A therapeutic agent for treating diabetic cardiomyopathy

Abstract

The application provides a therapeutic drug for treating diabetic cardiomyopathy, and belongs to the technical field of cardiomyopathy. The application finds out, through a PCR experiment, a highly expressed gene AC025580.1 in myocardial fibroblasts under high-sugar culture. Moreover, the application finds out, through an experiment, that after knocking down the AC025580.1 in myocardial fibroblasts, the expression of Collagen I protein and alpha-SMA protein caused by high sugar can be effectively reduced. Meanwhile, the application finds out that after knocking down the AC025580.1, the accelerated proliferation of myocardial fibroblasts caused by high sugar can be effectively reduced.

Description

Technical Field

[0001] This invention belongs to the field of cardiomyopathy technology, and in particular relates to a therapeutic drug for treating diabetic cardiomyopathy. Background Technology

[0002] Diabetic cardiomyopathy is an independent and specific complication of diabetes mellitus, characterized by myocardial fibrosis and diabetic metabolic abnormalities. Current research indicates that collagen synthesis and deposition are crucial factors contributing to the exacerbation of myocardial fibrosis, and high glucose levels accelerate collagen production, thus worsening the condition. In cases of myocardial fibrosis, excessive accumulation of extracellular matrix in the myocardial interstitium ultimately leads to ventricular remodeling and alterations in myocardial function and morphology, resulting in cardiomyopathy. Currently, the specific molecular mechanisms underlying diabetic cardiomyopathy remain unclear, making its prevention and treatment challenging.

[0003] Long non-coding RNAs (lncRNAs) are a class of RNA molecules with transcript lengths ≥200 nt. While lncRNAs do not encode proteins, they regulate gene expression at the epigenetic, transcriptional, and post-transcriptional levels through genomic imprinting, cell cycle regulation, chromatin remodeling, alternative splicing, and mRNA regulation, participating in various functions such as cell growth, differentiation, metabolism, apoptosis, and necrosis. However, the role of lncRNAs in diabetic cardiomyopathy remains unclear. Therefore, researching the role of lncRNAs in diabetic cardiomyopathy will contribute to the development of new drugs for its treatment. Summary of the Invention

[0004] The purpose of this invention is to provide a drug for treating diabetic cardiomyopathy and to provide the application of the AC025580.1 inhibitor in the preparation of a drug for diabetic cardiomyopathy.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] A drug for treating cardiomyopathy, the drug comprising an AC025580.1 inhibitor and a pharmaceutically acceptable carrier.

[0007] Preferably, the AC025580.1 inhibitor is the sole active ingredient or one of the active ingredients of the drug.

[0008] Preferably, the transcript sequence of AC025580.1 is shown in SEQ ID NO.13.

[0009] Preferably, the inhibitor is siRNA.

[0010] Preferably, the sequence of the siRNA is shown in SEQ ID NO.16 and SEQ ID NO.17.

[0011] The use of an inhibitor in the preparation of a drug for treating cardiomyopathy, wherein the inhibitor is an siRNA of AC025580.1, the transcript sequence of AC025580.1 is shown in SEQ ID NO.13, and the sequence of the siRNA is shown in SEQ ID NO.16 and SEQ ID NO.17.

[0012] Preferably, the siRNA inhibits the increased expression levels of Collagen I protein and α-SMA protein in human cardiomyocytes caused by high glucose.

[0013] The siRNA inhibits the accelerated proliferation of human cardiomyocytes caused by high glucose.

[0014] The use of an inhibitor in the preparation of a biological agent that inhibits the increased expression of Collagen I protein and α-SMA protein in human cardiomyocytes caused by high glucose, wherein the inhibitor is an siRNA of AC025580.1, the transcript sequence of which is shown in SEQ ID NO.13, and the sequence of which is shown in SEQ ID NO.16 and SEQ ID NO.17.

[0015] The use of an inhibitor in the preparation of a biological agent that inhibits the accelerated proliferation of human cardiomyocytes caused by high glucose, wherein the inhibitor is an siRNA of AC025580.1, the transcript sequence of AC025580.1 is shown in SEQ ID NO.13, and the sequence of the siRNA is shown in SEQ ID NO.16 and SEQ ID NO.17.

[0016] The beneficial effects of this invention are:

[0017] This invention discovered differential expression of the non-coding gene AC025580.1 in cardiomyocytes cultured under normal and high glucose conditions. AC025580.1 was highly expressed in cardiomyocytes cultured under high glucose conditions.

