Recombinant dna molecules encoding coronavirus antigens, dna vaccines and uses

Abstract

The present application relates to the field of biotechnology, in particular to a recombinant DNA molecule encoding a coronavirus antigen, a DNA vaccine and application. The present application recombines a nucleic acid molecule encoding the RBD region of SARS-CoV S protein and a nucleic acid molecule encoding the RBD region of S protein of the new coronavirus SARS-CoV-2 Omicron mutant strain, the polypeptide encoded by the recombinant nucleic acid molecule has the dual immunogenicity of the RBD region of SARS-CoV S protein and the RBD region of S protein of the new coronavirus SARS-CoV-2 Omicron mutant strain, when the polypeptide with dual immunogenicity is used as the immune effector component of the vaccine, the induced neutralizing antibodies can form an immune response to the RBD region of SARS-CoV S protein and the RBD region of S protein of the new coronavirus SARS-CoV-2 Omicron mutant strain, and can induce specific humoral and cellular immune responses.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to DNA molecules encoding coronavirus antigens, DNA vaccines, and their applications. Background Technology

[0002] Coronaviruses belong to the family Coronaviridae, which includes four genera: alpha-coronavirus, beta-coronavirus, gamma-coronavirus, and delta-coronavirus. The currently circulating novel coronavirus (Severe acute respiratory syndrome coronavirus 2, SARS-CoV-2) belongs to the beta-coronavirus genus. It is mainly transmitted through respiratory droplets and can also be transmitted through contact, causing pneumonia (Novel Coronavirus-infected Pneumonia, NCP). The general population is susceptible to it.

[0003] Currently, the World Health Organization classifies COVID-19 mutant strains into two main categories: VOC (Various Concerns) and VOI (Various Indications of Concern). To date, there are five VOC mutant strains: Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and Omicron (B.1.1.529); and eight VOI mutant strains: Epsilon (B.1.427 / 429), Zeta (P.2), Theta (P.3), Eta (B.1.525), Iota (B.1.526), ​​Kappa (B.1.617.1), Lambda (C.37), and Mu (B.1.621). In particular, the recently emerging Omeprone variant has exhibited over 30 mutations in the Spike region of its main protective antigen, with 15 mutation sites in the receptor-binding domain (RBD), 11 of which are in the receptor-binding motif (RBM) region. These include three mutations previously observed in beta and gamma mutants: 417, 484, and 501. N501Y is also present in the alpha mutant. Current research indicates that most RBD antibodies bind to the RBM region, and mutations in the RBM region can easily affect antibodies bound to these regions, leading to escape. Notably, four additional mutation sites outside the RBM region are located at the interaction interface of the S monomer, potentially affecting trimer stability. Furthermore, of the 15 mutations, nine sites are not conserved between SARS-CoV-2S and SARS-CoV S, indicating that the majority of mutations occur in non-conserved regions. Meanwhile, mutation sites in the N-terminal domain (NTD) are concentrated in four areas: A67V / Del69-70; T95I; G142D / Del143-145; and Del211 / L212I. These four sites are structurally located on the NTD surface and are also common recognition sites for SARS-CoV-2 NTD antibodies. Therefore, simultaneous mutations at these sites can affect the affinity and neutralizing activity of NTD antibodies. Based on current understanding of the mutation sites, this variant has broken through the protection of most neutralizing antibodies. Some preliminary data indicate that this variant reduces the neutralizing antibody level of SARS-CoV-2 vaccines by about 40 times compared to the wild type. Given the frequent emergence of various variants and the super-spreading ominkjong, developing a broad-spectrum vaccine that can "respond to all changes with the same approach" is an effective means of dealing with the frequent emergence of variants.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] One of the objectives of this invention is to provide a recombinant nucleic acid molecule encoding SARS-CoV and SARS-CoV-2 viral antigens, with the expectation of achieving a broad-spectrum immune effect that is "unchanging in the face of all changes".

[0006] The second objective of this invention is to provide biological materials comprising the above-mentioned recombinant nucleic acid molecules.

[0007] The third objective of this invention is to provide applications of the aforementioned biomaterials.

[0008] The fourth objective of this invention is to provide a DNA vaccine for SARS-CoV and / or SARS-CoV-2 viruses comprising the above-mentioned recombinant nucleic acid molecules and / or biological materials.

[0009] The fifth objective of this invention is to provide a method for preparing the aforementioned DNA vaccine.

[0010] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solutions:

[0011] In a first aspect, the present invention provides a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising any one of the following (a) to (c):

[0012] (a) The recombinant DNA molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Omicron mutant strain.

[0013] (b) A DNA molecule derived from (a) in which one or more nucleotides are substituted, deleted or added to the nucleotide sequence of the recombinant DNA molecule defined in (a) and which functions to encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Omicron mutant S protein.

[0014] (c) Nucleic acid molecules that hybridize under stringent conditions with the nucleotide sequence of a recombinant DNA molecule defined in (a) or a DNA molecule defined in (b) and that encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Omicron mutant S protein.

[0015] In an optional embodiment, the amino acid sequence encoded by the first DNA molecule is shown in SEQ ID No. 1; and the amino acid sequence encoded by the second DNA molecule is shown in SEQ ID No. 2.

[0016] In an optional embodiment, the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID No. 3; and the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID No. 4.

[0017] Preferably, the nucleotide sequence of the recombinant nucleic acid molecule is as shown in SEQ ID No. 5, or has at least 90% identity with the nucleotide sequence shown in SEQ ID No. 5, and encodes the nucleotide sequence of the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region.

[0018] In a second aspect, the present invention provides biological materials, including:

[0019] (I) A construct comprising the recombinant nucleic acid molecule described in any of the foregoing embodiments; and a third nucleic acid molecule encoding a signal peptide attached to the 5' end of the recombinant nucleic acid molecule;

[0020] (II) A recombinant expression vector, comprising an original expression vector; and, inserting a coding nucleic acid fragment into the original expression vector, wherein the coding nucleic acid fragment is selected from the recombinant nucleic acid molecule described in any of the foregoing embodiments or the construct described in (I); preferably, the original expression vector is a pVAX1 plasmid;

[0021] (III) A transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from insect cells, yeast, avian cells or mammalian cells; preferably, the host cell is HEK293, CHO or COS-7;

[0022] (IV) A polypeptide, including a polypeptide encoded by a recombinant nucleic acid molecule as described in any of the foregoing embodiments, a polypeptide encoded by the construct described in (I), or a polypeptide obtained by expression of a transformant described in (III);

[0023] (V) An antibody that specifically binds to the polypeptide described in (IV).

[0024] In an optional embodiment, the signal peptide encoded by the third nucleic acid molecule includes the following (c) or (d):

[0025] (c) The signal peptide with the amino acid sequence shown in SEQ ID No. 6;

[0026] (d) A signal peptide derived from (c) that has one or more amino acids substituted, deleted or added to the amino acid sequence of the signal peptide defined in (c) and has the function of a signal peptide.

[0027] Thirdly, the present invention provides the use of the recombinant nucleic acid molecule or the biological material described in any of the foregoing embodiments in the following (A) or (B):

[0028] (A) To prepare vaccines for the prevention and / or treatment of SARS-CoV and / or SARS-CoV-2 virus infection;

[0029] (B) To prepare drugs for the prevention and / or treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 viruses.

[0030] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.

[0031] Fourthly, the present invention provides a DNA vaccine, which includes the recombinant nucleic acid molecule described in any of the foregoing embodiments or the recombinant expression vector described in any of the foregoing embodiments.

[0032] In an optional embodiment, the DNA vaccine further includes at least one of a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient;

[0033] And / or, at least one drug that has therapeutic effects against SARS-CoV and / or SARS-CoV-2 virus;

[0034] Preferably, the adjuvant includes at least one of aluminum adjuvant, TLR ligand, metal ion, cytokine or chemokine adjuvant;

[0035] More preferably, the metal ion includes Mn 2+ and / or Zn 2+ .

[0036] In an optional embodiment, the recombinant nucleic acid molecule or the recombinant expression vector described in any of the foregoing embodiments is introduced into a host cell and cultured, and the recombinant nucleic acid molecule or recombinant expression vector is extracted from the host cell to obtain a DNA vaccine.

