A monoclonal antibody or antigen-binding fragment thereof and its anti-tumor use

Abstract

The application discloses a monoclonal antibody or an antigen-binding fragment thereof, wherein the antibody or the fragment contains CDR sequences selected from at least one of the following: heavy chain variable region CDR sequences SEQ ID NO: 1-11; light chain variable region CDR sequences SEQ ID NO: 12-26, or amino acid sequences with at least 95% identity thereto, and the monoclonal antibody or the antigen-binding fragment thereof is selected from scFv amino acid sequences SEQ ID NO: 27-33. The monoclonal antibody or the antigen-binding fragment thereof specifically recognizes LL / 2-Luc2 or other tumor cell-related antigens, has an anti-tumor effect and application, and has a good application prospect.

Description

[0001] This application is a divisional application of application number CN202310211947.6, filed on March 7, 2023, entitled "A monoclonal antibody or its antigen-binding fragment and its use in antitumor therapy". Technical Field

[0002] This invention belongs to the field of biomedicine, specifically relating to a monoclonal antibody or its antigen-binding fragment and its anti-tumor use. Background Technology

[0003] Lung cancer is currently the leading cause of cancer death worldwide and is one of the malignant tumors with the highest incidence and mortality rates globally. While numerous treatment options exist for lung cancer, its prognosis remains poor, and overall treatment outcomes are still unsatisfactory. Due to the difficulties in early diagnosis and the lack of effective treatments, selecting a simple, readily available, and highly successful animal model of lung cancer is essential for further in-depth research into its carcinogenic factors, pathogenesis, and the development of effective treatments and prevention measures.

[0004] Lewis lung cancer cells have been widely used in many important studies. The Lewis lung cancer cell line (LLC) was first isolated from mouse Lewis lung cancer and is an adapted cultured cell clone. C57BL / 6 mice have normal immune function, are inexpensive, well-tolerated, and have a mature model, and are often used to construct Lewis cell lung cancer metastasis models. LLC cells maintain high tumorigenicity and lung metastasis in C57BL / 6 mice. After being modified by genetic engineering, LLC cells can express luciferase or green fluorescent protein, achieving the effect of visualizing tumor cells in vivo (Bertram JS, Janik P. Establishment of a cloned line of Lewis lung carcinoma cells adapted to cell culture[J]. Cancer Lett, 1980, 11(1):63-73; Zhu H, et al. A simple bioluminescence imaging method for studying cancer cell growth and metastasis after subcutaneous injection of Lewis lung carcinoma cells in syngeneic C57BL / 6 mice[J]. React Oxyg Species (Apex), 2018, 5(14):118-125).

[0005] With the emergence of phage display technology and the development of genetic engineering antibody technology, phage antibody library technology has become a new method for preparing monoclonal antibodies. At present, most phage antibody libraries are immune phage libraries. After immunization, the antibody level in the animal body is increased, which is more conducive to screening for antibodies against specific antigens and has more advantages for subsequent diagnosis and treatment (Xu Jing, Zhang Lei, et al., Construction and expression of scFv phage display library of B3HM cell-immunized mouse spleen cells, China Biotechnology Journal, 2007, 27(7): 12-16).

[0006] There are currently no reports on the screening of specific monoclonal antibodies from animals immunized with LL / 2-Luc2 cells. This invention utilizes phage display technology to screen for monoclonal antibodies that specifically target LL / 2-Luc2 cells, providing a foundation for obtaining antibodies that specifically recognize tumor cells and for further preparation of antitumor drugs. Summary of the Invention

[0007] This invention provides a monoclonal antibody or its antigen-binding fragment thereof that specifically targets LL / 2-Luc2 lung cancer cells. Using genetic engineering methods, monoclonal antibodies or their antigen-binding fragments that specifically bind to LL / 2-Luc2 cells are screened and identified from a murine immunophage antibody library, achieving the goal of effectively and rapidly recognizing LL / 2-Luc2 lung cancer cells. This provides a strategy and method for obtaining monoclonal antibodies that specifically target tumor cells.

[0008] The following implementation scheme is provided to achieve the objectives of the present invention.

[0009] The present invention discloses a monoclonal antibody or antigen-binding fragment thereof, wherein the monoclonal antibody or antigen-binding fragment comprises a heavy chain variable region (CDR) and a light chain variable region (CDR), wherein the heavy chain variable region (CDR) has an amino acid sequence selected from SEQ ID NO: 1 to 11 or an amino acid sequence having at least 95% identity with it, and the light chain variable region (CDR) has an amino acid sequence selected from SEQ ID NO: 12 to 26 or an amino acid sequence having at least 95% identity with it.