[0018] Secondly, this invention found that knocking down AC025580.1 can effectively reduce the increased expression of Collagen I protein and α-SMA protein caused by high glucose.

[0019] Secondly, this invention found that knocking down AC025580.1 can effectively reduce the accelerated proliferation of myocardial fibroblasts caused by high glucose.

[0020] Therefore, drugs prepared from AC025580.1 inhibitors can be used to treat myocardial fibrosis caused by high glucose in diabetic cardiomyopathy. Attached Figure Description

[0021] Figure 1 Differences in the expression of different genes in the normal group and the high glucose group;

[0022] Figure 2 The knockdown effects of siRNA-A and siRNA-B on the mRNA expression of AC025580.1;

[0023] Figure 3 To investigate the inhibitory effect of knocking down AC025580.1 on the increased expression of Collagen I and α-SMA proteins caused by high glucose;

[0024] Figure 4 To investigate the inhibitory effect of knocking down AC025580.1 on the accelerated proliferation of myocardial fibroblasts induced by high glucose. Detailed Implementation

[0025] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0026] Example 1

[0027] Effects of high glucose treatment on lncRNA expression in human cardiomyocytes (HCFs)

[0028] 1. RNA extraction

[0029] (1) After digesting HCFs cells in the logarithmic growth phase with trypsin, add equal amounts of cells to two cell culture dishes and culture overnight.

[0030] (2) After the cells adhered, the culture medium was removed, the normal group was replaced with ordinary culture medium, and the high glucose group was replaced with high glucose culture medium (glucose concentration 25 mmol / L) for culture.

[0031] (3) After culturing for 48 hours, remove the cell culture dish from the constant temperature cell incubator, remove the culture medium, and wash the cells with PBS.

[0032] (4) After discarding PBS, add 1 ml of Trizol reagent and use a pipette to repeatedly blow and mix to promote lysis. Use a pipette to aspirate the homogenate into an enzyme-free EP tube and let it stand at room temperature for 10 min.

[0033] (5) Add 200 μL of pre-cooled chloroform, mix thoroughly by pipetting several times, and let stand at room temperature for 5 minutes.

[0034] (6) Place the EP tube into a 4℃ high-speed low-temperature centrifuge, balance it, and centrifuge at 13000r / min for 15min;

[0035] (7) After centrifugation, the liquid is divided into 3 layers. Use a pipette to place the liquid of the top layer into a new enzyme-free EP tube, then add an equal volume of pre-cooled isopropanol and let it stand at room temperature for 15 minutes.

[0036] (8) Place the EP tube in a 4℃ high-speed low-temperature centrifuge, set the speed to 13000r / min and centrifuge for 15min. After completion, carefully aspirate the supernatant using a pipette to obtain the precipitate.

[0037] (9) Wash the RNA precipitate with 75% ethanol, centrifuge at 7500g for 5 min at 4℃, and discard the supernatant;

[0038] (10) Let it dry at room temperature. After about 5-10 minutes, add 30 μL of RNase-free water and mix it several times with a pipette tip to obtain RNA.

[0039] 2. cDNA Synthesis

[0040] 1) Removal reaction of DNA from total cellular RNA genome

[0041] The amount of material added and the operating procedure for the reaction system are as follows: First, add the DNA removal reaction system:

[0042] Table 1 DNA Removal Reaction System

[0043] 5×gDNA Eraser Buffer 2.0μl gDNA Eraser 1.0μl Total RNA 1μg RNase-Free dH2O Up to 10.0μl

[0044] After adding the above ingredients, 42℃ for 2 minutes, then store at 4℃.

[0045] 2) Reverse transcription reaction

[0046] The following reaction system was prepared on ice:

[0047] Table 2 Reverse Transcription Reaction System

[0048] 5×PrimeScript Buffer 2(for Real Time) 4.0 RT Primer Mix 1.0 PrimeScript RT Enzyme Mix I 1.0 <![CDATA[RNase Free dH2O]]> Up to 20

[0049] After adding the above components, the first reaction was carried out at 37°C for 15 minutes, the second reaction at 85°C for 5 seconds, and finally stored at 4°C. After the reaction was completed, the cDNA was stored at -20°C for later use.

[0050] 3. Perform Real-time PCR on the cDNA template obtained from reverse transcription.