[0037] Fifthly, the present invention provides the application of the DNA vaccine described in the foregoing embodiments in the following (i) to (iv):

[0038] (i) Regulate the body's immune function;

[0039] (ii) Anti-SARS-CoV-2 virus infection;

[0040] (iii) Anti-SARS-CoV virus infection;

[0041] (iv) Prevent immunopathological damage.

[0042] Preferably, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.

[0043] In a sixth aspect, the present invention provides a method for preventing and / or treating mammalian infection with SARS-CoV and / or SARS-CoV-2 virus, the method comprising inoculating the mammal with the aforementioned DNA vaccine.

[0044] Preferably, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.

[0045] Preferably, the mammal is a human.

[0046] This invention recombines a nucleic acid molecule encoding the RBD region of the SARS-CoV S protein with a nucleic acid molecule encoding the RBD region of the SARS-CoV-2 Omicron mutant S protein. The polypeptide encoded by the recombinant nucleic acid molecule possesses dual immunogenicity against both the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region. When this dual-immunogenic polypeptide is used as an immune effector component of a vaccine, the induced neutralizing antibody can simultaneously induce an immune response against both the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region. Furthermore, by employing a dual-antigen design targeting the distantly related SARS-CoV and SARS-CoV-2, the conserved antigenic epitopes against the β-coronavirus genus are amplified to maximize the immune effect, thereby avoiding antigenic drift caused by continuous mutations within the SARS-CoV-2 family and achieving a broad-spectrum immune effect that is "unchanging in the face of all changes." Meanwhile, the tandem sequence of SARS-OmicronRBD selected in the protein domain tandem strategy, compared with the tandem sequence of Omicron-SARS RBD, keeps the two antigen domains of SARS RBD and Omicron RBD far apart, and the corresponding domains can be fully exposed. The more fully the antigen domains are exposed, the more complete the corresponding antibody response spectrum will be and the better the immune effect will be.

[0047] Based on the beneficial effects of the aforementioned recombinant nucleic acid molecules, this invention also provides a method for preparing the aforementioned recombinant nucleic acid molecules, the biological materials used in preparing the aforementioned recombinant nucleic acid molecules, and the polypeptides expressed by the aforementioned recombinant nucleic acid molecules. Simultaneously, it provides a DNA vaccine using the aforementioned biological materials as the main immune component and its preparation method. Verification has shown that this DNA vaccine not only effectively transcribes and expresses in mammalian cells but also exhibits good immunogenicity. For humoral immune responses, this DNA vaccine can significantly stimulate experimental animals to produce antigen-specific antibodies, generating antibodies not only against the wild-type antigen of SARS-CoV-2 but also against the Delta mutant antigen, Beta mutant antigen, Omicron mutant antigen, and SARS-CoV antigen, and exhibiting good neutralizing activity. For cellular immune responses, against the wild-type antigen of SARS-CoV-2 and the Omicron mutant antigen, this DNA vaccine can induce high levels of antigen-specific CD4 IFNγ and CD4 TNF-α T cell subsets. Furthermore, this DNA vaccine can effectively prevent or inhibit the replication of the Omicron mutant SARS-CoV-2 virus in vivo, demonstrating excellent vaccine protection. The above experiments all demonstrate that this DNA vaccine has good immunogenicity and broad-spectrum activity.

[0048] Based on this, the DNA vaccine provided by the present invention can modulate the body's immune function, effectively prevent infection by SARS-CoV and / or SARS-CoV-2 virus and its mutant strains, and also intervene in the treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 virus and its mutant strains. Attached Figure Description

[0049] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0050] Figure 1 This is a graph showing the DNA sequence codon optimization index scoring results provided in Embodiment 1 of the present invention;

[0051] Figure 2 This is a graph showing the GC content scoring results of the optimized DNA sequence provided in Example 1 of the present invention;

[0052] Figure 3 This is a graph showing the scoring results of the number of negative regulatory elements after DNA sequence optimization provided in Embodiment 1 of the present invention;

[0053] Figure 4This is a graph showing the fold change of qPCR expression after DNA sequence optimization provided in Example 1 of the present invention;

[0054] Figure 5 This is a structural diagram of the binding protein provided in Embodiment 1 of the present invention;

[0055] Figure 6 The results of qPCR expression of the wild-type SARS-CoV-2 and broad-spectrum candidate DNA vaccine provided in Example 3 of this invention;

[0056] Figure 7 The results of antigen-specific antibodies on day 14 after primary immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 4 of this invention;

[0057] Figure 8 The results of antigen-specific antibodies on day 14 after booster immunization with the wild-type COVID-19 and broad-spectrum candidate DNA vaccine provided in Example 4 of this invention;

[0058] Figure 9 The results of neutralizing antibodies on day 14 after booster immunization with the broad-spectrum candidate DNA vaccine for coronavirus provided in Example 4 of this invention;

[0059] Figure 10 The results of the comparison of neutralizing antibodies on day 14 after booster immunization of each vaccine provided in Example 4 of the present invention;

[0060] Figure 11 The results of antigen-specific CD4 IFN-γ T cell subsets on day 14 after booster immunization with the wild-type SARS-CoV-2 and broad-spectrum candidate DNA vaccine provided in Example 4 of this invention;

[0061] Figure 12 The results of antigen-specific CD4 TNF-α T cell subsets on day 14 after booster immunization with the wild-type SARS-CoV-2 and broad-spectrum candidate DNA vaccine provided in Example 4 of this invention;

[0062] Figure 13 The results of antigen-specific antibodies on day 17 after booster immunization with the broad-spectrum candidate DNA vaccine for coronavirus provided in Example 5 of this invention;

[0063] Figure 14 The results of neutralizing antibodies against the Omicron BA.1 mutant strain of SARS-CoV-2 on day 17 after booster immunization with the broad-spectrum candidate DNA vaccine for coronavirus provided in Example 5 of this invention;

[0064] Figure 15 The results of neutralizing antibodies against the Omicron BA.2 mutant strain of SARS-CoV-2 on day 17 after booster immunization with the broad-spectrum candidate DNA vaccine for coronavirus provided in Example 5 of this invention;

[0065] Figure 16 This is the result of gRNA detection in the lungs of mice after being challenged by the novel coronavirus Omicron BA.1 mutant strain provided in Example 5 of this invention;

[0066] Figure 17 The results are from the detection of sgRNA in the lungs of mice after being attacked by the novel coronavirus Omicron BA.1 mutant strain provided in Example 5 of this invention. Detailed Implementation

[0067] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature and laboratory procedures and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry described herein are those well known and commonly used in the art.

[0068] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0069] It should be noted that similar reference numerals and letters in the following figures indicate similar items; therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures. Furthermore, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.

[0070] In one specific embodiment, in a first aspect, the present invention provides a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising any one of the following (a) to (c):

[0071] (a) The recombinant DNA molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Omicron mutant strain.

[0072] (b) A DNA molecule derived from (a) in which one or more nucleotides are substituted, deleted or added to the nucleotide sequence of the recombinant DNA molecule defined in (a) and which functions to encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Omicron mutant S protein.

[0073] (c) Nucleic acid molecules that hybridize under stringent conditions with the nucleotide sequence of a recombinant DNA molecule defined in (a) or a DNA molecule defined in (b) and that encode the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Omicron mutant S protein.

[0074] It should be noted that this invention does not limit the connection order of the first and second DNA molecules. In some embodiments, the recombinant nucleic acid molecule includes a first DNA molecule and a second DNA molecule connected sequentially from the 5' end to the 3' end. In other embodiments, the recombinant nucleic acid molecule obtained by changing the order of the first and second DNA molecules can still have broad-spectrum immunogenicity. Those skilled in the art can select the connection order of the first and second DNA molecules according to specific experimental conditions and actual needs. The connection methods given in the embodiments of this invention are only examples and not restrictions on the connection order.

[0075] It is understood that the hybridization of the recombinant nucleic acid molecule (c) with the recombinant DNA molecule (a) or DNA molecule (b) under "strict conditions" refers to the recombinant nucleic acid molecule (c) obtained by hybridization using the recombinant DNA molecule (a) or DNA molecule (b) as a template, strictly following the base pairing principle. Furthermore, those skilled in the art should recognize that the recombinant nucleic acid molecule (c) includes both replicated DNA molecules and various RNA molecules transcribed from DNA.

