating and / or improving bradykinesia, decreased motor coordination, and / or motor disorders caused by Parkinson's disease.

[0047] Preferably, the drug is used in the treatment and / or improvement of motor function and / or nerve damage caused by Parkinson's disease.

[0048] Therefore, this study discloses a nanomedicine using borneol-modified carboxymethyl chitosan for the treatment of Parkinson's disease, achieving the dual effects of gene therapy and natural small molecule drug therapy. A series of characterizations, including ultraviolet spectroscopy, infrared spectroscopy, nuclear magnetic resonance analysis, particle size characterization, potential characterization, transmission electron microscopy, drug loading and encapsulation efficiency determination, and serum stability testing, all demonstrate the successful synthesis of BC / P / HCR nanoparticles obtained from borneol-modified carboxymethyl chitosan, exhibiting uniform size and good stability. In gene therapy, plasmid DNA (pDNA) provides an effective method to reduce SNCA expression. Gene therapy using pDNA plasmids exhibits low immunogenicity and flexible transgenic capabilities. Carboxymethyl chitosan is used to encapsulate the pDNA, protecting it from enzymatic degradation during in vivo circulation. In natural small molecule drug therapy, curcumin can inhibit α-synuclein oligomer formation induced by overexpression or mutation of the α-synuclein gene, while also inhibiting free radical generation and promoting free radical scavenging. Rosmarinic acid can increase neuronal activity, prevent abnormal increases in ROS levels and caspase-3 activity, downregulate apoptosis pathways, and has anti-oxidative stress effects. The borneol-modified outer shell increases the biocompatibility and blood-brain barrier permeability of the composite particles, promoting drug delivery to the lesion site and significantly enhancing the therapeutic effect of the nanoparticles.

[0049] Applying BC / P / HCR nanoparticles to the C57BL / 6 Parkinson's disease mouse model increased the opening of the blood-brain barrier. Curcumin, rosmarinic acid, and nucleic acid drugs improved motor function and neurological damage in the mice. BC / P / HCR nanoparticles improved motor impairment in Parkinson's disease model mice; and compared to the C / P / HCR nanoparticle group and the BC / HCR nanoparticle group, the BC / P / HCR nanoparticles showed more significant behavioral improvement in the Parkinson's disease model mice, demonstrating that BC / P / HCR nanoparticles increase the blood-brain barrier and enhance drug delivery into the brain; the nucleic acid drug (pDNA) improved motor function and neurological damage in mice, thereby mitigating the progression of Parkinson's disease.

[0050] In conclusion, BC / P / HCR nanoparticles have a certain protective effect on MPTP-induced dopaminergic neurons in the substantia nigra of a mouse model of Parkinson's disease, can improve the behavior of the model mice, and also show good biocompatibility. They are a potential drug that can improve the symptoms of Parkinson's patients and enhance their quality of life.

[0051] The present invention has the following beneficial effects:

[0052] Therefore, this invention discloses a borneol-modified carboxymethyl chitosan-loaded natural small-molecule nanomicelles and pDNA nanoparticles that enhance blood-brain barrier permeability and have low toxicity. Carboxymethyl chitosan serves as the nanocarrier, exhibiting good water solubility, biocompatibility, and biodegradability. Borneol is further modified as a blood-brain barrier-opening functional group, increasing the blood-brain barrier permeability and gene transfection efficiency of the nanoparticles. The BC shell structure not only effectively protects the small-molecule drugs curcumin and rosmarinic acid, as well as the gene drug pDNA, preventing premature leakage and prolonging their residence time in the body, but also increases the blood-brain barrier permeability of the composite particles, increasing drug entry into the brain and achieving protection of dopaminergic neurons, thereby treating Parkinson's disease. After injection of the nanomedicines into Parkinson's mice, curcumin, rosmarinic acid, and nucleic acid drugs showed potential effects in improving the mice's motor function and reducing neurological damage. Further studies revealed that the nanoparticles did not cause significant damage to major organs in mice, such as the heart, liver, spleen, lungs, and kidneys. Attached Figure Description

[0053] Figure 1 This is a schematic diagram of the synthesis of borneol-modified carboxymethyl chitosan nanoparticles BC / P / HCR.

[0054] Figure 2 This is a structural diagram of the synthesized HCR conjugate.

[0055] Figure 3 This is a structural diagram of the synthesized BC coupling compound.

[0056] Figure 4 For BO 1 H-NMR spectrum.

[0057] Figure 5 For CMCS 1 H-NMR spectrum.

[0058] Figure 6 For BC 1 H-NMR spectrum.

[0059] Figure 7 For HA 1 H-NMR spectrum.