[0010] In one specific embodiment, a monoclonal antibody or its antigen-binding fragment of the present invention, wherein the heavy chain variable region CDR is CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region CDR is CDR-L1, CDR-L2, and CDR-L3, and the monoclonal antibody or its antigen-binding fragment has an amino acid sequence selected from the following group:

[0011] 1) CDR-H1 has the amino acid sequence shown in SEQ ID NO:1, CDR-H2 has the amino acid sequence shown in SEQ ID NO:4, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:8; CDR-L1 has the amino acid sequence shown in SEQ ID NO:12, CDR-L2 has the amino acid sequence shown in SEQ ID NO:16, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:21.

[0012] 2) CDR-H1 has the amino acid sequence shown in SEQ ID NO:1, CDR-H2 has the amino acid sequence shown in SEQ ID NO:4, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:8; CDR-L1 has the amino acid sequence shown in SEQ ID NO:13, CDR-L2 has the amino acid sequence shown in SEQ ID NO:17, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:22.

[0013] 3) CDR-H1 has the amino acid sequence shown in SEQ ID NO:2, CDR-H2 has the amino acid sequence shown in SEQ ID NO:5, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:9; CDR-L1 has the amino acid sequence shown in SEQ ID NO:14, CDR-L2 has the amino acid sequence shown in SEQ ID NO:18, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:23.

[0014] 4) CDR-H1 has the amino acid sequence shown in SEQ ID NO:1, CDR-H2 has the amino acid sequence shown in SEQ ID NO:6, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:9; CDR-L1 has the amino acid sequence shown in SEQ ID NO:14, CDR-L2 has the amino acid sequence shown in SEQ ID NO:18, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:24.

[0015] 5) CDR-H1 has the amino acid sequence shown in SEQ ID NO:1, CDR-H2 has the amino acid sequence shown in SEQ ID NO:4, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:8; CDR-L1 has the amino acid sequence shown in SEQ ID NO:15, CDR-L2 has the amino acid sequence shown in SEQ ID NO:19, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:25.

[0016] 6) CDR-H1 has the amino acid sequence shown in SEQ ID NO:1, CDR-H2 has the amino acid sequence shown in SEQ ID NO:4, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:11; CDR-L1 has the amino acid sequence shown in SEQ ID NO:14, CDR-L2 has the amino acid sequence shown in SEQ ID NO:20, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:26.

[0017] 7) CDR-H1 has the amino acid sequence shown in SEQ ID NO:3, CDR-H2 has the amino acid sequence shown in SEQ ID NO:7, and CDR-H3 has the amino acid sequence shown in SEQ ID NO:10. CDR-L1 has the amino acid sequence shown in SEQ ID NO:12, CDR-L2 has the amino acid sequence shown in SEQ ID NO:16, and CDR-L3 has the amino acid sequence shown in SEQ ID NO:21.

[0018] Preferably, the monoclonal antibody or antigen-binding fragment of the present invention described above has an amino acid sequence selected from those shown in SEQ ID NO. 27 to 33.

[0019] More preferably, the monoclonal antibody or its antigen-binding fragment of the present invention described above has a sequence selected from the antibody numbers 501, Y003, Y005, Y008, Y009, Y010 and RA001 in Table 1.

[0020] The present invention also provides a DNA molecule that encodes the monoclonal antibody or antigen-binding fragment thereof described above.

[0021] The present invention also provides an expression vector containing the monoclonal antibody or its antigen-binding fragment described above, wherein the expression sequence of the IL-10 signal peptide-monoclonal antibody is cloned into the Not1 / Xba1 enzyme multiple cloning site of the pcDNA3.4 vector.

[0022] The present invention also provides a eukaryotic host cell into which the above-mentioned expression vector is inserted and transformed.

[0023] The eukaryotic host cell mentioned above is a CHO cell.

[0024] Terminology: CDR-H1, CDR-H2, and CDR-H3 represent heavy chain complementarity determination region 1, heavy chain complementarity determination region 2, and heavy chain complementarity determination region 3, respectively; CDR-L1, CDR-L2, and CDR-L3 represent light chain complementarity determination region 1, light chain complementarity determination region 2, and light chain complementarity determination region 3, respectively.