[0076] Furthermore, the nucleotide sequence provided by this invention is obtained by optimizing a unique codon optimization system.

[0077] In an optional embodiment, the amino acid sequence encoded by the first DNA molecule is shown in SEQ ID No. 1; and the amino acid sequence encoded by the second DNA molecule is shown in SEQ ID No. 2.

[0078] It should be noted that the SARS-CoV S protein RBD region fragment and the SARS-CoV-2 Omicron mutant S protein RBD region fragment influence each other during polypeptide spatial conformation folding. The tandem sequence of the SARS-Omicron RBD, compared to the Omicron-SARS RBD, keeps the two antigenic domains of the SARS RBD and Omicron RBD further apart, allowing for sufficient exposure of the corresponding domains. The more fully the antigenic domains are exposed, the more complete the corresponding antibody response spectrum will be, resulting in a better immune effect. SEQ ID No. 1 and SEQ ID No. 2 mentioned above represent the optimal combination sequences of the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region, chosen for their functional integrity and minimal mutual interference, aiming to achieve broad-spectrum and long-lasting immunogenicity. Based on the above description, it can be understood that there are other types of derivative polypeptides that can be used to encode the SARS-CoV S protein RBD region of the first DNA molecule of the present invention, such as those derived from the 5' and / or 3' ends of SEQ ID No. 1 by deleting or adding one or more amino acids. Similarly, the SARS-CoV-2 Omicron mutant S protein RBD region that can be used to encode the second DNA molecule of the present invention also includes derivative polypeptides derived from the 5' and / or 3' ends of SEQ ID No. 1 by deleting or adding one or more amino acids.

[0079] In an optional embodiment, the nucleotide sequence of the first nucleic acid molecule is shown in SEQ ID No. 3; and the nucleotide sequence of the second nucleic acid molecule is shown in SEQ ID No. 4.

[0080] Preferably, the nucleotide sequence of the recombinant nucleic acid molecule is as shown in SEQ ID No. 5, or has at least 90% identity with the nucleotide sequence shown in SEQ ID No. 5, and encodes the nucleotide sequence of the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region.

[0081] It is understood that, in this invention, “identity” refers to the similarity between nucleotide sequences, including nucleotide sequences that have at least 90% (e.g., but not limited to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) identity with the nucleotide sequence shown in SEQ ID NO.5 of this invention.

[0082] In a second aspect, the present invention provides biological materials, including:

[0083] (I) A construct comprising the recombinant nucleic acid molecule described in any of the foregoing embodiments; and a third nucleic acid molecule encoding a signal peptide attached to the 5' end of the recombinant nucleic acid molecule;

[0084] (II) A recombinant expression vector, comprising an original expression vector; and, inserting a coding nucleic acid fragment into the original expression vector, wherein the coding nucleic acid fragment is selected from the recombinant nucleic acid molecule described in any of the foregoing embodiments or the construct described in (I); preferably, the original expression vector is a pVAX1 plasmid;

[0085] (III) A transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from insect cells, yeast, avian cells or mammalian cells; preferably, the host cell is HEK293, CHO or COS-7;

[0086] (IV) A polypeptide, including a polypeptide encoded by a recombinant nucleic acid molecule as described in any of the foregoing embodiments, a polypeptide encoded by the construct described in (I), or a polypeptide obtained by expression of a transformant described in (III);

[0087] (V) An antibody that specifically binds to the polypeptide described in (IV), such as a monoclonal antibody or a polyclonal antibody.

[0088] It should be noted that the aforementioned original expression vector can be a eukaryotic expression vector, which generates the protein encoded by the DNA molecule through cellular transcription and translation mechanisms. Optionally, the original expression vector may have expression signals, such as a strong promoter, a strong stop codon, regulation of the distance between the promoter and the cloning gene, and insertion of a transcription termination sequence. Preferably, the eukaryotic expression vector includes pVAX1, but is not limited to any other expression vector capable of expressing DNA and enabling cells to translate the sequence into an antigen recognized by the immune system.

[0089] The host cells described above are merely typical preferred cells provided by this invention. Those skilled in the art may select other suitable host cells, not limited to eukaryotic or prokaryotic cells, based on actual experimental conditions or actual needs.

[0090] It is understood that the biomaterials provided by this invention can all be directly applied as biomodules in production for different needs and scenarios.

[0091] In an optional embodiment, the signal peptide encoded by the third nucleic acid molecule includes the following (c) or (d):

[0092] (c) The signal peptide with the amino acid sequence shown in SEQ ID No. 6;

[0093] (d) A signal peptide derived from (c) that has one or more amino acids substituted, deleted or added to the amino acid sequence of the signal peptide defined in (c) and has the function of a signal peptide.

[0094] The aforementioned signal peptides are signal peptides that match the efficient expression of SARS-CoV and SARS-CoV-2 viral genes, and can significantly improve the expression efficiency of this recombinant nucleic acid molecule in the host.

[0095] Thirdly, the present invention provides the use of the recombinant nucleic acid molecule or the biological material described in any of the foregoing embodiments in the following (A) or (B):

[0096] (A) To prepare vaccines for the prevention and / or treatment of SARS-CoV and / or SARS-CoV-2 virus infection;

[0097] (B) To prepare medicines for the prevention and / or treatment of diseases caused by SARS-CoV and / or SARS-CoV-2 viruses, including lung damage, brain damage, liver and kidney damage or heart damage.

[0098] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.

[0099] Fourthly, the present invention provides a DNA vaccine, which includes the recombinant nucleic acid molecule described in any of the foregoing embodiments or the recombinant expression vector described in any of the foregoing embodiments.

[0100] This DNA vaccine not only exhibits effective transcriptional expression in mammalian cells but also demonstrates excellent immunogenicity. Regarding humoral immune responses, it significantly stimulates the production of antigen-specific antibodies in experimental animals, generating antibodies against not only the wild-type SARS-CoV-2 antigen but also those against the Delta mutant strain, Beta mutant strain, Omicron mutant strain, and SARS-CoV antigen, exhibiting good neutralizing activity. Regarding cellular immune responses, the DNA vaccine induces high levels of antigen-specific CD4 IFNγ and CD4 TNF-α T cell subsets against both the wild-type and Omicron mutant strains. Furthermore, it effectively inhibits or prevents the replication of the Omicron mutant SARS-CoV-2 virus in vivo, demonstrating excellent vaccine protection. These experiments all demonstrate the good immunogenicity and broad-spectrum activity of this DNA vaccine.

[0101] In some embodiments, the DNA vaccine further includes at least one of a pharmaceutically acceptable adjuvant, carrier, diluent, or excipient to enhance the ability of its active ingredient, the DNA molecule, to generate an immune response in a subject. The adjuvant includes at least one of aluminum adjuvants, TLR ligands, metal ions, cytokines, or chemokine adjuvants; preferably, the metal ion includes Mn. 2+ and / or Zn 2+ .

[0102] In other embodiments, the DNA vaccine further includes at least one drug that has therapeutic effects against SARS-CoV and / or SARS-CoV-2 viruses to enhance the therapeutic effect of the vaccine against diseases caused by SARS-CoV and / or SARS-CoV-2 viruses.

[0103] In some embodiments, the DNA vaccine also includes at least one of the pharmaceutically acceptable adjuvants, carriers, diluents or excipients and at least one drug that has therapeutic effects on SARS-CoV and / or SARS-CoV-2 virus.

[0104] In an optional embodiment, the recombinant nucleic acid molecule or the recombinant expression vector described in any of the foregoing embodiments is introduced into a host cell and cultured, and the recombinant nucleic acid molecule or recombinant expression vector is extracted from the host cell to prepare a DNA vaccine.

[0105] Fifthly, the present invention provides a method for preventing and / or treating mammalian infection with SARS-CoV and / or SARS-CoV-2 virus, the method comprising inoculating the mammal with the aforementioned DNA vaccine.

[0106] In an optional implementation, the SARS-CoV-2 virus includes a wild-type strain, a B.1.617.2 mutant strain, a B.1.1.7 mutant strain, a B.1.351 mutant strain, a P.1 mutant strain, a B.1.2 mutant strain, a B.1 mutant strain, a B.1.621 mutant strain, a B.1.525 mutant strain, a B.1.526 mutant strain, a C.37 mutant strain, a B.1.617.1 mutant strain, or a B.1.1.529 mutant strain.

