Use of a product that promotes expression of a Per gene and / or a Slc1a gene in the manufacture of a medicament for the treatment of sleep deprivation

Abstract

The present application relates to the technical field of medicine, in particular to the application of a product for promoting the expression of Per gene and / or Slc1a gene in the preparation of a medicine for treating sleep deprivation. The sleep deprivation early death model constructed by the present application is verified from the periodic expression of clock genes, brain nerve cell apoptosis, inflammation and the like, and through transcriptomic analysis, the key differentially expressed genes, clock genes Per and glutamate transporter coding genes Slc1a, are identified, and drugs are used for intervention on the two coding proteins, which have a relieving effect on the early death caused by sleep deprivation, that is, the drugs designed for the two targets or the existing drugs have the effect of relieving the consequences of sleep deprivation, that is, Per and Slc1a can be used as potential therapeutic targets, which provides a basis for developing a medicine for preventing death caused by sleep deprivation.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, and in particular to the use of products that promote the expression of the Per gene and / or the Slc1a gene in the preparation of medicaments for treating sleep deprivation. Background Technology

[0002] Sleep deprivation is a prevalent problem in modern society, impacting the lives of many. It can cause serious cardiovascular diseases (such as heart disease and diabetes) and brain dysfunction (such as Alzheimer's disease, dementia, and epilepsy). Prolonged sleep deprivation can lead to premature death; data from animal models also indicate that chronic sleep deprivation causes premature death. However, current research on its molecular mechanisms is insufficient, and there is a lack of clearly defined intervention targets and corresponding therapeutic drugs.

[0003] Sleep deprivation models include dogs, rats, and fruit flies. Zebrafish juveniles exhibit behavioral, physiological, and pharmacological characteristics of mammalian sleep, sharing 87% genetic similarity with humans. Their behavioral responses to known sleep and wakefulness-active compounds are similar to those of mammals, making them a compelling model for sleep research.

[0004] Currently, a large number of studies have been conducted using zebrafish to construct sleep deprivation models. However, these studies mainly focus on behavior and memory, and do not involve research on sleep deprivation-induced premature death. Furthermore, there is a lack of clear intervention targets and corresponding therapeutic drugs for sleep deprivation-induced premature death. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides the use of products that promote the expression of the Per gene and / or the Slc1a gene in the preparation of medicaments for treating sleep deprivation. This invention discovers that the Per gene and the Slc1a gene can serve as drug targets, as well as therapeutic agents EX 527 and riluzole.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides the use of products that promote the expression of the Per gene and / or the Slc1a gene in the preparation of medicaments for treating sleep deprivation.

[0008] Preferably, the product includes EX 527.

[0009] This invention provides the use of products that alleviate glutamate accumulation caused by low expression of the Per gene and / or Slc1a gene in the preparation of medicaments for treating sleep deprivation.

[0010] Preferably, the product includes riluzole.

[0011] This invention provides the use of products that promote the absorption or metabolism of glutamate in the preparation of medicaments for treating sleep deprivation.

[0012] Preferably, the product includes riluzole.

[0013] Beneficial effects:

[0014] The sleep deprivation-induced premature death model constructed in this invention has been validated through periodic expression of clock genes, brain nerve cell apoptosis, and inflammation. Furthermore, transcriptomic analysis identified key differentially expressed genes—the clock gene Per and the glutamate transporter gene Slc1a. Drug intervention targeting these two encoded proteins has a mitigating effect on sleep deprivation-induced premature death. This indicates that drugs designed or existing drugs targeting these two points can alleviate the consequences of sleep deprivation, suggesting that Per and Slc1a can serve as potential therapeutic targets, providing a basis for developing primers to prevent death caused by sleep deprivation. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0016] Figure 1 The survival rate of zebrafish after sleep deprivation;

[0017] Figure 2 Pathological sections of brain tissue from a zebrafish subjected to sleep deprivation;

[0018] Figure 3 Results of immune cell response in zebrafish after sleep deprivation;

[0019] Figure 4 The results show the periodic expression of the clock genes Per-1, Per-2, and Per-3 over a 24-hour period.