[0060] Figure 8 For RA 1 H-NMR spectrum.

[0061] Figure 9 For Cur 1 H-NMR spectrum.

[0062] Figure 10 For HCR 1 H-NMR spectrum.

[0063] Figure 11 For the detection of various substances by ultraviolet-visible spectroscopy.

[0064] Figure 12 For HCR infrared spectroscopy analysis.

[0065] Figure 13 For BC infrared spectroscopy analysis.

[0066] Figure 14 Infrared spectral analysis of each substance.

[0067] Figure 15 Here is the Zeta potential of each substance.

[0068] Figure 16 Characterize the particle size of each substance.

[0069] Figure 17 Particle size characterization of BC / P / HCR nanoparticles.

[0070] Figure 18 Electron microscopy characterization of BC / P / HCR nanoparticles.

[0071] Figure 19 For the detection of encapsulation efficiency and drug loading rate.

[0072] Figure 20 For serum stability testing.

[0073] Figure 21 A flowchart for the Parkinson's mouse pathway.

[0074] Figure 22 The total distance and average speed of the mice in the open field experiment.

[0075] Figure 23 The movement trajectory of the mouse in the open field experiment

[0076] Figure 24 For the rotator experiment

[0077] Figure 25 For the pole climbing experiment

[0078] Figure 26 HE staining diagram Detailed Implementation

[0079] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0080] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0081] 1. Main reagents

[0082] Bornol (BO), 3,3′-dithiodipropionic acid (DA), 4-dimethylaminopyridine (DMAP), N,N-dimethylformamide (DMF), rosmarinic acid (RA), hyaluronic acid The following ingredients were purchased from Beyotime Biotechnology Co., Ltd.: anhydrous dichloromethane, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (3-(ethyliminomethylideneamino)-N,N-dimethylpropan-1-amine,hydrochloride,EDCl), curcumin (Cur), carboxymethylchitosan (CMCS), N-hydroxysuccinimide (NHS), 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) hydrochloride, Calcein AM cell viability assay kit, and reactive oxygen species assay kit. Dialysis bags (Mr 1000) were also purchased.

[0083] 2. Instruments

[0084] Malvern Zetasizer Nano ZS90 particle size potential analyzer (UK); JEOL JEM-2100HR transmission electron microscope (Japan); Platinum Elmer Spectrum Two Fourier transform infrared spectrometer (Germany); Shimadzu UV-2550 UV-Vis spectrophotometer (Japan); Platinum Elmer Enspire multi-functional microplate reader (Germany); Leica DMI3000B fluorescence inverted phase contrast microscope (Germany).

[0085] Example 1 Synthesis of BC / P / HCR Nanoparticles

[0086] Figure 1 This is a schematic diagram illustrating the synthesis of borneol-modified carboxymethyl chitosan nanoparticles BC / P / HCR.

[0087] First, based on the hydroxyl groups in the curcumin structure and the carboxyl groups in the rosmarinic acid and hyaluronic acid molecules, curcumin undergoes an esterification reaction with rosmarinic acid and hyaluronic acid in the presence of a catalyst to generate HCR conjugates, which serve as the core of nanoparticles.

[0088] Carboxymethyl chitosan, as an amphoteric polyelectrolyte, contains both amino and carboxyl groups in its structure. On one hand, carboxymethyl chitosan electrostatically adsorbs negatively charged pDNA; on the other hand, it exhibits good biocompatibility and can encapsulate the core of HCR conjugates. Borneol, a small-molecule terpene alcohol containing hydroxyl groups, is used as a functional modifying group to promote blood-brain barrier opening and structural modification of carboxymethyl chitosan. In the presence of the catalyst DMAP, borneol first undergoes esterification with 3,3′-dithiodipropionic acid to generate the intermediate BO-DA. Subsequently, the carboxyl group of intermediate BO-DA further reacts with the amino group of carboxymethyl chitosan to form an amide bond, generating the BC conjugate.

[0089] HCR conjugate, BC conjugate and anti-SNCA plasmid (anti-SNCApDNA) extracted from engineered bacteria were mixed and incubated to obtain BC / P / HCR nanoparticles loaded with genes and natural small molecules modified with carboxymethyl chitosan by borneol.

[0090] I. Synthesis of HCR Couplings

[0091] Hyaluronic acid and rosmarinic acid contain carboxyl groups, while curcumin molecules contain hydroxyl groups. In the presence of the catalysts DMAP and EDC, hyaluronic acid, curcumin, and rosmarinic acid undergo an esterification reaction to generate HCR conjugates. Figure 2 This is a structural diagram of the synthesized HCR conjugate.

