Channa argus water bubble disease virus passage attenuated strain and its application

Abstract

The application belongs to the technical field of fish virus vaccine preparation, and particularly relates to a snakehead water bubble virus (SHVV) passage attenuated strain and application thereof. The snakehead water bubble virus passage attenuated strain is SHVV-P160-5FU, which was preserved in the China Center for Type Culture Collection on April 21, 2023, and the preservation number is CCTCC NO:V202330. The SHVV-P160-5FU strain is obtained by continuously passing SHVV on channel catfish ovary cells (CCO) for 160 generations (in which 101-160 generations are added with a mutagen 5FU), and the mortality rate of the SHVV-P160-5FU strain in infecting snakeheads is significantly lower than that of SHVV-P1. The SHVV-P160-5FU strain can reduce the proliferation ability of SHVV in snakehead tissues when the strain is used as a live attenuated vaccine to immunize snakeheads by intraperitoneal injection, and can provide an immune protection rate of 50%.

Description

Technical Field

[0001] This invention belongs to the field of fish virus vaccine preparation technology, specifically relating to the passaged attenuated strain SHVV-P160-5FU of snakehead vesicle virus and its application. Background Technology

[0002] Snakehead vesiculovirus (SHVV) is a fish rhabdovirus whose genome encodes five structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase (L). SHVV infection in snakeheads causes symptoms such as hepatomegaly and blackening of the spleen, resulting in high mortality rates. Currently, there are no effective prevention and control measures for this viral disease. With the promotion of green and healthy aquaculture concepts, vaccination has become an effective way to prevent viral diseases; therefore, the development of an SHVV vaccine is urgently needed.

[0003] Live attenuated vaccines, due to their long immune cycle and ability to proliferate in vivo, have become an important research direction in the preparation of fish vaccines. Currently, the main methods for preparing live attenuated vaccines are continuous passage attenuation and genetic engineering attenuation, with continuous passage attenuation being the most classic method. Continuous passage attenuation mainly includes three methods: in vivo continuous passage, in vitro continuous passage, and cross passage. In vitro passage mainly involves passage in cells, and compared to the other two methods, cell passage has the advantages of simple operation, high efficiency, and low cost. The phenotype of live attenuated vaccines depends on gene mutations. Most of the attenuated strains reported for live attenuated vaccines have been obtained through cell passage attenuation. Through continuous passage in cells, the strain gradually adapts to the cells and undergoes mutations during the adaptation process. For example, the invention patent application number 201910759551.9 describes the attenuated pseudorabies virus strain obtained by passage attenuating pseudorabies virus in primary chicken embryo fibroblasts (CEF). Summary of the Invention

[0004] This invention protects the attenuated snakehead vesicle virus strain SHVV-P160-5FU, which was obtained by passaged SHVV in CCO cells for 160 generations. During passages 101-160, the mutagen 5-fluorouracil (5FU) was added to the cell culture medium. The pathogenicity of the SHVV-P160-5FU strain to snakehead is significantly lower than that of the SHVV-P1 strain, making it a vaccine candidate strain with higher safety. The attenuated snakehead vesicle virus strain SHVV-P160-5FU was deposited at the China Center for Type Culture Collection on April 21, 2023, with accession number CCTCC NO:V202330 and classification name Snakehead Vesiculovirus P160-5FU.

[0005] Another aspect of this invention protects the application of the attenuated strain of snakehead vesicular vesicular virus SHVV-P160-5FU as a live attenuated vaccine, and the vaccine prepared using this strain is used to vaccinate snakehead (10 5 TCID 50 After 28 days of treatment, the dosage can reduce the proliferation of SHVV in snakehead tissue and provide 50% immune protection.

[0006] Compared with the prior art, the present invention has the following advantages:

[0007] 1. There are currently no vaccine studies or products for snakehead vesicular virus. This invention is the first to initiate vaccine research on this virus. Snakehead vesicular virus was continuously passaged and attenuated in CCO cells, and the mutagen 5FU was added during passages 101-160. The resulting SHVV-P160-5FU strain showed significantly reduced pathogenicity to snakehead compared to SHVV-P1.

[0008] 2. Immunizing snakehead with a vaccine prepared using the SHVV-P160-5FU strain can reduce the proliferation of SHVV in snakehead tissues and provide a 50% immune protection rate. It can be applied to the prevention of snakehead vesicular virus disease in snakehead farms, reduce the incidence of snakehead vesicular virus disease, and improve the survival rate of snakehead. Attached Figure Description

[0009] Figure 1 Viral titers of CCO cells infected with SHVV passaged strains P1, P100, P130-5FU, and P160-5FU at 24 h and 48 h.