[0020] Figure 5 Transcriptome analysis results of zebrafish after sleep deprivation;

[0021] Figure 6 The effect of riluzole on the survival rate of sleep-deprived zebrafish;

[0022] Figure 7 The effects of EX527 on the expression of Per and Slc1a and on survival rate. Detailed Implementation

[0023] This invention provides the use of products that promote the expression of the Per gene and / or the Slc1a gene in the preparation of medicaments for treating sleep deprivation. In this invention, the products preferably include EX 527.

[0024] This invention utilizes zebrafish to construct a sleep deprivation-induced premature death model. The feasibility of the model was validated through the periodic expression of clock genes, brain neuron apoptosis, and inflammation. Furthermore, transcriptomic analysis identified key differentially expressed genes—the clock gene Per and the glutamate transporter gene Slc1a—and targeted drug intervention against these two encoded proteins showed a mitigating effect on sleep deprivation-induced premature death. Experimental results showed that EX527 treatment increased the expression levels of Per-1 and Slc1a-1 and significantly reduced sleep deprivation-induced mortality. This indicates that using the compound EX527 to increase the expression levels of Per and Slc1a can alleviate sleep deprivation-induced mortality, suggesting that Per and Slc1a can serve as drug targets.

[0025] This invention provides the use of products that alleviate glutamate accumulation in the brain caused by low expression of the Per gene and / or Slc1a gene in the preparation of medicaments for treating sleep deprivation. In this invention, the product preferably includes riluzole. Riluzole is a novel glutamate modulator that promotes glutamate uptake. Low expression of Slc1a causes glutamate accumulation in the brain, leading to death. This invention uses riluzole as a candidate therapeutic agent targeting Slc1a to alleviate premature death caused by sleep deprivation. Experimental results show that the addition of riluzole in the sleep deprivation group significantly delayed the progression of death. This indicates that the Slc1a-encoded protein can serve as a therapeutic target for sleep deprivation-induced death.

[0026] This invention also provides the use of products that promote glutamate absorption or metabolism in the preparation of medicaments for treating sleep deprivation. In this invention, the product preferably includes riluzole. Slc1a is a gene encoding a glutamate transporter. This invention has found that sleep deprivation leads to downregulation of Slc1a expression, resulting in glutamate accumulation and ultimately inducing death. Therefore, drugs that enhance glutamate absorption or metabolism are also a symptomatic treatment method. Experiments in this invention have shown that the addition of riluzole to the sleep deprivation group significantly delayed the progression of death.

[0027] To further illustrate the present invention, the application of the products that promote the expression of the Per gene and / or Slc1a gene provided by the present invention in the preparation of medicaments for treating sleep deprivation is described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0028] Preparation Example

[0029] Zebrafish rearing: Zebrafish were cultured in water at 28±0.5℃ with a light-dark cycle of 14:10h. They were mated after four months of age. After spawning, fertilized embryos were collected and cultured in fish culture solution. The fish culture solution was changed daily, and dead embryos were removed. The hatched fry were cultured for another 3 days as zebrafish for subsequent examples.

[0030] The fish liquid is prepared by using 3.6g sodium bicarbonate, 10g sea salt, and 15ml methylene blue solution.

[0031] Example 1

[0032] Establishment of a Zebrafish Sleep Deprivation Premature Death Model

[0033] 1) Survival rate determination: Wild-type zebrafish (AB strain) were purchased from the National Zebrafish Resource Center and raised in aquariums with daily fluid changes. The rearing conditions were: 28±0.5℃, a light-dark cycle of 14:10h, with lights on at 9:00 AM and off at 11:00 PM. The normal group received normal light, while the sleep-deprived group was raised in a continuously lit environment. Survival rates of both groups were recorded daily. Statistical analysis was performed using GraphPad Prism 8.0, and data were analyzed using the log-rank (Mantel Cox) test. Results are shown below. Figure 1 , where n represents the number of zebrafish in each group.

[0034] Depend on Figure 1 It can be seen that zebrafish subjected to continuous light treatment experienced premature mortality and a significant decrease in survival rate, with a mortality rate of 100% after about 10 days.