[0025] In another specific embodiment, the present invention provides a monoclonal antibody or antigen-binding fragment thereof targeting LL / 2-Luc2 cells, comprising heavy chain complementarity-determining region 1 (CDR-H1), heavy chain complementarity-determining region 2 (CDR-H2), heavy chain complementarity-determining region 3 (CDR-H3), and light chain complementarity-determining region 1 (CDR-L1), light chain complementarity-determining region 2 (CDR-L2), and light chain complementarity-determining region 3 (CDR-L3). The amino acid sequences of the heavy chain variable region CDR are shown in SEQ ID NO: 1-11; the amino acid sequences of the light chain variable region CDR are shown in SEQ ID NO: 12-26.

[0026] Preferably, in another specific embodiment described above, the amino acid sequence of the CDR of the monoclonal antibody or antigen-binding fragment targeting LL / 2-Luc2 cells of the present invention is selected from the following group:

[0027] (1) The amino acid sequence of CDR-H1 is SEQ ID NO:1, the amino acid sequence of CDR-H2 is SEQ ID NO:4, the amino acid sequence of CDR-H3 is SEQ ID NO:8; the amino acid sequence of CDR-L1 is SEQ ID NO:12, the amino acid sequence of CDR-L2 is SEQ ID NO:16, and the amino acid sequence of CDR-L3 is SEQ ID NO:21;

[0028] (2) The amino acid sequence of CDR-H1 is SEQ ID NO:1, the amino acid sequence of CDR-H2 is SEQ ID NO:4, and the amino acid sequence of CDR-H3 is SEQ ID NO:8; the amino acid sequence of CDR-L1 is SEQ ID NO:13, the amino acid sequence of CDR-L2 is SEQ ID NO:17, and the amino acid sequence of CDR-L3 is SEQ ID NO:22;

[0029] (3) The amino acid sequence of CDR-H1 is SEQ ID NO:2, the amino acid sequence of CDR-H2 is SEQ ID NO:5, the amino acid sequence of CDR-H3 is SEQ ID NO:9; the amino acid sequence of CDR-L1 is SEQ ID NO:14, the amino acid sequence of CDR-L2 is SEQ ID NO:18, and the amino acid sequence of CDR-L3 is SEQ ID NO:23;

[0030] (4) The amino acid sequence of CDR-H1 is SEQ ID NO:1, the amino acid sequence of CDR-H2 is SEQ ID NO:6, the amino acid sequence of CDR-H3 is SEQ ID NO:9; the amino acid sequence of CDR-L1 is SEQ ID NO:14, the amino acid sequence of CDR-L2 is SEQ ID NO:18, and the amino acid sequence of CDR-L3 is SEQ ID NO:24;

[0031] (5) The amino acid sequence of CDR-H1 is SEQ ID NO:1, the amino acid sequence of CDR-H2 is SEQ ID NO:4, the amino acid sequence of CDR-H3 is SEQ ID NO:8; the amino acid sequence of CDR-L1 is SEQ ID NO:15, the amino acid sequence of CDR-L2 is SEQ ID NO:19, and the amino acid sequence of CDR-L3 is SEQ ID NO:25;

[0032] (6) The amino acid sequence of CDR-H1 is SEQ ID NO:1, the amino acid sequence of CDR-H2 is SEQ ID NO:4, and the amino acid sequence of CDR-H3 is SEQ ID NO:11; the amino acid sequence of CDR-L1 is SEQ ID NO:14, the amino acid sequence of CDR-L2 is SEQ ID NO:20, and the amino acid sequence of CDR-L3 is SEQ ID NO:26;

[0033] (7) The amino acid sequence of CDR-H1 is SEQ ID NO:3, the amino acid sequence of CDR-H2 is SEQ ID NO:7, the amino acid sequence of CDR-H3 is SEQ ID NO:10; the amino acid sequence of CDR-L1 is SEQ ID NO:12, the amino acid sequence of CDR-L2 is SEQ ID NO:16, and the amino acid sequence of CDR-L3 is SEQ ID NO:21.

[0034] Furthermore, the monoclonal antibody or its antigen-binding fragment of the present invention is selected from the scFv amino acid sequence as shown in any one of SEQ ID NO: 27 to 33.

[0035] This invention provides a method for screening the scFv sequence of the monoclonal antibody or its antigen-binding fragment, the screening method comprising the following steps:

[0036] The first step is the construction of a phage antibody library;

[0037] The second step is screening the phage antibody library;

[0038] The third step involves successfully enriching positive LL / 2-Luc2 cells, plating the enriched phage culture onto a plate, selecting positive monoclonal phages and sending them to a sequencing company for sequencing to obtain monoclonal antibodies targeting LL / 2-Luc2 cells or the heavy chain and light chain variable region sequences of their antigen-binding fragments.