[0010] Figure 2 : Pathogenicity of SHVV passaged strains P1 and P160-5FU to snakehead fish. Control: control group; P1(10 5 TCID 50 ): SHVV-P1 strain at 10 5 TCID50 Intraperitoneal injection of snakehead fish; P1(10) 3 TCID 50 ): SHVV-P1 strain at 10 3 TCID 50 Intraperitoneal injection of snakehead fish; P160-5FU (10 5 TCID 50 ): SHVV-P160-5FU strain at 10 5 TCID 50 Intraperitoneal injection of snakehead fish; P160-5FU (10 3 TCID 50 ): SHVV-P160-5FU strain at 10 3 TCID 50 The dosage of snakehead fish was administered via intraperitoneal injection.

[0011] Figure 3 Serum antibody titers of snakehead immunized with SHVV-P160-5FU strain. Control: Snakehead immunized with MEM medium via intraperitoneal injection; P160-5FU (10 5 TCID 50 ): SHVV-P160-5FU strain at 10 5 TCID 50 Intraperitoneal injection of immunized snakehead fish; P160-5FU (10 3 TCID 50 ): SHVV-P160-5FU strain at 10 3 TCID 50 Immunize snakehead fish with intraperitoneal injection.

[0012] Figure 4 Immunizing snakehead fish with SHVV-P160-5FU strain followed by SHVV infection, and the expression level of viral G gene in the liver and spleen tissues of snakehead fish. (A) Viral G gene expression level in snakehead fish liver tissue, (B) Viral G gene expression level in snakehead fish spleen tissue. Control: Snakehead fish were intraperitoneally injected with MEM culture medium for 28 days, followed by 10 5 TCID 50 The dose of SHVV was used for challenge, and tissue samples were taken on day 4 for SHVV testing; P160-5FU (10 5 TCID 50 ): SHVV-P160-5FU strain at 10 5 TCID 50 Immunize snakehead fish with intraperitoneal injection at a dose of 10 mg / L for 28 days, then administer 10 mg / L of immunized snakehead fish. 5 TCID 50 The dose of SHVV was used for challenge, and tissue samples were taken on day 4 for SHVV testing; P160-5FU (10 3 TCID 50): SHVV-P160-5FU strain at 10 3 TCID 50 Immunize snakehead fish with intraperitoneal injection at a dose of 10 mg / L for 28 days, then administer 10 mg / L of immunized snakehead fish. 5 TCID 50 The SHVV was challenged with a specific dose, and tissue samples were taken on day 4 to detect the G gene of SHVV.

[0013] Figure 5 Immunoprotective effect of SHVV P160-5FU strain against snakehead fish. Control: Snakehead fish were immunized intraperitoneally with MEM medium for 28 days, followed by 10... 5 TCID 50 The snakehead fish were challenged with SHVV at a dose of 1000-5 FU and the mortality rate was observed for 28 days; P160-5 FU (10 5 TCID 50 ): SHVV-P160-5FU strain at 10 5 TCID 50 Immunize snakehead fish with intraperitoneal injection at a dose of 10 mg / L for 28 days, then administer 10 mg / L of the immunized snakehead fish. 5 TCID 50 The snakehead fish were challenged with SHVV at a dose of 1000-5 FU and the mortality rate was observed for 28 days; P160-5 FU (10 3 TCID 50 ): SHVV-P160-5FU strain at 10 3 TCID 50 Immunize snakehead fish with intraperitoneal injection at a dose of 10 mg / L for 28 days, then administer 10 mg / L of the immunized snakehead fish. 5 TCID 50 The snakehead fish were challenged with SHVV at a specific dose, and mortality was observed for 28 days. Detailed Implementation

[0014] Experimental materials description:

[0015] Snakehead vesicle virus (SHVV) and channel catfish ovary cells (CCO) were preserved by the Fish Immunology and Disease Control Laboratory of the College of Fisheries, Huazhong Agricultural University. In the examples, "Pn strain" represents the SHVV strain obtained after n passages in CCO cells, and "5FU" indicates the addition of the mutagen 5-fluorouracil (5FU) during passage.