[0092] The specific steps are as follows:

[0093] Hyaluronic acid (1.258 mmol) powder was dissolved in 50 mL of anhydrous DMSO and stirred at 80 °C for 2 h. Then, EDC (2 mol) and DMAP (0.125 mmol) were added to activate the carboxyl groups in the hyaluronic acid, and the mixture was stirred at room temperature for 1 h (the synthesized product was HC). Subsequently, curcumin (1.258 mmol) was dissolved in the same system, and the mixture was stirred at 40 °C for another 24 h. Rosmarinic acid (1.258 mmol) was then added to the mixture, and the reaction continued for another 24 h (after the reaction, the supernatant was used for subsequent calculations of encapsulation efficiency and drug loading). The resulting reaction solution was dialyzed against DMSO for 24 h, then against deionized water for 48 h, and then lyophilized. The HCR conjugate dissolved in deionized water and formed under magnetic stirring.

[0094] II. Synthesis of BC Couplings

[0095] The synthesis of BC couplings requires two steps ( Figure 3(Synthetic structure diagram of BC coupling compound): Borneol is a small molecule terpene alcohol containing hydroxyl groups. In the presence of the catalyst DMAP, borneol first undergoes esterification with 3,3′-dithiodipropionic acid to generate intermediate BO-DA; then, the carboxyl group of intermediate BO-DA reacts further with the amino group of carboxymethyl chitosan to form an amide bond to generate BC coupling compound.

[0096] The specific steps are as follows:

[0097] 3,3′-Dithiodipropionic acid (4.997 mmol) powder was dissolved in 20 mL of anhydrous DMSO and stirred at 80 °C for 2 h. Then, DMAP (0.5 mmol) was added to activate the carboxyl group in DA, and the mixture was stirred at room temperature for 1 h. Subsequently, borneol (4.997 mmol) was dissolved in the system, and the mixture was stirred at 40 °C for another 24 h to obtain the intermediate product BO-DA.

[0098] Dissolve BO-DA and carboxymethyl chitosan separately in 20 mL of DMSO, with a concentration of 1.0 mmol / mL for both systems. After mixing, add DMAP, EDCl, and NHS to the mixture. React overnight at room temperature and then transfer to a dialysis bag (Mr1000). Dialyze the resulting solution with DMSO for 24 h, then with ultrapure water for 24 h, and freeze-dry to obtain the solid product BC conjugate.

[0099] III. Synthesis of BC / P / HCR Nanoparticles

[0100] The HCR conjugate and BC conjugate were dissolved in deionized water and acetic acid solution (pH 5.0), respectively. The concentrations of both the HCR conjugate and BC conjugate were 1.0 mg / mL. Subsequently, at 4 °C, the pre-prepared plasmid pDNA and HCR conjugate solution were added to the BC conjugate solution (pDNA / (BC conjugate + HCR conjugate) = 1:30 (w / w)) to obtain BC / P / HCR nanoparticles.

[0101] The plasmid contains the nucleotide sequence CACCGCTCACTCAAGATTGTCAGCAATTCAAGAGATTGCTGACAATCTTGAGTGAGTT TTTTG (SEQ ID NO:2) inserted between the BbsⅠ and BamHI restriction sites on the pGPU6 / Neo vector. This plasmid can inhibit or target and silence the GAPDH gene and / or GAPDH protein, with its target sequence being CTCACTCAAGATTGTCAGCAA (SEQ ID NO:1).

[0102] The preparation method is as follows: shRNA template is ligated with linearized vector pGPU6 / Neo (using BBSI and BamHI) using T4 ligase to obtain...

[0103] The sense strand of the shRNA template is: CACCGCTCACTCAAGATTGTCAGCAATTCAAGAGATTGCTGACAATCTTGAGTGAGTT TTTTG (SEQ ID NO:3);

[0104] The antisense strand of the shRNA template is: GATCCAAAAAACTCACTCAAGATTGTCAGCAATCTCTTGAATTGCTGACAATCTTGAG TGAGC (SEQ ID NO:4).

[0105] Adjust the pH of the mixture to approximately 5.0 using diluted sodium hydroxide or hydrochloric acid. Centrifuge the mixture at 14,000 rpm and 4°C for 1 hour. Carefully collect the precipitate from the bottom of the centrifuge tube, rinse with deionized water, and centrifuge under the same conditions. Repeat this process three times. Freeze-dry the obtained BC / P / HCR nanoparticles and store them at 4°C for later use.