[0039] The fourth step involves assembling the obtained heavy and light chain variable region sequences into scFv sequences to express the corresponding antibodies.

[0040] Preferably, the construction of the phage antibody library in the first step includes:

[0041] (1) Six 6-8 week old C57 mice (half male and half female) were immunized intraperitoneally with Lewis lung cancer LL / 2-Luc2 cells in the exponential growth phase. Each mouse was injected with 1 x 10 cells. 5 Each cell was injected every other week, and the mice were sacrificed after three immunizations.

[0042] (2) RNA was extracted from the spleens of 6 immunized mice;

[0043] (3) RNA is reverse transcribed into cDNA, which is then used as a template to amplify VH (heavy chain variable region) and VL (light chain variable region) by PCR, and then spliced ​​into scFv fragments.

[0044] (4) Electroporate the scFv fragment into the phage and evaluate the quality of the library;

[0045] (5) Collect antibody library phages and establish the original library of scFv phage antibody library.

[0046] The present invention also provides a DNA molecule encoding the above-mentioned monoclonal antibody or its antigen-binding fragment.

[0047] The present invention provides a recombinant vector comprising the aforementioned monoclonal antibody targeting LL / 2-Luc2 cells, the vector comprising the aforementioned DNA molecule; the expression sequence of the IL-10 signal peptide-monoclonal antibody is cloned into the Not1 / Xba1 enzyme multiple cloning site of the pcDNA3.4 vector.

[0048] This invention provides a host cell transformed by the aforementioned expression vector. In a preferred embodiment, the host cell is a CHO cell.

[0049] This invention provides a method for preparing the monoclonal antibody described above, the method comprising:

[0050] (1) An expression vector is provided, the expression vector containing a nucleic acid sequence encoding the monoclonal antibody of the present invention and an expression regulatory sequence operatively linked to the sequence;

[0051] (2) Transform host cells using the expression vector described in step (1);

[0052] (3) Culturing the host cells obtained in step (2) under conditions suitable for the expression of the monoclonal antibody;

[0053] (4) The monoclonal antibody was obtained by separation and purification.

[0054] The monoclonal antibody is a unique antibody that can specifically bind to LL / 2-Luc2 cells. Flow cytometry results showed that the chimeric antibody containing the 501 antibody sequence, expressed in vitro, achieved a binding rate of 35.84% with LL / 2-Luc2 positive cells, while the binding rate with negative cells was approximately 3.36%. Immunocytochemical experiments showed that the chimeric antibody containing the 501 antibody sequence had a strong positive binding to LL / 2-Luc2 positive cells but almost no binding to negative cells, all indicating that the chimeric antibody has the characteristic of targeting LL / 2-Luc2 cells.

[0055] In combination with the above technical solutions, the advantages and positive effects of this invention are as follows: The monoclonal antibody or its antigen-binding fragment targeting LL / 2-Luc2 cells provided by this invention provides support for constructing genetically engineered antibodies that specifically target tumor cells. The monoclonal antibody or its antigen-binding fragment of this invention specifically targets LL / 2-Luc2 lung cancer cells and inhibits their growth, thus exhibiting anti-tumor activity. Attached Figure Description

[0056] Figure 1 It is a pcDNA3.4 vector, and its elements and restriction sites are shown;

[0057] Figure 2 The expression vector constructed in this invention contains heavy chain variable region and light chain variable region genes that specifically recognize monoclonal antibodies that recognize LL / 2-Luc2 (the light-colored region is the target gene);

[0058] Figure 3 This is an electrophoresis diagram of the protein purification of the chimeric antibody containing the 501 antibody sequence of the present invention;

[0059] Figure 4 This is a high-performance liquid chromatogram of the chimeric antibody containing the 501 antibody sequence of the present invention;

[0060] Figure 5 This is a flow cytometry result of the chimeric antibody containing the 501 antibody sequence of the present invention specifically binding to LL / 2-Luc2.

[0061] Figure 6This is an image showing the immunocytochemical detection results of the chimeric antibody containing the 501 antibody sequence of the present invention specifically binding to LL / 2-Luc2 (darker color indicates positive expression);

[0062] Figure 7 The chimeric antibody of this invention exhibits growth-inhibiting activity against LL / 2-Luc2 cells. Detailed Implementation

[0063] The following examples are provided to further illustrate and understand the essence of the present invention, but do not limit the scope of the present invention in any way. Any simple modifications and variations made under the spirit of the present invention are within the scope of the present invention.