[0051] Prepare the following reaction system, gently mix by pipetting, and briefly centrifuge to avoid residual air bubbles;

[0052]

[0053]

[0054] After adding the above components, set the reaction program as follows: 95℃ for 5 min; 95℃ for 15 s, 60℃ for 40 s, 35 cycles;

[0055] The primer sequences used in the experiment are as follows:

[0056]

[0057]

[0058] Real-time quantitative PCR data were obtained using 2 -△△Ct The method was used to process the data, and the result was as follows: Figure 1 As shown.

[0059] As shown in the figure, the relative expression level of AC000067.1 was 0.85±0.11, with no statistically significant difference; the relative expression level of AC023157.3 was 1.23±0.07, with a statistically significant difference; the relative expression level of AC025580.1 was 2.94±0.38, with a statistically significant difference; the relative expression level of AC046130.1 was 1.66±0.19, with a statistically significant difference; the relative expression level of AC055713.1 was 1.10±0.09, with no statistically significant difference; and the relative expression level of AC012361.1 was 0.86±0.05, with a statistically significant difference. Among these, AC025580.1 showed the most significant difference, therefore, AC025580.1 was selected for subsequent experiments in this invention.

[0060] Example 2

[0061] The effect of reducing AC025580.1 expression level on Collagen I and α-SMA protein expression under high glucose environment

[0062] 1. Design the siRNA AC025580.1 and test its knockdown effect.

[0063] (1) Two siRNAs were designed based on the sequence of AC025580.1 (SEQ ID NO.13). The sequences of the designed siRNA-A and siRNA-B are as follows:

[0064] siRNA-A positive strand: AAGAUACAUUCAUAUCCAGCA, SEQ ID NO.14;

[0065] siRNA-A antisense strand: CUGGAUAUGAAUGUAUCUUCA, SEQ ID NO.15;

[0066] siRNA-B positive strand: AGAUGAAUUGGAAUGCAAGGC, SEQ ID NO.16;

[0067] siRNA-B antisense strand: CUUGCAUUCCAAUUCAUCUCC, SEQ ID NO.17;

[0068] (2) HCFs cells were seeded in 6-well culture plates. When the cell density reached 90%, si-NC, siRNA-A and siRNA-B were transfected into the cells according to the lip2000 instruction manual.

[0069] (3) After transfection, the relative expression level of AC025580.1 was detected by following the RNA extraction, reverse transcription and PCR detection steps in Example 1, so as to select siRNA with good knockdown effect;

[0070] The experimental results are shown in Figure 1. As can be seen from the figure, after siRNA-A transfection, the relative expression level of AC025580.1 in cells was 0.26±0.03, a statistically significant difference; after siRNA-B transfection, the relative expression level of AC025580.1 in cells was 0.18±0.05, also a statistically significant difference. It can be seen that siRNA-B has a more significant effect; therefore, in subsequent tests, this invention selected siRNA-B for the experiments.

[0071] 2. Detection of the effect of AC025580.1 knockdown on the expression of Collagen I and α-SMA proteins in HCFs cells.

[0072] (1) HCFs cells transfected with si-NC and si-RNA-B were digested with trypsin;

[0073] (2) After the cells adhered, the culture medium was removed. The control group consisted of cells transfected with si-NC and added with normal culture medium. The high glucose group 1 consisted of cells transfected with si-NC and added with high glucose culture medium. The high glucose group 2 consisted of cells transfected with si-RNA-B and added with high glucose culture medium.

[0074] (3) After culturing for 48 hours, remove the cell culture dish from the constant temperature cell incubator, remove the culture medium, and wash the cells with PBS.

[0075] (4) Add 100 μL of PMSF-containing RIPA lysis buffer to each well, mix well, and place on a shaker at 4°C for 20 min.

[0076] (5) After gently scraping off the cells with a cell scraper, aspirate them into an EP tube, place the EP tube in a 4°C high-speed low-temperature centrifuge at 12000 rpm / min for 15 min, and then aspirate the supernatant into a new EP tube.

[0077] (6) Detect the protein concentration in each group according to the instructions of the BCA protein concentration detection kit, add sample loading buffer, and boil at 100℃ for 5 min to obtain protein samples.

[0078] (7) Prepare a 10% separating gel and a 5% stacking gel according to the SDS-PAGE gel preparation table. Then, install the prepared SDS-PAGE gel on the electrophoresis rack, add electrophoresis buffer, slowly remove the sample comb, add protein samples, and the loading order is high sugar group 1 protein sample, high sugar group 2 protein sample, control group protein sample. Add 5 μL of protein marker to both sides for electrophoresis.