[0106] Synthesis of 1BC / HCR nanoparticles (Comparative Example)

[0107] HCR and BC conjugates were prepared according to the method in Example 1. The HCR and BC conjugates were then dissolved separately in deionized water-acetic acid solution at pH 5.0. The concentrations of both HCR and BC conjugates were 1.0 mg / mL. Subsequently, the HCR conjugate solution was added to the BC conjugate solution at 4°C (BC conjugate / HCR conjugate = 15:15 (w / w)) to obtain BC / HCR nanoparticles.

[0108] Synthesis of 2C / P / HCR Nanoparticles (Comparative Example)

[0109] The HCR conjugate was prepared according to the method in Example 1. The HCR conjugate and C (carboxymethyl chitosan) were dissolved in deionized water and acetic acid solution (pH 5.0), respectively. The concentrations of both the HCR conjugate and C (carboxymethyl chitosan) were 1.0 mg / mL. Subsequently, at 4°C, the pre-prepared plasmid pDNA and HCR conjugate solution were added to the BC conjugate solution (pDNA / (carboxymethyl chitosan + HCR conjugate) = 1:30 (w / w)) to obtain C / P / HCR nanoparticles.

[0110] The plasmid used is the same as in Example 1.

[0111] Example 2: 1H NMR Spectroscopy Analysis

[0112] I. Experimental Methods

[0113] Take 3 mg of each dried sample (borneol, carboxymethyl chitosan, hyaluronic acid, rosmarinic acid, curcumin, and the HCR conjugate and BC conjugate prepared in Example 1) and dissolve them in 1 ml of D2O, CDCl3, and DMSO-d6, respectively. Sonicate until the solid is basically dissolved, centrifuge at 6000 rpm for 10 min to remove the precipitate, and transfer the supernatant to the bottom of an NMR tube using a syringe for NMR analysis. Process the data using MestReNova software.

[0114] II. Experimental Results

[0115] The proton spectrum of the nanoparticles was analyzed using nuclear magnetic resonance spectroscopy, and the results are as follows: Figures 4 to 10 As shown. In the BC coupling 1 Characteristic peak signals of borneol and carboxymethyl chitosan can be observed in the H-NMR spectrum. In the HCR conjugate... 1 The H-NMR spectrum also shows characteristic peak signals of curcumin, hyaluronic acid, and rosmarinic acid. 1 H-NMR spectra indicate the successful synthesis of its core structure BC conjugate and its shell structure HCR conjugate.

[0116] Example 3: Ultraviolet-Visible Spectroscopy Analysis

[0117] I. Experimental Methods

[0118] A certain amount of hyaluronic acid solution, curcumin solution, HC solution prepared in Example 1, HCR conjugate solution prepared in Example 1, BC / HCR nanoparticle solution prepared in Comparative Example 1, and BC / P / HCR nanoparticle solution prepared in Example 1 were taken as samples, and deionized water was used as a blank control. Ultraviolet scanning (UV2550) was performed in the wavelength range of 200-600 nm to obtain ultraviolet spectra.

[0119] II. Experimental Results

[0120] Through ultraviolet-visible spectroscopy, such as Figure 11 As shown, the characteristic peak of curcumin appears at around 427 nm, hyaluronic acid has no obvious absorption peak, and the characteristic peak of rosmarinic acid is at around 324 nm. When RA and HA-Cur form HCR, the characteristic peaks exhibit a "red shift." This phenomenon is due to the presence of a benzene ring structure in the rosmarinic acid structure, resulting in conjugation in the system of the synthetic conjugate. The HCR conjugate prepared in Example 1 contains the characteristic peaks of curcumin and rosmarinic acid in the spectrum, indicating that the HCR conjugate prepared in Example 1 was successfully coupled.

[0121] Example 4 Infrared Spectroscopy Analysis

[0122] I. Experimental Methods

[0123] Take 1 mg of each sample (hyaluronic acid, curcumin, HC prepared in Example 1, rosmarinic acid, and HCR conjugate prepared in Example 1) and 100 mg of KBr to prepare tablets, with a sample to KBr mass ratio of approximately 1:100. Grind the mixture of sample and KBr in a mortar for ten minutes under an infrared lamp, press it into a transparent film on a tablet press, and scan it in the wavenumber range of 4000–500 after background removal using a Fourier transform infrared spectroscopy.

[0124] II. Experimental Results

[0125] The nanocomposite at different stages was detected using Fourier transform infrared spectroscopy, and the results are as follows: Figures 12 to 14 As shown. Infrared spectral analysis of the HCR conjugate prepared in Example 1 showed that at 1637 cm⁻¹... -1 1514cm -1 、 and 1423cm -1 The peaks at the left and right are characteristic absorption peaks of the aromatic ring C=C in the structure, at 1278 cm⁻¹. -1 The absorption peaks around 3182 cm⁻¹ are due to the COC stretching vibration of the ester bond. Rosmarinic acid has an absorption peak at 3182 cm⁻¹. -1 Left and right sides and 1714cm -1 The disappearance of the absorption peaks related to the carboxyl group indicates that the HCR conjugate product prepared in Example 1 has been preliminarily synthesized.