[0016] Example 1: Obtaining the SHVV-P160-5FU strain and its amino acid sequence analysis

[0017] 1. Obtaining the SHVV-P160-5FU strain

[0018] CCO cells were cultured in MEM medium (Gibco) containing 10% fetal bovine serum at 25°C for 12-24 hours until a monolayer was formed. SHVV was diluted 1:1000 with MEM medium. The culture medium in the CCO cells was discarded, and the CCO cells were washed twice with PBS. The diluted virus solution was added, and the CCO cells were incubated for 2 hours. The virus solution was discarded, and MEM medium containing 5% FBS was added for further culture. When 80% cytopathic effect was observed, the supernatant was collected. The above experiment was repeated until passage 160. During passages 101-160, 2.0 mg / mL 5-fluorouracil (5FU) was added to the MEM medium.

[0019] 2. Amino acid sequence analysis of SHVV-P160-5FU strain

[0020] SHVV-P1, SHVV-P100, SHVV-P130-5FU, and SHVV-P160-5FU strains were inoculated into monolayers of CCO cells and cultured for 36–48 hours. When cytopathic effects reached 80% or more, diseased cells were collected, 1 mL of Trizol reagent was added, and the mixture was incubated at room temperature for 10 min. Then, 200 μL of chloroform was added, vortexed, and allowed to stand at room temperature for 5 min. The cells were then centrifuged at 12,000 × g at 4 °C for 15 min. The supernatant was transferred to a new RNase-free centrifuge tube, and an equal volume of isopropanol was added. The mixture was incubated at room temperature for 10 min, and then centrifuged at 12,000 × g at 4 °C for 10 min. The supernatant was discarded, 1 mL of 75% ethanol was added, and the mixture was inverted to mix. The cells were then centrifuged at 12,000 × g at 4 °C for 5 min. The supernatant was discarded, and the precipitate was retained. The precipitate was dried for 2–5 min, and the liquid on the tube wall was aspirated. Finally, the RNA precipitate was dissolved in 20 μL of RNase-free H₂O. The obtained RNA was immediately reverse transcribed into cDNA using Novizan's reverse transcription kit, as follows:

[0021] first step:

[0022]

[0023] Mix gently by pipetting, incubate at 42°C for 2 minutes;

[0024] Step Two:

[0025]

[0026] Mix gently by pipetting, 50℃ for 15 min; 85℃ for 2 min.

[0027] The obtained cDNA was subjected to PCR amplification. First, primers for the N, P, M, G, and L genes of SHVV were designed segmentally based on the SHVV genome sequence (referencing MW291462.1). Each gene of SHVV was amplified segmentally according to the primer sequences in Table 1. 1 μL of reverse transcription product, 10 μL of Primer Star Mix, and 1 μL each of forward and reverse primers were added to the PCR reaction tube. The final volume was adjusted to 20 μL with ddH2O, and the mixture was then amplified on a PCR instrument. The PCR amplification program was: denaturation at 98℃ for 10 s, annealing at 55℃ for 5 s, extension at 72℃ for 30 s / kb, for 30 cycles. The amplified PCR products were sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. The amino acid sequence alignment results are shown in Table 2.

[0028] Table 1 PCR primer sequences

[0029]

[0030]

[0031] Compared with SHVV-P1, SHVV-P100 showed 10 amino acid mutations. Compared with SHVV-P100, SHVV-P130-5FU showed 11 amino acid mutations, including 1 amino acid mutation in the N gene (M66I), no amino acid mutations in the P and M genes, 2 amino acid mutations in the G gene (Q190E, R477G), and 8 amino acid mutations in the L gene (V177I, I298V, D395E, N528S, R765K, E1208K, V1471I, S2069L). Compared to the SHVV-P100 strain, the SHVV-P160-5FU strain exhibited 20 amino acid mutations. These included one mutation in the N gene (K267R), one mutation in the P gene (A33V), no mutations in the M gene, five mutations in the G gene (D109E, Q190E, I196V, N426S, I444V), and 13 mutations in the L gene (E148G, V177I, I298V, N528S, V536I, H569Y, R765K, V798I, K1059R, E1208K, I1348V, V1471I, S2069L). This indicates that the addition of the mutagen 5-fluorouracil (5FU) promoted amino acid mutations during viral passage.

[0032] Table 2. Amino acid sequence alignment results of SHVV passaged strains P1, P100, P130-5FU, and P160-5FU.

[0033]

[0034] Example 2: Comparison of the proliferation ability of SHVV passages in CCO cells

[0035] CCO cells that had grown into a monolayer were washed twice with PBS. SHVV-P1, SHVV-P100, SHVV-P130-5FU, and SHVV-P160-5FU strains were seeded into the confluent CCO cells at an MOI of 0.01. The cells were incubated at 25°C for 2 hours. The supernatant was discarded, and the culture medium was replaced with MEM containing 5% FBS. The supernatant was collected at 24 and 48 hours and analyzed using TCID50. 50 The viral titer in the supernatant was detected to compare the proliferation capacity of different passaged strains on CCO cells.