[0107] In an alternative implementation, the mammal is a human.

[0108] The mechanism of action of the DNA vaccine provided by this invention is as follows: An optimized nucleotide sequence encoding the RBD region of the SARS-CoV S protein is tandemly linked with an optimized nucleotide sequence encoding the RBD region of the SARS-CoV-2 Omicron mutant S protein. A highly efficient expression signal peptide is added, and the sequence is inserted into a eukaryotic expression vector. This vector is then introduced into host cells, enabling efficient expression of viral antigens within the host cells. Through antigen presentation, the systemic antiviral humoral and cellular immune responses are activated. The antibodies produced by the activated humoral immune response can prevent viral invasion, and the activated cellular immune response can further clear virus-infected cells and regulate adverse reactions caused by potential ADE (antibody-dependent enhancement) side effects.

[0109] Based on the above-described mechanism of action, the present invention also provides applications of the aforementioned DNA vaccine, including:

[0110] (i) Regulate the body's immune function;

[0111] (ii) Anti-SARS-CoV-2 virus infection;

[0112] (iii) Anti-SARS-CoV virus infection;

[0113] (iv) Prevent immunopathological damage.

[0114] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other.

[0115] Example 1: Nucleic acid optimization screening encoding the RBD region of the S protein

[0116] In order to increase the expression of target proteins in host cells, the nucleic acid sequence of the target gene needs to be optimized. The general principle of nucleic acid sequence optimization is as follows: (1) Optimize degenerate codons according to the host cell’s preference for nucleic acid codons so that the optimized sequence contains more nucleic acid codons that are easy for the host cell to recognize; (2) Further optimize the GC content in the nucleic acid sequence based on the codon preference optimization so that the GC content optimized sequence can express more target proteins; (3) Optimize the nucleic acid sequence so that it can transcribe more stable mRNA, which is beneficial to the translation of target proteins; (4) Change the frequency of codons that are preferred by the host and increase the CAI index (codon fitness index). This application optimizes the nucleotide sequences encoding the RBD region of the SARS-CoV S protein and the RBD region of the SARS-CoV-2 Omicron mutant S protein by adjusting the GC content in the nucleotide sequences, changing the frequency of host-preferred codons, increasing the CAI (codon fitness index), reducing the free energy for RNA secondary structure formation, reducing the proportion of negative CIS elements, and decreasing the proportion of repetitive sequences in the sequence. In addition, it optimizes the signal peptide and combines it with the company's proprietary algorithm developed from the inventors' many years of experience in this field, thereby further improving its expression level, obtaining the optimized nucleotide sequence, and then using it to make a nucleic acid vaccine.

[0117] Optimization process: The nucleotide sequence of the wild-type SARS-CoV S protein RBD region before optimization (AY278488, GenBank) was optimized according to the optimization strategy of the present invention to obtain the nucleotide sequence shown in SEQ ID No. 3. The nucleotide sequence of the wild-type SARS-CoV-2 Omicron mutant S protein RBD region before optimization (EPI_ISL_6640917, GISAID) was optimized according to the optimization strategy of the present invention to obtain the nucleotide sequence shown in SEQ ID No. 4. SEQ ID No. 3 and SEQ ID No. 4 were directly concatenated, and the nucleotide sequence encoding the signal peptide shown in SEQ ID No. 7 was added to the N-terminus of SEQ ID No. 3, and the TGATAA stop codon was added to the C-terminus of SEQ ID No. 4, finally obtaining the nucleotide sequence shown in SEQ ID No. 5. The nucleotide sequence shown in SEQ ID No. 9 was finally obtained by using the optimization strategy of the conventional commercial database (Integrated DNA Technologies, IDT). The nucleotide sequences of the wild-type sequence before optimization, SEQ ID No. 5 after optimization, and SEQ ID No. 9 obtained through conventional commercial optimization were scored. Regarding the increase in expression through DNA sequence optimization, the optimization effect was positively correlated with key DNA optimization indicators such as codon optimization index, GC content, and the number of negative regulatory elements. Figures 1-3 As shown, the optimization strategy adopted in this invention has a significant improvement in key indicators compared with conventional commercial optimization strategies, which indicates that the optimization strategy adopted in this invention can increase the expression efficiency of optimized genes.

[0118] The three nucleotide sequences of the unoptimized wild-type sequence, the optimized SEQ ID No. 5 of this invention, and SEQ ID No. 9 obtained from a conventional commercial database were respectively transformed and constructed into the pVAX1 vector (ThermoFisher, catalog number: V26020), resulting in three plasmid DNAs: pSARS-Omicron Dimer-wild-type, pSARS-Omicron Dimer, and pSARS-Omicron Dimer-conventionally optimized. After transfecting the three plasmids into HEK293T cells for 48 hours, RNA was extracted, and the transcription level of the plasmid DNA obtained by different optimization methods was identified using qPCR. The results are as follows: Figure 4As shown, the optimized DNA sequence of this invention can increase RNA transcription by more than 100 times compared to the wild-type sequence before optimization, and by more than 2.5 times compared to molecules conventionally optimized from commercial databases. This further demonstrates that the nucleic acid molecules optimized by this invention are superior to those obtained from conventional commercial databases. Increased transcription levels in DNA vaccines can lead to increased protein expression, thereby improving the immunogenicity of DNA vaccines. The sequence designed and obtained by this invention achieves a very significant increase in transcription levels, and its protein expression is also significantly improved, resulting in a significantly better immunogenicity.

[0119] When designing and optimizing nucleotide sequences, the first consideration was to use coronaviruses of the β genus for tandem design of nucleic acid sequences. β genus coronaviruses include Severe Respiratory Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and SARS-CoV-2. Since MERS-CoV binds to CD26 (DPP4) as its host binding receptor, while SARS-CoV and SARS-CoV-2 bind to ACE2, and based on virological and immunological predictions, significant differences in receptor structure were expected to result in weaker immune responses against SARS-CoV-2, a tandem design of the RBD regions of the S proteins of SARS-CoV and SARS-CoV-2 was adopted. Furthermore, it was considered that different protein domain tandem strategies would affect the exposure level of antigen domains; the more sufficient the exposure of antigen domains, the more complete the corresponding antibody response spectrum would be, and the better the immune effect. Therefore, we analyzed the tandem sequence of the SARS-CoV S protein RBD region (SARS RBD) and the SARS-CoV-2 Omicron mutant S protein RBD region (Omicron RBD) using bioinformatics methods such as artificial intelligence combined with protein structure analysis. Figure 5 As shown, the analysis results indicate that the tandem sequence of SARS-Omicron RBD (Figure A) is more conducive to the separation of the two antigenic domains of SARS RBD and Omicron RBD compared to the tandem sequence of Omicron-SARSRBD (Figure B), and the corresponding domains can be fully exposed. Therefore, it is expected that the tandem strategy of SARS-Omicron RBD in this invention has a better immune effect.

[0120] Example 2: The construction process of a DNA vaccine

[0121] 1. Preparation method of broad-spectrum candidate DNA vaccines for coronaviruses

[0122] 1.1. Construction of plasmids

[0123] The nucleotide sequence encoding the RBD region of the SARS-CoV S protein (from AY278488, GenBank) was designed as shown in SEQ ID No. 3, and the nucleotide sequence encoding the RBD region of the S protein of the SARS-CoV-2 Omicron mutant strain (from EPI_ISL_6640917, GISAID) was designed as shown in SEQ ID No. 4. SEQ ID No. 3 and SEQ ID No. 4 were directly concatenated, and the nucleotide sequence encoding the signal peptide as shown in SEQ ID No. 7 was added to the N-terminus of SEQ ID No. 3, and the TGATAA stop codon was added to the C-terminus of SEQ ID No. 4, resulting in the nucleotide sequence shown in SEQ ID No. 5. SEQ ID No. 5 was inserted between the BamHI and XhoI sites in the pVAX1 vector to obtain the plasmid pSARS-OmicronDimer.