[0126] Infrared spectral analysis of the BC couplings showed that at 1633 cm⁻¹ -1 The peaks at the left and right are due to the C=O stretching vibration in the amide bond, 1568 cm⁻¹. -1 The peaks at the left and right are due to the in-plane bending vibrations of the NH bond, 1323 cm⁻¹. -1 The peaks on the left and right are due to the stretching vibrations of CN bonds, 1153 cm⁻¹. -1 The peaks at the left and right are characteristic peaks of -COOR, and the infrared spectrum confirms the successful synthesis of the BC coupling compound.

[0127] Example 5: Zeta potential detection

[0128] I. Experimental Methods

[0129] The HCR conjugate solution prepared in Example 1, the BC / HCR nanoparticle solution prepared in Comparative Example 1, and the BC / P / HCR nanoparticle solution prepared in Example 1 were diluted to appropriate concentrations and ultrasonically dispersed. A trace amount was injected into a Malvern potential measurement cell. Appropriate parameters were selected for potential detection.

[0130] II. Experimental Results

[0131] The zeta potentials of nanocomposites at different synthesis stages were detected using a Malvern particle size potential analyzer, such as... Figure 15 As shown. Plasma proteins are mostly negatively charged under physiological conditions, and the potential of the BC / P / HCR nanoparticles prepared in Example 1 is -21.2mV. Therefore, the BC / P / HCR nanoparticles prepared in Example 1 are not prone to adsorbing free proteins to form protein crowns and are relatively stable in vivo.

[0132] Example 6 Particle Size Detection

[0133] I. Experimental Methods

[0134] The HCR conjugate solution prepared in Example 1, the BC / HCR nanoparticle solution prepared in Comparative Example 1, and the BC / P / HCR nanoparticle solution prepared in Example 1 were diluted to appropriate concentrations and ultrasonically dispersed. A trace amount of each solution was placed in a particle size measurement cell. Appropriate parameters were selected for particle size analysis.

[0135] II. Experimental Results

[0136] The particle size, potential, and PDI of nanoparticles at different synthesis stages were analyzed using a Malvern particle size potential analyzer. The results are as follows: Figure 16 and Figure 17 As shown. The HCR conjugate solution prepared in Example 1 has a particle size of around 103 nm. After being coated with BC conjugate, the BC / HCR nanoparticles prepared in Example 1 increase in size to around 225 nm. Finally, the BC / P / HCR nanoparticles prepared in Example 1 with the plasmid loaded have a particle size distribution of around 296.7 nm, a Z-Average of 260.5 nm, and a PDI of 0.243.

[0137] Example 7: Transmission Electron Microscopy Detection

[0138] I. Experimental Methods

[0139] The HCR conjugate solution prepared in Example 1, the BC / HCR nanoparticle solution prepared in Comparative Example 1, and the BC / P / HCR nanoparticle solution prepared in Example 1 were diluted to appropriate concentrations (the solutions tended to be colorless and transparent). The samples were sonicated for 15 minutes before electron microscopy.

[0140] II. Experimental Results

[0141] The size and morphology of nanoparticles were observed using transmission electron microscopy, and the results are as follows: Figure 18As shown. The HCR conjugate prepared in Example 1 has a particle size of about 100 nm, but due to the adhesiveness of hyaluronic acid, the conjugate partially agglomerates together; the BC / HCR nanoparticles prepared in Comparative Example 1 have an HCR conjugate core and a BC conjugate exterior; the BC / P / HCR nanoparticles prepared in Example 1 with plasmid loading are spherical.

[0142] Example 9 Encapsulation efficiency and drug loading

[0143] I. Experimental Methods

[0144] In the preparation process of Example 1, the absorbance of each substance in the supernatant of Example 1 was detected by ultraviolet light spectroscopy. Then, the actual dosage was obtained by subtracting the amount in the supernatant from the total dosage. The drug loading and encapsulation efficiency can be obtained through formulas.

[0145] The encapsulation efficiency of Cur in the BC / P / HCR nanoparticles prepared in Example 1 was EE. Cur (%), drug loading is LC Cur (%). The encapsulation efficiency of RA in the BC / P / HCR nanoparticles prepared in Example 1 was EE. RA (%), drug loading is LC RA (%).