[0036] Use TCID 50 The method for detecting viral titers in the supernatant and comparing the proliferation abilities of SHVV-P1, SHVV-P100, SHVV-P130-5FU, and SHVV-P160-5FU strains in CCO cells is as follows: First, 1×10 4 100 μL of CCO cells were seeded into each well of a 96-well plate. After the cell monolayer had grown, the cells were washed twice with PBS. The collected SHVV-P1, SHVV-P100, SHVV-P130-5FU, and SHVV-P160-5FU viral solutions were then serially diluted 10-fold with MEM pure medium. -1 10 -2 ...10 -10 After dilution, 100 μL was added to each well of a 96-well plate, with 8 wells for each dilution. MEM pure medium was used as a negative control. After incubation at 25°C for 1 hour, the medium was replaced with MEM cell maintenance medium containing 5% FBS. After virus inoculation, observations were performed every 12 hours for 7 days, and the number of diseased cells in each well was recorded. Viral titers were calculated using the Reed-Muench formula.

[0037] The results are as follows Figure 1 As shown, comparing the viral titers of different strains at different time points revealed that the viral titer increased with increasing infection time. Comparing the viral titers of different passaged strains at the same time point showed that the titer of the passaged strains increased with increasing passage number. In summary, the viral titer gradually increased with increasing passage number, indicating that the proliferation capacity of the passaged strains in CCO cells gradually increased.

[0038] Example 3: Pathogenicity of SHVV-P160-5FU strain against snakehead fish and its immunoprotective effect as a vaccine. 1. Pathogenicity of SHVV-P160-5FU strain against snakehead fish.

[0039] Two hundred healthy hybrid snakehead fish (hereinafter referred to as snakehead fish) were selected and randomly divided into 5 groups, with 40 fish in each group and each fish weighing 10-15g. SHVV-P1 and SHVV-P160-5FU strains were respectively injected with 10 5 TCID 50 and 10 3 TCID 50 Snakehead fish were injected intraperitoneally with a dose of 100 μL per fish, while the control group was injected with the same volume of MEM culture medium. Disease and mortality were observed in snakehead fish for 28 days after injection, and mortality rates were recorded for each group.

[0040] The final statistical results are as follows Figure 2 As shown, the survival rates of SHVV-P1 strain after injection into snakehead fish at two different doses were 26.7% and 66.7%, respectively, while the survival rates of SHVV-P160-5FU strain after injection at two different doses were 83.3% and 93.3%. Statistical analysis of the mortality results shows that the lethality of SHVV-P160-5FU strain was significantly lower than that of SHVV-P1 strain, and the mortality rate of SHVV-P160-5FU strain was significantly lower after injection at 10... 5 TCID 50 When infected with the appropriate dose, the survival rate of snakehead fish still reached 83.3%, indicating that the virulence of the SHVV-P160-5FU strain was significantly weakened compared to the SHVV-P1 strain.

[0041] 2. Detection of serum neutralizing antibody titers in snakehead fish immunized with SHVV-P160-5FU strain 28 days after intraperitoneal injection

[0042] SHVV-P160-5FU strain was used at 10 5 TCID 50 and 10 3 TCID 50 Snakehead fish were immunized with intraperitoneal injection of a specific dose. Twenty-eight days later, five snakehead fish from each group were randomly selected for blood collection. Serum samples from the control group (snakehead fish immunized with MEM culture medium) were used as negative serum. Blood was collected from the tail vein using a 1.0 mL sterile syringe. The collected serum was placed in a 1.5 mL sterile centrifuge tube, incubated at room temperature for 1 hour, then incubated overnight at 4°C, and finally centrifuged at 3000 rpm for 15 minutes. The collected serum was stored at -20°C for later use. The serum collected in this experiment was analyzed using the fixed-virus dilution serum method to determine the neutralizing antibody titer. The specific steps were as follows: 100 μL of CCO cell suspension was added to each well of a 96-well plate and cultured in a 25°C incubator until the cells formed a monolayer. All serum samples were heated in a 56°C water bath for 30 min. The serum was then diluted 10-fold with MEM medium, followed by serial dilutions at ratios of 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, and 1:256. SHVV-P1 strain was diluted to 100 TCID50.50 Take 50 μL of 100 TCID solution. 50 The virus solution was mixed thoroughly with an equal volume of serially diluted serum and incubated at room temperature for 1 hour. The mixture was then seeded onto 96-well plates containing 80% confluent CCO cells, with four replicates per titer. The experiment also included a negative serum control group, a virus control group, and a normal cell control group. After culturing at 25°C for 4 days, the cell CPE count was observed and recorded, and the antibody neutralizing titer was calculated using the Reed-Muench method.