[0064] Positive cells: LL / 2-Luc2 mouse Lewis lung cancer cells, purchased from ATCC.

[0065] Negative cells: Normal mouse lung epithelial cells, purchased from Shanghai Fuxiang Biotechnology Co., Ltd.

[0066] Example 1: Screening for antibody gene variable regions targeting LL / 2-Luc2 cells from an antibody library

[0067] 1) Construction of a mouse antibody library

[0068] Six 6-8 week old C57 mice (half male and half female) were immunized intraperitoneally with Lewis lung cancer LL / 2-Luc2 cells in the exponential growth phase. Each mouse was injected with 1×10⁻⁶ cells. 5 One cell was injected every other week for three immunizations. Blood was collected from the tail vein on the third day after the last immunization, and the cell was euthanized.

[0069] Serum was separated from mouse blood, and antibody titers were detected using a standard ELISA method. LL / 2-Luc2 cells in the coating index growth phase were cultured in 96-well microplates at a concentration of 1×10⁶ cells / well. 5 Cells / well, PBS buffer as negative control. Primary antibody was mouse serum after immunization, diluted appropriately; mouse serum injected with PBS buffer served as negative control. Secondary antibody was HRP-labeled goat anti-mouse IgG antibody, developed with tetramethylbenzidine (TMB), stop solution added, and absorbance measured at 450 nm using a microplate reader. OD 450 Subtracting the blank value, a value greater than twice that of the negative control was considered positive. The results showed that the average titer of the six mouse serum samples was greater than 1:10.

[0070] Spleens from six immunized mice were collected and mixed, and splenic lymphocytes were isolated. 2 × 10⁻⁶ cells were collected. 7 Total RNA was extracted from mouse spleens using a total RNA extraction kit according to the instructions.

[0071] Reverse transcription was performed immediately after total RNA extraction using a reverse transcription kit. The PCR reaction program was as follows: 95℃ pre-denaturation for 2 min, followed by 94℃ denaturation for 30 s, 55℃ annealing for 45 s, and 72℃ extension for 1 min, for a total of 30 cycles. The obtained cDNA can be temporarily stored at 4℃, while cDNA requiring long-term storage should be stored at -20℃, avoiding repeated freeze-thaw cycles.

[0072] Using cDNA as a template, VH / VL fragments were obtained through a single round of PCR amplification with a high-fidelity enzyme; then, using VL as a template, Linker-VL fragments were obtained through a second round of PCR amplification; and scFv fragments were obtained through overlap PCR using VH and Linker-VL templates.

[0073] The purified scFv gene product was digested and recovered by enzymes, ligated with a vector fragment that had been digested and purified by the same enzymes, and then the ligation product was electroporated. The electroporation product was activated and the antibody library phages were collected.

[0074] Library capacity was determined, and 10 single clones were randomly selected from LB / Carb50 plates for PCR identification. The GA insertion efficiency was >90%.

[0075] 2) Screening of phage antibody libraries

[0076] Phages that specifically bind to LL / 2-Luc2 were selected using a subtractive screening method (negative selection followed by positive selection). Normal or control cells (3 × 10⁻⁶) were used first. 6 (number of cells) and library phage supernatant (titer 2 × 10⁻⁶) 10 The suspension was incubated at 4°C for 2 hours to adsorb non-specific antibodies. The phage supernatant was collected by centrifugation and then used to treat target cells LL / 2-Luc2 (5×10⁻⁶). 6 (Number of cells) were bound to phage supernatant and incubated at 4°C for 2 hours for affinity screening. The cells were washed 6-8 times with pre-cooled PT buffer at 4°C. Alpha5F phages were added and cultured overnight for amplification. The phages were isolated and purified using the PEG8000 / NaCl precipitation method. Three to four rounds of phage panning were performed, and the final phage library was stored in 50% glycerol at -80°C.

[0077] 3) Pick positive monoclonal phage antibodies and sequence them to obtain the scFv sequence.

[0078] Positive monoclonal phage antibodies were selected from phage culture enriched in LL / 2-Luc2 cells and sent to a sequencing company for sequencing. The heavy chain and light chain variable region sequences of the monoclonal antibodies targeting LL / 2-Luc2 cells were obtained and assembled into single-chain antibodies 501, Y003, Y005, Y008, Y009, Y010, and RA001. Their scFv amino acid sequences are shown in Table 1.