[0035] 2) Brain cell apoptosis staining: Wild-type zebrafish (AB strain) were fed using the method in step 1). Zebrafish deprived of sleep for 5 days were selected for head paraffin sections. The control group consisted of zebrafish under normal light. After sectioning, anti-Cleaved-Caspase-3 antibody (AC033, Beyotime, this antibody is used as a marker of apoptosis) was used for immunofluorescence staining. Cell nuclei were stained with DAPI (C1002, Beyotime) to determine the extent of brain tissue damage. The staining method was referenced in [XiaoX, Zhang R, Pang X, Liang G, Wang P, Cheng GA neuron-specific antiviral mechanism prevents lethal flaviviral infection of mosquitoes. PLoS Pathog. 2015 Apr27; 11(4):e1004848.]. The staining results are shown in the figure. Figure 2 .

[0036] Depend on Figure 2It is known that after light-induced sleep deprivation, brain cells undergo apoptosis, while this phenomenon is not observed in the normal group of brain cells. This indicates that sleep deprivation causes damage to brain tissue and leads to apoptosis of brain cells.

[0037] 3) Inflammatory Response: The migration of centrioles and macrophages is a marker of the inflammatory response. In this invention, centrioles and macrophage-labeled fish strain Tg(lyz:DsRed2) (purchased from the National Zebrafish Resource Center, ID CZ59, website http: / / www.zfish.cn / ) were fed using the method in step 1). On day 5 of light-sleep deprivation, the migration status of centrioles and macrophages was recorded using a fluorescence microscope. The results are shown below. Figure 3 .

[0038] Depend on Figure 3 It was observed that after sleep deprivation, most of the centrioles and macrophages in zebrafish migrated from the abdomen towards the head, indicating inflammation in that area. This suggests that sleep deprivation caused damage and inflammation to the brain tissue.

[0039] 4) Detection of periodic expression of clock genes: After processing according to step 1), samples from the normal group and the sleep deprivation group were collected at 0h, 3h, 6h, 9h, 12h, 15h, 18h, 21h, and 24h after treatment. Total RNA was extracted from zebrafish using the Axygen RNA Extraction Kit (AP-MN-MS-RNA-250G), and the total RNA was reverse transcribed into cDNA using the Bio-Rad Reverse Transcription Kit (1708891) (reaction system shown in Table 1). The reverse transcription conditions were: incubation at 42℃ for 15min. The expression of Per-1, Per-3 genes was detected using the Bio-Rad qPCR Detection Kit (172-5121). The qPCR reaction system is shown in Table 2, and the primers used for qPCR are shown in Table 3. The qPCR reaction program was: 94℃ for 30s; 94℃ for 5s, 60℃ for 30s, 40-45 cycles. Results are shown in Table 2. Figure 4 .

[0040] Table 1 Reverse Transcription System

[0041] TotalRNA 1μL <![CDATA[Oligo(dT) 18 ]]> 1μL 2xESReactionMix 10μL RT / RIEnzymeMix 1μL gRNARemover 1μL RNase-freeWater 6μL total 20μL

[0042] Table 2 qPCR reaction system

[0043]

[0044]

[0045] Table 3 Primer sequences for different genes

[0046] Gene Upstream primer (5'-3') SEQ ID Downstream primer (5'-3') SEQ ID Per-1 AGATCAACTGCCTGGACAGG NO.1 GAGTCTCTGCTTGGGTTGCT NO.2 Per-2 TACACTTTCGCTCGCACTGT NO.3 TTTGACTTGGCTCCTCCGAC NO.4 Per-3 TTCCGGATCACTCCGTACCT NO.5 CCTGGTGAATGAGTCGTGCT NO.6 β-actin CCTTCCAGCAGATGTGGATTAG NO.7 GATTTGCCTGACAATGGTGAAGT NO.8

[0047] Depend on Figure 4 It was found that the expression of Per-1, Per-1, and Per-3 genes in the normal group showed a periodic expression pattern over 24 hours, while the expression of Per-1, Per-1, and Per-3 genes in the sleep deprivation group showed an irregular and decreasing trend. This indicates that the circadian rhythm of the zebrafish in the sleep deprivation group was disrupted, and the model was successfully constructed at the gene level.