[0146] The absorbance values ​​of curcumin at 427 nm and rosmarinic acid at 324 nm were determined using a UV spectrophotometer, and the concentrations of curcumin and rosmarinic acid were obtained according to the standard curve. The drug loading and encapsulation efficiency were calculated using the following formula.

[0147] EE(%) = (W1 - C) unloaded ×V) / W1×100%

[0148] LC (%) = (W1 - C) unloaded ×V) / W0×100%

[0149] Where W0 represents the mass (mg) of the nano-drug delivery system, W1 represents the total mass (mg) of the added drug, and C unloaded V represents the mass concentration of the unencapsulated drug (mg / mL), and V represents the volume of the centrifuged supernatant (mL).

[0150] The standard curves for curcumin and rosmarinic acid were constructed as follows:

[0151] Accurately weigh a certain amount of curcumin, dissolve it in an appropriate amount of acetic acid, and prepare rosmarinic acid standard solutions of different concentrations with distilled water. Using distilled water as a reference, measure its absorbance at 427 nm using a UV spectrophotometer and plot a standard curve. Prepare a standard solution of rosmarinic acid by dissolving it in distilled water using the same method, measure the absorbance of rosmarinic acid at a wavelength of 324 nm, and plot a standard curve.

[0152] II. Experimental Results

[0153] Curcumin absorbs at 427 nm. The linear regression equation between its absorbance and concentration, as measured in experiments, is: Y = 0.0071X + 0.1472R. 2 =0.9994; The linear regression equation between the absorbance and concentration of rosmarinic acid at 324 nm is: Y = 0.0393X + 0.0098R 2 =0.9998. For example... Figure 19 As shown, the encapsulation efficiency of curcumin in the BC / P / HCR nanoparticles prepared in Example 1 was 47.79%, and the drug loading was 6.44%; the encapsulation efficiency of rosmarinic acid was 84.82%, and the drug loading was 11.17%.

[0154] Example 10: Investigation of serum stability

[0155] I. Experimental Methods

[0156] The BC / P / HCR nanoparticles prepared in Example 1 were resuspended in DMEM complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin, and incubated at 37°C with 5% CO2. After incubation for 0 h, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h, 36 h, and 48 h, particle size changes at each time point were monitored using a Malvern dynamic light scattering particle size analyzer, and curves were plotted.

[0157] II. Experimental Results

[0158] Since the BC / P / HCR nanoparticles prepared in Example 1 were administered via tail vein injection, their non-specific interactions with proteins and other molecules in the blood would affect their long-circulation properties. Serum stability testing showed that the BC / P / HCR nanoparticles prepared in Example 1 are a stable delivery system under physiological conditions. Figure 20 ).

[0159] Example 11: Behavioral Changes in Parkinson's Disease Model Mice

[0160] I. Construction of the C57BL / 6 mouse Parkinson's disease model

[0161] Thirty-six male C57BL / 6 mice (22–25 g, 6–8 weeks old) purchased from the Experimental Animal Center of Southern Medical University were divided into 6 groups (n = 6 mice / group). This experimental protocol complies with the national guidelines for the care and use of laboratory animals and has been approved by the Animal Ethics Committee of South China Normal University.

[0162] To investigate the effects of the BC / P / HCR nanoparticles prepared in Example 1 on behavioral changes in Parkinson's disease model mice, the BC / P / HCR nanoparticles prepared in Example 1 and other control group nanoparticles were injected intravenously into MPTP-induced Parkinson's disease model mice (DAY 1 to 7). Nanodrug administration was then performed intravenously every other day for 12 consecutive administrations (DAY 8 to 30). Forty-eight hours after the last injection, the mice underwent behavioral tests, including the open field test (DAY 32), rotarod test (DAY 33), and pole climbing test (DAY 34). The movement trajectory of the mice and the time to reach the top of the pole and turn their heads were recorded to document their motor behavior. The mice were then sacrificed (DAY 35), and their hearts, livers, spleens, lungs, and kidneys were collected and fixed in 4% paraformaldehyde for 24 hours before being prepared into paraffin sections. See the flowchart for details. Figure 21 .

[0163] The experimental animals were divided into 6 groups, as follows:

[0164] Group I (saline control group): During the MPTP-induced Parkinson's model mouse stage and the nanodrug tail vein injection stage, the same amount of saline as other groups was injected.

[0165] Group II (MPTP modeling group): MPTP-induced Parkinson's disease model mice were injected with the same amount of physiological saline as other groups during the tail vein injection of nanomedicine.

[0166] Group III (MPTP+C / P / HCR group): MPTP-induced Parkinson's disease model mice were used in the MPTP-induced Parkinson's disease model mouse stage, and C / P / HCR nanoparticles were injected into the tail vein of the nanomedicine for nanomedicine delivery.