[0124] Based on the wild-type sequence of SARS-CoV-2 (MN908947.3, NCBI), the nucleotide sequence shown in SEQ ID No. 8 was optimized and inserted between the BamHI and XhoI sites of the pVAX1 vector to obtain the wild-type SARS-CoV-2 plasmid (pWT). The pWT wild-type vaccine is a product developed by our company targeting the wild-type strain and has entered Phase III clinical trials, demonstrating excellent immunogenicity.

[0125] 1.2. DNA vaccine sequence conversion

[0126] Take 100 μl of DH10B competent cell suspension from a -80°C freezer and thaw on ice. Add plasmid DNA solution (volume not exceeding 10 μl), gently mix, and incubate on ice for 30 min. Heat shock in a 42°C water bath for 70 seconds, then quickly cool on ice for 5 min. Add 0.9 ml of LB liquid medium (antibiotic-free) to the tube, mix well, and incubate at 37°C with shaking for 45 min to allow the bacteria to return to normal growth. After mixing the above bacterial suspension, take 100 μl and spread it onto a selection plate containing appropriate antibiotics, placing it face up. After the bacterial suspension is completely absorbed by the medium, invert the plate and incubate at 37°C for 12-16 h. Select uniformly shaped single clones, use a sterile pipette tip to detach the clones, and place them in 5 ml of LB selection medium containing 50 mg / mL kanamycin. Incubate overnight at 37°C.

[0127] 1.3. DNA vaccine plasmid extraction

[0128] Add the above bacterial culture to 200–400 ml of LB selective medium containing kanamycin (50 mg / mL stock solution, 1:1000 dilution) at a ratio of 1:1000, and incubate at 37°C and 200 rpm for 12–16 h. Perform plasmid extraction using the EndoFreen Plasmid Maxi kit (QIAGEN, Germany): Centrifuge the bacterial culture (12–16 h) at 8000 rpm for 10 min at 4°C, discard the supernatant, collect the bacterial cells, resuspend the culture in 10 ml of P1 Buffer, then add 10 ml of P2 Buffer and gently invert 4–6 times to mix thoroughly. Incubate at room temperature for 5 min to achieve complete lysis. Add 10 ml of P3 Buffer to the mixture, gently invert 4–6 times to stop lysis, then transfer the entire mixture to a QIA filter cartridge and incubate at room temperature for 10 min. Add the supernatant to the filter cartridge. Transfer the filtrate to a clean, endotoxin-free 50ml centrifuge tube, add 2.5ml ER Buffer, gently invert 10 times to mix, and incubate on ice for 30min. Remove a QIAGEN-tip 500 and add 10ml QBT Buffer to equilibrate the column. Transfer the above liquid to the column and adsorb the plasmid using gravity flow. Wash twice with 30ml QC Buffer, then elute with 15ml QN Buffer. Precipitate each sample with 10.5ml isopropanol and centrifuge at 4000g for 30min at 4℃. Discard the supernatant, wash once with 70% ethanol, and centrifuge at 4000g for 10min at 4℃. Discard the supernatant, air-dry the precipitate, and resuspend the plasmid in 500μl of endotoxin-free water for each sample to obtain the recombinant expression plasmid for DNA vaccine preparation.

[0129] Example 3: Mammalian cell transcription identification of a broad-spectrum candidate DNA vaccine for coronavirus

[0130] To verify whether the plasmid constructed in Example 2 can be effectively transcribed in mammalian cells, it was identified by in vitro DNA transfection, RNA extraction, and qPCR.

[0131] 1. In vitro transfection of DNA vaccines

[0132] The frozen HEK293T cell line was removed from liquid nitrogen, incubated at 37°C, and centrifuged at 1000 rpm for 5 minutes to remove DMSO. The cells were washed once with serum-free DMEM medium and cultured in 5 ml of DMEM medium containing 10% fetal bovine serum at 37°C with 5% CO2 for 2-3 passages. Cells were then digested with trypsin (containing 0.25% EDTA) at 37°C for 1 minute, and the digestion was terminated with complete culture medium. Cells were then sped at 2-4 × 10⁻⁴ times. 6 Cells / wells were spread evenly in 60mm culture dishes, and 5ml of growth medium (without 1% antibiotics) was added. The dishes were then incubated at 37℃ in a 5% CO2 incubator for 24h.

[0133] Two sterile plasmids, 4 μg pSARS-Omicron Dimer and 4 μg pWT, were added to 500 μl of serum-reduced OPTI-MEM medium and gently mixed. At the same time, 24 μl of cationic liposomes (Shanghai Yisheng, 40802ES03) were added to 500 μl of serum-reduced OPTI-MEM medium and gently mixed. The mixture was incubated at room temperature for 5 min. The two plasmids were then mixed with the liposomes at a 1:1 ratio and incubated at room temperature for 20 min to obtain plasmid DNA / liposome complexes.

[0134] The plasmid DNA / liposome complex was added at a rate of 1 ml / plate to the 60 mm culture dish that had been cultured for 24 h, and then incubated at 37 °C in a 5% CO2 incubator for 48 h for subsequent experiments.

[0135] 2. RNA extraction after transfection

[0136] Cells transfected for 48 hours were digested and collected. After resuspending in 1 ml of complete culture medium, 100 μl of the resuspended solution was used for RNA extraction. The remaining resuspended solution was used for subsequent Western blot sample preparation.

[0137] Centrifuge 100 μl of cell suspension at 4000 rpm for 5 minutes, discard the supernatant, and add 350 μl of TRK Lysis Solution (containing 20% ​​β-mercaptoethanol) to each sample for lysis. Then add 350 μl of 70% ethanol (prepared with DEPC water) to each sample to terminate lysis, and mix thoroughly by pipetting.

[0138] Transfer the above mixture to a HiBind RNA column, centrifuge at 10000g for 1 min, and discard the filtrate. Add 500 μl of Wash Buffer I to each sample column, centrifuge at 10000g for 1 min, and discard the filtrate. Add 500 μl of Wash Buffer II to each sample column and wash twice, centrifuging at 10000g for 1 min each time, and discard the filtrate. Adjust the centrifuge speed to the highest speed (17000g) and centrifuge for 2 min to allow the ethanol in the column to evaporate. Transfer the column to a clean 1.5 ml centrifuge tube free of DNA and RNase, incubate at room temperature for 3-5 min to completely evaporate the ethanol, then add 50 μl of RNase-free water to each sample, incubate at room temperature for 5 min, and centrifuge at 17000g for 1 min. Aspirate the filtrate and add it back to the column, incubate at room temperature for 5 min, centrifuge at 17000g for 1 min to collect RNA, and store at -80℃.

[0139] 3. RNA reverse transcription and qPCR reaction

[0140] RNA concentration was quantified using a microplate reader (OD260 / 280 readings were used). The required PCR number was n (n = number of samples + 1 negative control + 1 positive control). For each sample, a 10 μl reaction mixture was prepared (2 μl 5×g DNA digester buffer, 1 μl g DNA digester, 100 ng RNA, adjusted to 10 μl with RNase-free ddH2O). The mixture was gently pipetted and incubated at 42°C for 2 min. Then, 10 μl 2×Hifair II SuperMix plus was added to each sample, gently pipetted and mixed, and incubated at 25°C for 5 min, 42°C for 30 min, and 85°C for 5 min. The collected cDNA was stored at -20°C for later use.

[0141] The cDNA product obtained from reverse transcription was reacted using a qPCR kit. The reaction system is as follows: 10 μl of qPCRSYBR Green Master Mix (No Rox), 0.4 μl each of the target forward and reverse primers (forward primer: 5'AAGCTGAACGACCTGTGCTTCA3', SEQ ID No. 10; reverse primer: 5'GGCAGCTTGTAGTTGTAG3', SEQ ID No. 11), 1 μl of cDNA template, and sterile ultrapure water to a total volume of 20 μl. PCR reaction conditions: 95℃ for 5 min, 95℃ for 10 s, 56℃ for 30 s, and 72℃ for 30 s for a total of 40 cycles. The expression level of the target gene was compared with the internal control using a 2:1 ratio. -△△C Method calculation.

[0142] Conclusion: Figure 6 As shown, both the wild-type COVID-19 candidate DNA vaccine pWT and the broad-spectrum coronavirus candidate DNA vaccine pSARS-Omicron Dimer, after 48 hours of in vitro transfection with the empty vector (pVAX1), could induce high levels of antigen RNA transcription. Furthermore, the RNA transcription level in the broad-spectrum coronavirus candidate DNA vaccine pSARS-Omicron Dimer group was significantly higher than that in the pWT group.