[0048] Example 2

[0049] Differential gene expression analysis in a zebrafish sleep deprivation premature death model

[0050] After processing according to step 1) of Example 1, samples from the normal group and the sleep-deprivation group of zebrafish were collected. RNA was extracted using the Trizol method and sent to Beijing Novogene Technology Co., Ltd. for sequencing analysis. The results are shown in […]. Figure 5 .

[0051] Depend on Figure 5 Differential analysis of the transcriptome revealed significant downregulation of the zebrafish clock gene Per (transcripts Per-1, Per-2, and Per-3) and the glutamate transporter gene Slc1a (transcripts Slc1a-1 and Slc1a-1). This indicates a close correlation between sleep deprivation-induced premature death and the clock gene and the glutamate transporter gene Slc1a.

[0052] Example 3

[0053] Riluzole can alleviate death caused by sleep deprivation.

[0054] Riluzole is a novel glutamate modulator that promotes glutamate absorption. This invention uses riluzole as a candidate therapeutic agent targeting Slc1a to alleviate sleep deprivation-induced premature death.

[0055] After processing according to step 1) of Example 1, the samples are divided into three groups, as follows:

[0056] 1) Add DMSO (dimethyl sulfoxide) to the normal group fish solution at a final volume concentration of 1‰;

[0057] 2) The sleep deprivation group was given DMSO at a final volume concentration of 1‰;

[0058] 3) The sleep deprivation group was given a riluzole solution with a final volume concentration of 1‰, wherein the concentration of riluzole in the riluzole solution was 0.01μM and the solvent was DMSO.

[0059] The survival rate of zebrafish was recorded daily. Statistical analysis was performed using GraphPad Prism 8.0, and the data were analyzed using the log-rank (Mantel Cox) test. Results are shown below. Figure 6 , where n represents the number of zebrafish in each group.

[0060] The results showed that the addition of riluzole to the sleep deprivation group significantly delayed the progression of death. This indicates that the Slc1a-encoded protein could serve as a therapeutic target for sleep deprivation-induced death.

[0061] Example 4

[0062] Compounds that promote the expression of Per and Slc1a can alleviate sleep deprivation-induced death.

[0063] This invention uses Selisistat (EX 527) to increase the expression of Per and observes its alleviating effect on sleep deprivation-induced death.

[0064] The experiment was divided into three groups, as detailed in Example 3. The difference was that the riluzole solution in group 3) was replaced with a Selisistat (EX 527) solution at a concentration of 20 μM, using DMSO as the solvent. The survival rate of the zebrafish was recorded daily, and the results are shown below. Figure 7 C in the middle.

[0065] Three groups of samples were collected. Total RNA was extracted from zebrafish using the Axygen RNA Extraction Kit (AP-MN-MS-RNA-250G). cDNA was extracted using the Bio-Rad Reverse Transcription Kit (1708891) (reaction system as in step 4 of Example 1). The expression of Per-1 and Slc1a-1 was detected using the Bio-Rad qPCR Detection Kit (172-5121). The qPCR reaction system and reaction procedure were the same as in step 4 of Example 1. The primer sequences for Per-1 and the internal reference gene β-actin are shown in Table 3. The primer sequences for Slc1a-1 are as follows: upstream primer: 5'-ATGGTCATTGCCTTCCCTGG-3' (SEQ ID NO. 9), downstream primer: 5'-GGTTTCCAGGGTGGATGAGG-3' (SEQ ID NO. 10). Statistical analysis of the data was performed using GraphPad Prism 8.0. In the survival rate experiment, n represents the number of zebrafish in each group. The data were analyzed using the log-rank (Mantel Cox) test. The results are shown in [link to results]. Figure 7In this study, A represents the effect of EX527 on sleep deprivation in zebrafish, and B and C represent the effects of EX527 on the expression of Per and Slc1a mRNA. Independent data were analyzed using unpaired t-tests and nonparametric Mann-Whitney tests. **, p < 0.01, ***, p < 0.001.

[0066] The results showed that EX 527 treatment increased the expression levels of Per-1 and Slc1a-1 and significantly reduced sleep deprivation-induced death. This indicates that using the compound EX527 to increase the expression levels of Per and Slc1a can alleviate sleep deprivation-induced death, suggesting that Per and Slc1a can serve as drug targets.

[0067] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of EX 527 in the preparation of drugs for treating sleep deprivation.

Images