[0043] The results are as follows Figure 3 As shown, only in the SHVV-P160-5FU strain at 10 5 TCID 50 Neutralizing antibodies were detected in the serum of snakehead fish immunized with a dose of 10, while those of the SHVV-P160-5FU strain were detected at a dose of 10. 3 TCID 50 Antibodies were not detected in either the immunized snakehead or the control group at the specified dose.

[0044] 3. Immunoprotective effect of SHVV-P160-5FU strain against snakehead fish

[0045] SHVV-P160-5FU strain was used at 10 5 TCID 50 and 10 3 TCID 50 Snakehead fish were immunized with intraperitoneal injection at the recommended dose. Twenty-eight days later, they were challenged with 100 μL of SHVV (SHVV-P1 strain) via intraperitoneal injection. 5 TCID 50 The relative expression level of SHVV G gene in the liver and spleen tissues of snakehead fish was detected on the 4th day after challenge. At the same time, the mortality rate of snakehead fish was observed and counted 28 days after challenge. The relative protection rate (RPS) of the strain was calculated according to the following formula: RPS = (1 - mortality rate of the immunized group / mortality rate of the control group) × 100%.

[0046] The specific procedure for detecting the relative expression level of the SHVV G gene in the liver and spleen tissues of snakehead fish was as follows: RNA was extracted from the liver and spleen tissues of 5 snakehead fish randomly selected from each group, and cDNA was obtained by reverse transcription according to the steps described in the real-time quantitative reverse transcription kit. Using the control group as a reference and the expression level of β-actin as a calibration, the fluorescence signal was collected as Ct values ​​throughout the reaction process, and the relative expression level of the SHVV G gene was calculated.

[0047] The primer sequences for the G gene are: forward primer: ACACCATACATGCCAGAGGC; reverse primer: GCCTCGCTGGGTATCCAAAT;

[0048] The primer sequences for β-actin are: forward primer: CACTGTGCCCATCTACGAG; reverse primer: CCATCTCCTGCTCGAAGTC.

[0049] q-PCR reaction system:

[0050]

[0051] The reaction system was as follows: 95℃, 5min; 95℃, 15s, 55℃, 10s, 72℃, 15s, 45 cycles; 72℃, 3min.

[0052] The relative expression levels of the SHVV G gene in liver and spleen tissues are as follows: Figure 4 As shown, SHVV-P160-5FU strain 10 5 TCID 50 In the immunization group, the relative expression levels of the SHVV G gene in the liver and spleen of snakehead fish were significantly lower than those in the control group; while the expression levels of the SHVV-P160-5FU strain 10 were significantly lower. 3 TCID 50 In the immunization group, the relative expression levels of the SHVV G gene in the liver and spleen of snakehead fish were not significantly different from those in the control group. This indicates that the SHVV-P160-5FU strain, at a dose of 10, 5 TCID 50 Immunizing snakehead fish with a dose can reduce the proliferation capacity of SHVV in snakehead tissue.

[0053] Results of immune protection experiments as follows Figure 5 As shown, the survival rate of the control group was 27.3%, and that of the SHVV-P160-5FU strain was 10. 5 TCID 50 The survival rate of the immunized group reached 63.6%, with a relative protection rate of 50%; SHVV-P160-5FU strain 10 3 TCID 50 The survival rate of the immunized group reached 31.8%, with a relative protection rate of 6.25%. Overall, SHVV-P160-5FU, at 10... 5 TCID 50 Dosage-based immunization provides good protection.

Claims

1. Snakehead vesicle virus ( Snakehead vesiculovirus The attenuated SHVV strain SHVV-P160-5FU, characterized by, Its accession number is CCTCC NO:V202330.

2. A live attenuated vaccine against snakehead vesicular virus, characterized in that, Its active ingredient is the attenuated strain of snakehead vesicle virus described in claim 1.

3. The live attenuated snakehead vesicular virus vaccine according to claim 2, characterized in that, The dose of the attenuated strain SHVV-P160-5FU of snakehead vesicular virus in the vaccine is 10. 5 TCID 50 / 0.1ml.

4. The use of the attenuated snakehead vesicular virus strain SHVV-P160-5FU described in claim 1 in the preparation of a live attenuated snakehead vesicular virus vaccine.

Images