[0167] Group IV (MPTP+BC / HCR group): MPTP-induced Parkinson's disease model mice were injected with BC / HCR nanoparticles prepared in Comparative Example 1 during the tail vein injection stage of nanomedicine delivery.

[0168] Group V (MPTP+BC / P / HCR group): MPTP-induced Parkinson's disease model mice were injected with BC / P / HCR nanoparticles prepared in Example 1 during the tail vein injection stage of nanomedicine delivery.

[0169] The specific method for establishing a Parkinson's disease mouse model using MPTP is as follows: mice are injected intraperitoneally with 30 mg / kg of MPTP once a day, which means that mice are injected intraperitoneally with a concentration of 3 mg / mL of MPTP once a day. The volume of the solution administered is 0.1 mL per 10 g of body weight. After 7 consecutive days, a Parkinson's disease mouse model is established.

[0170] The specific method for the tail vein injection stage of nanomedicine is as follows: intravenous injection once every other day for a total of 12 times, at a concentration of 200 μg / mL, with a solution volume of 0.1 mL per 10g of body weight.

[0171] II. Open Field Test

[0172] 1. Experimental Methods

[0173] The above six groups of mice underwent the open field test. The open field test is a commonly used method for measuring exploratory behavior and general activity in rodents, and is a common indicator of reduced movement after MPTP injury.

[0174] The experimental setup consisted of two parts: an open field reaction chamber and a recording system. The open field reaction chamber was square, approximately 40 cm high, with a base side length of 45 cm. The bottom surface of the open field was divided into nine equal-area regions, including a central region. A camera was mounted 2 meters above the chamber, covering the entire open field. The experiment was conducted in a dimly lit environment and under quiet conditions. Before the formal testing, the mice underwent a one-day training period, during which they were allowed to move freely in the open field for 5 minutes. After training, the mice were placed in the central compartment, and video recording and timing were performed simultaneously for 5 minutes. The activity status of the animals over this period was analyzed using a computer-aided tracking and analysis system.

[0175] 2. Experimental Results

[0176] Quantitative data from the open field test over 5 minutes showed that, compared with the saline control group, the MPTP-induced model group mice exhibited bradykinesia and fewer movements in the central region during the open field test. Mice in the MPTP+C / P / HCR, MPTP+BC / HCR, and MPTP+BC / P / HCR groups, which received nanomedicine administration, showed a trend towards improved motor function, especially the MPTP+BC / P / HCR group, which showed significant improvement in motor behavior. Figure 22 and Figure 23 ).

[0177] III. Rotating Rod Experiment

[0178] 1. Experimental Methods

[0179] The six groups of mice were subjected to the rotarod experiment. The mice were placed on a rotating rod with a diameter of 3 cm, and the rotation speed was adjusted to 30 r / min. Five mice were tested simultaneously each time, one in each compartment. The time elapsed from the start of the rotarod's rotation to the moment the mouse fell off was recorded. The measurement time was 1 minute, with a 1-minute rest between each test, for a total of 5 tests. The number of times the mouse fell off within 1 minute was recorded.

[0180] 2. Experimental Results

[0181] In the rotator bar experiment, latency was used as the observation indicator. From the experimental results ( Figure 24 It can be seen that, compared with the saline control group, the motor coordination ability of the MPTP model group mice was significantly reduced. The latency of the MPTP+BC / P / HCR group mice on the rotarod was significantly prolonged.

[0182] IV. Pole Climbing Experiment

[0183] 1. Experimental Methods

[0184] The six groups of mice were subjected to a pole-climbing experiment. Mice were placed on a small, rough wooden ball, the lower end of which was attached to a 0.5m long, 1cm diameter pole wrapped in gauze for easy gripping. The lower end of the pole was placed in the mouse cage. Before the formal test, each group of mice underwent two days of training, descending from the top of the pole into the cage. On the first day of training, the mice underwent three trials. In the first trial, the mice were placed headfirst on the floor at one-third of the distance; in the second trial, they were placed at two-thirds of the distance; and in the third trial, they were placed at the top. On the second day of training, the mice underwent three trials, descending headfirst from the top of the pole. On the test day, the mice were placed headfirst on the top of the pole and allowed to descend back into the cage at set times. Timing began when the mice were released and ended when one hind leg reached the bottom of the cage. Each mouse was measured three times, and each group was repeated six times. The time taken for each group of mice to descend from the top to the bottom of the pole (T-total) was recorded.