[0079] (8) After loading the sample, pour 800ml of electrophoresis buffer into the electrophoresis apparatus, turn on the power, and perform 80V constant voltage electrophoresis.

[0080] (9) After pre-soaking a 5cm×8cm PVDF membrane in a small amount of methanol for 5 minutes, immerse the PVDF membrane and 3mm filter paper together in the transfer buffer. Then, in the order of sponge, filter paper, PVDF membrane, gel, filter paper, sponge, remove air bubbles in each layer of the electrotransfer clamp, insert it into the electrotransfer tank, add enough electrotransfer buffer to completely soak the well plate, adjust the power supply to constant current 200mA, and run for 90 minutes.

[0081] (10) Weigh 5 mg of skim milk powder and completely dissolve it in 100 ml of 1×TBST to obtain 5% skim milk powder. After the transfer is completed, take out the membrane and place it in 5% skim milk powder for 1 h to block it. After incubation with primary antibody, incubate overnight at 4°C.

[0082] (11) Wash the strips with 1×TBST for 5 minutes each time, wash 3 times, select the secondary antibody according to the source of the primary antibody, and incubate with the secondary antibody at room temperature for 1 hour by shaking slowly.

[0083] (11) Wash the strip with TBST 3 times, 15 min each time, and prepare ECL chemiluminescent solution according to the ratio of solution A and solution B 1:1 to carry out the color development reaction.

[0084] The results obtained from the experiment are as follows Figure 3As shown, the expression levels of Collagen I and α-SMA proteins in cells of high glucose group 2 were lower than those in high glucose group 1, reaching levels similar to the control group. This result indicates that knocking down AC025580.1 can effectively reduce the increase in Collagen I and α-SMA protein expression in HCFs cells induced by high glucose.

[0085] Example 3

[0086] The effect of reducing AC025580.1 expression level under high glucose environment on cell proliferation

[0087] (1) HCFs in the logarithmic growth phase were seeded into 96-well plates, with 5000 cells added to each well. After culturing in a cell culture incubator for 24 hours, the culture medium was replaced with serum-free medium to synchronize the cells for 24 hours.

[0088] (2) The control group was transfected with si-NC and added with normal culture medium; the high glucose group 1 was transfected with si-NC and added with high glucose culture medium, and the high glucose group 2 was transfected with siRNA-B and added with high glucose culture medium. Each group was set up with 5 replicates and cultured for 48h.

[0089] (3) Add the MMT detection reagent 4 hours before the end of the culture, place it in an incubator and continue to culture for 4 hours, then detect the absorbance at 490nm.

[0090] The results obtained from the experiment are as follows Figure 4 As shown in the figure, the OD value of high glucose group 1 was higher than that of the control group, while the OD value decreased after transfection with siRNA-B. The differences between high glucose group 1 and the control group, as well as between high glucose group 1 and high glucose group 2, were statistically significant. These results indicate that high glucose treatment can promote the proliferation of cardiomyocytes, while inhibiting AC025580.1 can reduce the cell proliferation induced by high glucose to a certain extent.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A drug for treating diabetic cardiomyopathy, characterized in that, The drug includes an AC025580.1 inhibitor and a pharmaceutically acceptable carrier; The AC025580.1 inhibitor is the sole active ingredient or one of the active ingredients of the drug; The transcript sequence of AC025580.1 is shown in SEQ ID NO.13; The inhibitor is siRNA, the sense strand sequence of which is shown in SEQ ID NO.16, and the antisense strand sequence of which is shown in SEQ ID NO.

17.

2. The application of an inhibitor in the preparation of a therapeutic drug for diabetic cardiomyopathy, characterized in that, The inhibitor is an siRNA of AC025580.1, the transcript sequence of AC025580.1 is shown in SEQ ID NO.13, the sense strand sequence of the siRNA is shown in SEQ ID NO.16, and the antisense strand sequence of the siRNA is shown in SEQ ID NO.

17.

3. The application according to claim 2, characterized in that, The siRNA inhibits the increased expression of Collagen I and α-SMA proteins in human cardiomyocytes caused by high glucose. The siRNA inhibits the accelerated proliferation of human cardiomyocytes caused by high glucose.

Images