[0143] Example 4: Immunogenicity Validation of Broad-Spectrum Coronavirus Candidate DNA Vaccine

[0144] To evaluate the immunogenicity of the vaccine prepared in Example 2 and the impact of the immunization strategy on humoral and cellular immune responses, specific pathogen-free 6-week-old female C57BL / 6 mice were purchased from Shanghai Slack Pharmaceutical Co., Ltd. and stored in the animal facility of Advaccine Laboratory (Suzhou). For the DNA vaccine administration: the DNA vaccine described in Example 1 was injected sequentially into the anterior femoral muscle according to different grouping doses, followed by an electrical pulse (EP). The EP device consisted of two sets of pulses with a constant current of 0.2 Amp. The second pulse set was delayed by 3 seconds. In each set, there were two 52 ms pulses with a delay of 198 ms between pulses. The first primary immunization was counted as day 0, and the second immunization (booster immunization) was performed on day 14. Experimental groups: (1) Control group vector plasmid pVAX125μg; (2) Experimental group wild-type strain DNA vaccine pWT-25μg; (3) Experimental group coronavirus broad-spectrum DNA vaccine pSARS-Omicron Dimer-25μg; Blood samples were collected from mice on days 14, 21, and 28 to measure specific antibodies in serum. On day 28, the immunized mice were sacrificed to analyze the cellular immune response.

[0145] 1. Assess the antigen-specific humoral immune response induced by DNA vaccines.

[0146] 1.1. ELISA detection of antibody concentration

[0147] Fourteen days after the initial immunization and 14 days after the booster immunization, antibodies binding to the SARS-CoV-2 wild-type (WT) RBD protein, the SARS-CoV-2 Beta mutant RBD protein, the SARS-CoV-2 Delta mutant RBD protein, and the SARS-CoV-2 Omicron mutant RBD protein were evaluated using an ELISA-based method. Nunc 96-well ELISA plates were coated overnight at 4°C with 1 μg / mL of SARS-CoV-2 wild-type RBD protein, 1 μg / mL of SARS-CoV-2 Beta mutant RBD protein, 1 μg / mL of SARS-CoV-2 Delta mutant RBD protein, and 1 μg / mL of SARS-CoV-2 Omicron BA.1 mutant RBD protein (Acro Biosystems, DE, USA). The plates were washed three times and then blocked for 1 hour at 37°C with PBS containing 5% bovine serum albumin (BSA) (containing 0.05% Tween 20, i.e., PBST buffer). Three-fold serially diluted mouse serum was added to each well and incubated at 37°C for 1 hour. The plate was washed five times again, and then incubated at 37°C for 1 hour with a 1:8000 diluted goat anti-mouse IgG-HRP (GenScript, NJ, CN) solution. Binding antibodies were then detected. After a final wash, the plate was developed using TMB substrate, and the reaction was terminated with 50 μl / well of 2M H2SO4. Readings were taken at 450 nm and 620 nm. The endpoint of the serum antibody titer was determined as the reciprocal of the highest dilution. The highest dilution of the sample was 2.1 times higher than the absorbance of the negative control (judgment criterion: OD450-620 value ≥ 2.1 for experimental group: control group (negative), the highest dilution corresponding to this OD value was determined as the serum antibody titer).

[0148] Conclusion: Antibody test results are as follows Figure 7 and Figure 8As shown, both the broad-spectrum candidate DNA vaccine pSARS-OmicronDimer and the wild-type candidate DNA vaccine pWT significantly induced antigen-specific antibodies in experimental animals 14 days after primary immunization and 14 days after booster immunization. Furthermore, in the aforementioned ELISA experiments, the SARS-CoV-2 wild-type (WT) RBD protein, SARS-CoV-2 Beta mutant RBD protein, SARS-CoV-2 Delta mutant RBD protein, and SARS-CoV-2 Omicron BA.1 mutant RBD protein were used as in vitro coating antigens, respectively. As can be seen from the results, the SARS-CoV-2 wild-type candidate DNA vaccine pWT can not only produce antibodies against the SARS-CoV-2 wild-type antigen, but also against the Beta mutant antigen, Delta mutant antigen, and Omicron mutant antigen. However, the pSARS-Omicron Dimer DNA vaccine provided by this invention also achieved considerable technical effectiveness. Moreover, against the SARS-CoV-2 Beta mutant antigen, Delta mutant antigen, and Omicron mutant antigen, the pSARS-Omicron Dimer DNA vaccine provided by this invention has significantly better efficacy than the SARS-CoV-2 wild-type candidate DNA vaccine pWT. As mentioned earlier, pWT is a preliminary product with excellent immunogenicity against the SARS-CoV-2 wild-type strain, further demonstrating that the pSARS-Omicron Dimer DNA vaccine of this invention has superior immunogenicity and broad-spectrum activity.

[0149] 1.2. Detection of pseudovirus neutralizing antibodies

[0150] Huh-7 cells were seeded and cultured in 96-well plates containing 10% FBS in DMEM. To detect neutralizing antibody titers, mouse serum was serially diluted 1:2 in DMEM medium. The diluted serum samples were then incubated with various variants of SARS-CoV-2 pseudoviruses at 37°C for 30 minutes before being added to Huh-7 cells for infection. After a further 4-hour incubation, the supernatant was replaced with fresh DMEM medium (containing 10% FBS). After another 48 hours of culture, the cell supernatant was removed, and the absolute luciferase levels in lysed cells were measured using a Promega luciferase assay kit and a microplate reader. Relative values ​​were calculated by normalizing to the virus control wells in the same plate. Neutralizing antibody titers were calculated using GraphPad Prism 9 and defined as the reciprocal of the serum dilution (after subtracting the background RLU in the cell control wells, the RLU was reduced by 50% compared to the RLU in the virus control wells).

[0151] Conclusion: The results are as follows Figure 9As shown, on day 14 after booster immunization with the broad-spectrum candidate DNA vaccine pSARS-Omicron Dimer, all of them exhibited good neutralizing activity against wild-type (WT), Beta mutant, Delta mutant, and Omicron BA.1 mutant strains of SARS-CoV-2, further demonstrating that the pSARS-Omicron Dimer DNA vaccine of this invention has good immunogenicity and broad-spectrum activity.

[0152] 1.3. Comparison Experiment of Neutralizing Antibodies Against Pseudoviruses

[0153] Mice were immunized with 25 μg of pSARS-Omicron Dimer DNA vaccine, 25 μg of pWT DNA vaccine, 10 μg of ZF2001 protein vaccine (derived from a commercially available recombinant protein vaccine from Zhifei Biological Products), and 25 μg of ZF2001 DNA vaccine (the DNA vaccine corresponding to a commercially available recombinant protein vaccine from Zhifei Biological Products). Serum was collected 14 days after booster immunization for the detection of neutralizing antibodies against the Omicron mutant pseudovirus. The experimental method was consistent with the pseudovirus neutralizing antibody detection method described above, and the data were statistically analyzed using the geometric mean.

[0154] Conclusion: Figure 10 As shown, the broad-spectrum candidate DNA vaccine pSARS-Omicron Dimer for the novel coronavirus Omicron BA.1 mutant strain pseudovirus exhibits superior efficacy compared to the candidate DNA vaccines pWT, ZF2001 protein vaccine, and ZF2001 DNA vaccine for the wild-type novel coronavirus. As previously mentioned, pWT is a preliminary product with excellent immunogenicity against the wild-type novel coronavirus, while ZF2001 is a commercially available recombinant protein vaccine, and ZF2001 DNA is the corresponding DNA vaccine to the ZF2001 protein vaccine. The above results indicate that the pSARS-Omicron Dimer DNA vaccine of this invention has significantly better immunogenicity against the novel coronavirus Omicron mutant strain than pWT, ZF2001, and ZF2001 DNA. Therefore, it is expected that the vaccine of this invention can provide excellent preventive protection against the novel coronavirus Omicron mutant strain that is spreading widely in many countries and regions around the world.

[0155] 2. Further evaluate the antigen-specific cellular response induced by the DNA vaccine.