[0185] 2. Experimental Results

[0186] The pole climbing test can reflect the motor coordination ability of mice, and the results are as follows: Figure 25 As shown in the figure, compared with the saline control group, the MPTP model group mice exhibited certain motor impairments, with a significantly increased descent and crawling time. However, the MPTP+BC / P / HCR group mice showed a significantly shorter crawling time compared to the MPTP model group mice, indicating that it improved the bradykinesia symptoms in the model mice.

[0187] Example 12 Biocompatibility testing using HE staining method

[0188] I. Experimental Methods

[0189] Hematoxylin-eosin staining (HE staining) is a method where hematoxylin, an alkaline dye, stains chromatin in the cell nucleus and nucleic acids in the cytoplasm a purplish-blue color, while eosin, an acidic dye, stains components in the cytoplasm and extracellular matrix red. HE staining is used to assess the toxic effects of the particles on various major organs. Mice in the following groups (Sample Control Group, MPTP+C / P / HCR Group, MPTP+BC / HCR Group, and MPTP+BC / P / HCR Group) were sacrificed after treatment. Heart, liver, spleen, lung, and kidney were collected and fixed in 4% paraformaldehyde for 24 hours. Paraffin sections were then prepared, and subsequent procedures were performed as follows:

[0190] First, dewax the product with xylene for 15 minutes. Then, soak it in a xylene:anhydrous ethanol ratio of 1:1 for 2 minutes.

[0191] Then, soak in 80% and 100% ethanol for 5 minutes each. Rinse with distilled water for 5 minutes, stain with hematoxylin for 5 minutes, rinse with tap water for 5-10 minutes, soak in 1% hydrochloric acid ethanol for 30 seconds, rinse with tap water for 30 seconds, and finally rinse with distilled water for 5 seconds. Next, stain with 0.5% eosin for 1-3 minutes, distilled water for 30 seconds, 80% ethanol for 30 seconds, 95% ethanol for 2 minutes, anhydrous ethanol for 3 minutes, and xylene for 3 minutes. Dehydrate, clear, mount, and observe under a microscope. Finally, collect whole blood from each group of mice for complete blood count analysis to determine whether the particles induce an inflammatory response.

[0192] II. Experimental Results

[0193] To investigate the biocompatibility of nanomedicines, the major organs (heart, liver, spleen, lung, and kidney) of mice in each treatment group were stained with hematoxylin and eosin (HE) to observe whether there were any changes in the morphology of the organs. The results are as follows: Figure 26 As shown, the cell nuclei of the major organs in the mice of each treatment group were clearly visible, and no pathological changes such as nuclear pyknosis and necrosis were observed. Therefore, the results indicate that the BC / P / HCR nanoparticles prepared in Example 1 did not cause significant toxic side effects during treatment, have good biocompatibility, and can be used for in vivo disease treatment.

[0194] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for preparing borneol-modified carboxymethyl chitosan nanoparticles, characterized in that, Includes the following steps: Preparation of HCR conjugates: Hyaluronic acid, curcumin and rosmarinic acid react to generate HCR conjugates; Preparation of BC conjugate: Borneol reacts with 3,3′-dithiodipropionic acid to obtain an intermediate; then, the intermediate reacts with carboxymethyl chitosan to generate BC conjugate; Preparation of BC / P / HCR nanoparticles: HCR conjugates, BC conjugates, and plasmids were mixed and reacted to obtain BC / P / HCR nanoparticles. The structural formula of the HCR conjugate is as follows: ； The structural formula of the BC coupling is: ； The ratio of plasmid, HCR conjugate, and BC conjugate by mass is 1:(10-20):(10-20).

2. The preparation method according to claim 1, characterized in that, In the preparation of HCR conjugates, hyaluronic acid, curcumin and rosmarinic acid react to generate HCR conjugates in the presence of catalysts DMAP and EDC.

3. The preparation method according to claim 1, characterized in that, In the preparation of HCR conjugates, the molar ratio of hyaluronic acid, curcumin and rosmarinic acid is 1:(0.5-1.5):(0.5-1.5).

4. The preparation method according to claim 1, characterized in that, In the preparation of BC couplings, borneol reacts with 3,3′-dithiodipropionic acid as an intermediate in the presence of the catalyst DMAP.

5. The preparation method according to claim 1, characterized in that, In the preparation of BC couplings, the molar ratio of borneol to 3,3′-dithiodipropionic acid is 1:(0.5-1.5).

6. The preparation method according to claim 1, characterized in that, In the preparation of BC conjugates, the molar ratio of intermediate to carboxymethyl chitosan is 1:(0.5-1.5).

7. Nanoparticles prepared by any of the preparation methods described in claims 1 to 6.

8. The use of the nanoparticles of claim 7 in the preparation of a drug for treating Parkinson's disease.

Images