[0156] 2.1 Specific T cell immune response

[0157] To further evaluate the impact of the vaccine on antigen-specific cellular immune responses, spleen cells were isolated 14 days post-immunization and analyzed by flow cytometry.

[0158] Spleen cell isolation: 14 days after booster immunization, the process was performed in a sterile environment. Mice were euthanized, spleens were removed, and cells were ground into a single-cell suspension. Cells were harvested by centrifugation, resuspended in red blood cell lysis buffer, and lysed. Lysis was terminated with PBS containing FBS. Cells were filtered, and the prepared single-cell suspension was counted. The single cells were then suspended in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin / streptomycin.

[0159] Flow cytometry assay: Splenic cell suspensions obtained from each mouse using the above method were stimulated at 37°C and 5% CO2 with either a SARS-CoV-2 wild-type RBD peptide library (pool), a SARS-CoV-2 Omicron BA.1 mutant RBD peptide library, or PMA / Iono, while simultaneously blocked with 1 μg / ml Brefeldin A (BD, CA, USA) for 6 hours. Extracellular and intracellular cytokine staining was performed on the spleen cells. Stimulated spleen cells were stained with FVD-eFluor780, washed, and stained with anti-mouse CD4 antibody for 30 minutes at room temperature in the dark. Cells were permeabilized with fixation / permeability buffer and stained intracellularly with anti-mouse IFN-γ and TNF-α at 4°C for 45 minutes. Cells were washed twice, resuspended in 200 μL PBS, and collected using a flow cytometer (ThermoFisher, MA, USA). Analysis was then performed using FlowJo software (BD, CA, USA).

[0160] Conclusion: The results are as follows Figure 11 and Figure 12As shown, 14 days after booster immunization, both the broad-spectrum coronavirus candidate DNA vaccine pSARS-Omicron Dimer and the wild-type SARS-CoV-2 candidate DNA vaccine pWT significantly induced the production of antigen-specific CD4 IFNγ and CD4 TNF-α T cell subsets. In the aforementioned FACS assay, the wild-type SARS-CoV-2 RBD protein and the SARS-CoV-2 Omicron BA.1 mutant RBD protein were used as in vitro stimulating peptides. Using both wild-type and Omicron BA.1 mutant RBD proteins as in vitro stimulating peptides was advantageous for the wild-type SARS-CoV-2 nucleic acid vaccine pWT. However, the broad-spectrum coronavirus candidate DNA vaccine pSARS-Omicron Dimer provided by this invention also achieved considerable technical effectiveness. Furthermore, when using the SARS-CoV-2 Omicron BA.1 mutant strain RBD protein as the in vitro stimulating peptide, the coronavirus broad-spectrum candidate DNA vaccine pSARS-OmicronDimer provided by this invention has significantly better efficacy than the COVID-19 wild-type candidate DNA vaccine pWT. As mentioned above, pWT is a pre-product with excellent immunogenicity against the COVID-19 wild-type strain, which further demonstrates that the pSARS-Omicron Dimer DNA vaccine of this invention has better immunogenicity and broad-spectrum efficacy.

[0161] Example 5: Validation of the protective efficacy of a broad-spectrum candidate DNA vaccine against SARS-CoV-2 infection.

[0162] To further investigate the actual effect of the pSARS-Omicron Dimer DNA vaccine of this invention on preventing SARS-CoV-2 infection in mice and whether it provides protection for mice after viral infection, a human ACE2 (hACE2) transgenic mouse (C57BL / 6 background) model was used for the experiment. Experimental groups: (1) Control group vector plasmid pVAX1 20 μg; (2) Experimental group coronavirus broad-spectrum DNA vaccine pSARS-Omicron Dimer-20 μg; The inoculation method of the DNA vaccine was the same as in Example 4. The first immunization was performed on day 0, and the second immunization (booster immunization) was performed on day 21. The specific antibodies in the serum were measured on day 17 after the second immunization. The mice were infected with the virus on day 18 after the second immunization, and the viral load in the lung tissue was measured on day 4 after infection.

[0163] 1. ELISA detection of antibody concentration

[0164] Seventeen days after booster immunization, the IgG antibody titer in the serum was detected. The experimental method was the same as the ELISA method in Example 4. This experiment added the detection of SARS-CoV RBD protein binding antibody, using 1 μg / mL SARS-CoV RBD protein (Acro Biosystems, DE, USA) coated overnight.

[0165] Conclusion: Antibody test results are as follows Figure 13 As shown, the broad-spectrum candidate DNA vaccine pSARS-OmicronDimer significantly induced high levels of antigen-specific antibodies in hACE2 transgenic mice 17 days after booster immunization. The results also demonstrate that the broad-spectrum candidate DNA vaccine pSARS-OmicronDimer not only produces antibodies against the wild-type SARS-CoV antigen, but also against Beta mutant antigen, Delta mutant antigen, Omicron BA.1 mutant antigen, and SARS-CoV antigen, further illustrating the good immunogenicity and broad-spectrum activity of the pSARS-Omicron Dimer DNA vaccine of this invention.

[0166] 2. Detection of neutralizing antibodies against pseudoviruses

[0167] Serum was collected 17 days after booster immunization to detect neutralizing antibody titers. This experiment tested the neutralizing ability of the Omicron BA.1 and Omicron BA.2 mutant strains of SARS-CoV-2. Experimental method: 3x10 4 293-ACE2 cells were cultured in 96-well plates in DMEM containing 10% FBS. To detect neutralizing antibody titers, mouse serum (starting with a 1:30 dilution) was serially diluted 1:3 in DMEM medium for a total of six dilutions. Antibody XG05 (0.1 mg / mL) was used as a positive control. Subsequently, the diluted serum samples were mixed with various SARS-CoV-2 mutant pseudoviruses (1 x 10⁻⁶ cells / mL). 3 TCID 50 After incubating at 37°C for 1 hour, the mixture was added to 293-ACE2 cells for infection. After 48 hours of culture, the cell supernatant was removed, and the absolute luciferase levels in lysed cells were detected using a Promega Firefly Luciferase Assay Kit and a microplate reader. The relative values ​​were calculated by normalizing the values ​​to those of the virus control wells in the same plate. Neutralizing antibody titers were calculated using GraphPad Prism 9 and defined as the reciprocal of the serum dilution (after subtracting the background RLU in the cell control wells, the RLU was reduced by 50% compared to the RLU in the virus control wells).

[0168] Conclusion: Neutralizing antibody test results are as follows Figure 14 and 15 As shown, the broad-spectrum candidate DNA vaccine pSARS-Omicron Dimer showed good neutralizing activity against the Omicron BA.1 and Omicron BA.2 mutant strains of SARS-CoV-2 on day 17 after booster immunization, indicating that the pSARS-Omicron Dimer DNA vaccine of this invention has excellent preventive and protective effects against the Omicron mutant strain of SARS-CoV-2.

[0169] 3. Detection of viral load in the lungs

[0170] Mice were infected with the Omicron BA.1 mutant virus on day 18 post-immunization. Lung tissue was collected on day 4 post-infection, and viral load was measured using qPCR. This experiment was conducted by the BSL-3 laboratory of the Changchun Military Veterinary Research Institute using the Omicron BA.1 virus infection assay. Viral RNA was isolated from lung tissue using the QIAamp Viral RNA Kit (Qiagen, 52906) according to the manufacturer's instructions. Viral copy number was then detected using RT-qPCR via an ABI 7500 real-time PCR system (Applied Biosystems, CA, United States) and the HiScript II One Step RT-qPCR SYBR Green Kit (Vazyme Biotech, Nanjing, China). The RT-qPCR reaction conditions were as follows: 50℃ for 15 minutes, 95℃ for 30 seconds, followed by 45 cycles at 95℃ for 10 seconds and 63℃ for 35 seconds. Specific primers for detecting the SARS-CoV-2N and SgE genes were:

[0171] N-gene-F,GACCCCAAAATCAGCGAAAT (SEQ ID No. 12);

[0172] N-gene-R,TCTGGTTACTGCCAGTTGAATCTG (SEQ ID No. 13);

[0173] sgRNA-EF,CGATCTCTTGTAGATCTGTTCTC (SEQ ID No. 14);

[0174] sgRNA-ER,ATATTGCAGCAGTACGCACACA (SEQ ID No. 15).

[0175] Conclusion: The viral load results in the lungs are as follows: Figure 16 and17 As shown, gRNA detection detects the viral N gene. The detection of gRNA indicates the presence of the virus in lung tissue, suggesting viral infection. sgRNA is an intermediate product of SARS-CoV-2 replication; its detection indicates viral infection of cells and self-replication within the host cell environment. The results show that the pVAX1 control group exhibited high levels of both gRNA and sgRNA genes, indicating viral infection and replication within cells. In contrast, the gRNA and sgRNA levels in the pSARS-Omicron Dimer DNA vaccine group were significantly lower than those in the control group, demonstrating that the pSARS-Omicron Dimer DNA vaccine can effectively prevent or inhibit viral replication in vivo, exhibiting excellent vaccine protection.

[0176] In summary, the results of Examples 1-5 demonstrate that, due to the effective codon optimization system and reasonable sequence design, the broad-spectrum coronavirus candidate DNA vaccine pSARS-Omicron Dimer of this invention can be effectively transcribed and expressed in mammalian cells; and it exhibits good immunogenicity, manifested in humoral and cellular immune responses. For humoral immune responses, the pSARS-Omicron Dimer candidate DNA vaccine can significantly stimulate experimental animals to produce antigen-specific antibodies, not only against the wild-type antigen of SARS-CoV-2, but also against the Delta mutant antigen, Beta mutant antigen, Omicron mutant antigen, and SARS-CoV antigen, and possesses good neutralizing activity. For cellular immune responses, against both the wild-type and Omicron mutant antigens of SARS-CoV-2, the pSARS-Omicron Dimer DNA vaccine can induce high levels of antigen-specific CD4 IFNγ and CD4 TNF-α T cell subsets. Simultaneously, the DNA vaccine of this invention can effectively prevent or inhibit the replication of the Omicron mutant SARS-CoV-2 virus in vivo, demonstrating excellent vaccine protection. The above experiments all demonstrate the good immunogenicity and broad-spectrum activity of the pSARS-Omicron Dimer DNA vaccine of this invention.

[0177] It is worth noting that the pWT wild-type vaccine is a product developed by our company in response to the wild-type SARS-CoV-2 strain. It has now entered Phase III clinical trials and exhibits excellent immunogenicity. In the aforementioned trials, such as ELISA, pseudovirus neutralization, and FACS detection, not only was the wild-type SARS-CoV-2 RBD protein or virus used as the in vitro coating antigen or stimulating peptide, but also the RBD protein or virus of the SARS-CoV-2 Beta mutant strain, the SARS-CoV-2 Delta mutant strain, and the SARS-CoV-2 Omicron mutant strain were used as in vitro coating antigens or stimulating peptides to detect antigen-specific immune responses. Even when conditions were significantly more favorable for the wild-type SARS-CoV-2 nucleic acid vaccine pWT (using the wild-type SARS-CoV-2 RBD protein), the pSARS-Omicron Dimer DNA vaccine provided by this invention achieved significant technical effects, even surpassing the wild-type SARS-CoV-2 nucleic acid vaccine pWT, further demonstrating that the pSARS-Omicron Dimer DNA vaccine of this invention has superior immunogenicity and broad-spectrum activity. When using SARS-CoV-2 Beta mutant RBD protein or virus, SARS-CoV-2 Delta mutant RBD protein or virus, and SARS-CoV-2 Omicron mutant RBD protein or virus as in vitro coating antigens or stimulating peptides, the pSARS-Omicron Dimer DNA vaccine of the present invention significantly induces higher levels of humoral and cellular immunity.

[0178] Meanwhile, ZF2001 is a recombinant protein vaccine currently available on the market, and ZF2001 DNA is a DNA vaccine targeting the ZF2001 protein vaccine. In neutralization experiments against the Omicron mutant pseudovirus, the pSARS-Omicron Dimer DNA vaccine provided by this invention is significantly superior to pWT, ZF2001 protein vaccine, and ZF2001 DNA vaccine, further demonstrating that the pSARS-Omicron Dimer DNA vaccine of this invention has superior immunogenicity against the COVID-19 Omicron mutant virus.

[0179] The broad-spectrum candidate DNA vaccine pSARS-Omicron Dimer of this invention showed excellent neutralizing activity against SARS-CoV-2 Omicron BA.1 and Omicron BA.2 mutant strains on day 17 after booster immunization, indicating that the pSARS-Omicron Dimer DNA vaccine has excellent protective efficacy against SARS-CoV-2 Omicron mutant strains. The levels of gRNA and sgRNA in the pSARS-Omicron Dimer DNA vaccine group were significantly lower than those in the control group, indicating that the pSARS-Omicron Dimer DNA vaccine can effectively prevent or inhibit viral replication in vivo and has a good protective effect.

[0180] Therefore, it is expected that the vaccine of the present invention can provide excellent preventive protection against the Omicron mutant strain of COVID-19, which is spreading widely in many countries and regions around the world.

[0181] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant nucleic acid molecule, characterized in that, The recombinant nucleic acid molecule includes a first DNA molecule encoding the RBD region of the SARS-CoV S protein and a second DNA molecule encoding the RBD region of the S protein of the SARS-CoV-2 Omicron mutant strain. The nucleotide sequence of the first DNA molecule is shown in SEQ ID No. 3; the nucleotide sequence of the second DNA molecule is shown in SEQ ID No. 4; The nucleotide sequence of the recombinant nucleic acid molecule is as shown in SEQ ID No. 5, and encodes the SARS-CoV S protein RBD region and the SARS-CoV-2 Omicron mutant S protein RBD region.

2. The recombinant nucleic acid molecule according to claim 1, characterized in that, The amino acid sequence encoded by the first DNA molecule is shown in SEQ ID No. 1; the amino acid sequence encoded by the second DNA molecule is shown in SEQ ID No.

2.

3. A biomaterial, characterized in that, Including any of the following biomaterials: (I) A construct comprising the recombinant nucleic acid molecule of claim 1 or 2; (II) A recombinant expression vector, comprising an original expression vector; and a coding nucleic acid fragment inserted into the original expression vector, said coding nucleic acid fragment being selected from the recombinant nucleic acid molecule of claim 1 or 2 or the construct of (I); (III) The transformant obtained by introducing the recombinant expression vector of (II) into a host cell, wherein the host cell is selected from mammalian cells.

4. The biomaterial according to claim 3, characterized in that, The original expression vector was the pVAX1 plasmid.

5. The biomaterial according to claim 3, characterized in that, The host cells are HEK293, CHO, or COS-7.

6. The use of the recombinant nucleic acid molecule of claim 1 or 2 or the biological material of any one of claims 3 to 5 in (A) or (B) below: (A) To prepare a vaccine to prevent SARS-CoV-2 virus infection; (B) To prepare drugs for preventing diseases caused by the SARS-CoV-2 virus; The SARS-CoV-2 virus was selected from wild-type strains, B.1.617.2 mutant strains, B.1.351 mutant strains, or B.1.1.529 mutant strains.

7. A DNA vaccine, characterized in that, The DNA vaccine comprises the recombinant nucleic acid molecule of claim 1 or 2 or the recombinant expression vector of any one of claims 3 to 5.

8. The DNA vaccine according to claim 7, characterized in that, The DNA vaccine also includes at least one of a pharmaceutically acceptable adjuvant, carrier, or diluent; And / or, at least one drug that has therapeutic effects against the SARS-CoV-2 virus; The SARS-CoV-2 virus was selected from wild-type strains, B.1.617.2 mutant strains, B.1.351 mutant strains, or B.1.1.529 mutant strains.

9. The DNA vaccine according to claim 8, characterized in that, The adjuvant includes at least one of aluminum adjuvant, TLR ligands, metal ion or cytokine adjuvant.

10. The DNA vaccine according to claim 9, characterized in that, The metal ions include Mn 2+ and / or Zn 2+ .

11. A method for preparing the DNA vaccine according to any one of claims 7 to 10, characterized in that, The method involves introducing the recombinant nucleic acid molecule of claim 1 or 2 or the recombinant expression vector of any one of claims 3 to 5 into a host cell and culturing it, then extracting the recombinant nucleic acid molecule or recombinant expression vector from the host cell to prepare a DNA vaccine.

Images