[0079] Table 1. Amino acid sequences of scFv targeting LL / 2-Luc2 cells

[0080]

[0081]

[0082] The amino acid sequence of the complementary determinant region (CDR), which plays a key role in the variable region of the above antibodies, is shown in Table 2.

[0083] Table 2. CDR amino acid sequences of monoclonal antibodies targeting LL / 2-Luc2 cells.

[0084]

[0085]

[0086] The composition of the complementarity-determining region (CDR) of each monoclonal antibody or its antigen-binding fragment targeting LL / 2-Luc2 cells is shown in Table 3.

[0087] Table 3. Amino acid sequences of the complementarity-determining regions of specific monoclonal antibodies.

[0088]

[0089] Example 2: Preparation of Recombinant Vector

[0090] The antibody sequences obtained through screening were expressed using scFv+ rabbit Fc protein. The antibody sequences were then organized into an IL-10 signal peptide-chimeric antibody and cloned into the pcDNA3.4 vector.

[0091] Nucleotide sequence of the linker region SEQ ID NO.34:

[0092] GGTGGTGGCGGATCAGGTGGGGGAGGCTCTGGTGGAGGCGGTAGT.

[0093] The nucleotide sequence of the IL-10 signal peptide is SEQ ID NO.35:

[0094] GCGGCCGCAAACTACAAGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC.

[0095] The nucleotide sequence of the Fc fragment is SEQ ID NO.36:

[0096] .

[0097] The integrated sequence was synthesized in its entirety by Shanghai Baiying Biotechnology Co., Ltd., and cloned into the pcDNA3.4 plasmid (e.g., Figure 1 As shown), the recombinant vector (as shown) was constructed by Baiying Biotechnology using the upstream NotⅠ restriction site and the downstream XbaⅠ restriction site. Figure 2(As shown). Figure 2 The constructed expression vector contains heavy chain variable region and light chain variable region genes of a monoclonal antibody that specifically recognizes LL / 2-Luc2.

[0098] Example 3: Antibody Expression and Purification

[0099] The constructed expression vector pcDNA3.4-Vector+scFv+Fc carrying the chimeric antibody gene was transformed into *E. coli* DH5α strain and amplified by inoculation into 100 mL LB medium. Plasmid DNA was extracted and purified using an Ultraplasmid DNA Purification Kit. The purified plasmid DNA was then co-transfected into CHO cells using an Invitrogen lipofectamine 2000 transfection reagent (11668-027), following the manufacturer's instructions.

[0100] Transformed CHO cells were selected on MTX selection medium (Sigma A-6770) for two consecutive weeks, and then subjected to extreme dilution culture in 96-well plates for three consecutive times to achieve monoclonalization.

[0101] The selected monoclonal cell lines were cultured on RPMI 1640 medium (Invitrogen). The chimeric antibody was directly isolated and purified from the cell culture supernatant using a Protein A affinity chromatography column. The purified protein collection was then identified by SDA-PAGE electrophoresis. Figure 3 It can be seen that the chimeric antibody protein containing the 501 antibody sequence was significantly expressed in CHO cells.

[0102] The affinity chromatography product was subjected to molecular sieve chromatography again. The purity results of the seven expressed and purified chimeric antibodies were identified by HPLC and are shown in Table 4. Figure 4 As shown, chimeric antibodies containing the 501 antibody sequence yielded samples with a purity >98%.

[0103] Table 4. Purity of chimeric antibodies targeting LL / 2-Luc2 cells

[0104]

[0105] Example 4: Flow cytometry detection of chimeric antibodies

[0106] After digesting the cultured positive and negative cells with trypsin, the cells were thoroughly pipetted to form a single-cell suspension. 1 × 10⁸ positive cells and 1 × 10⁸ negative cells were then collected from each suspension. 6Centrifuge at 250g for 5 min, discard the culture medium, wash cells three times with pre-chilled PBS, centrifuge at 250g for 5 min, and collect the cell pellet for later use. Resuspend cells in 100 μL PBS, add 5 μL of chimeric antibody, mix, and incubate at 4°C in the dark for 30 min; centrifuge at 350g for 5 min, discard the supernatant. Wash cells three times with pre-chilled PBS to remove unbound antibodies, obtaining positive and negative cell-antibody complexes respectively.

[0107] The cell-antibody complexes were mixed with fluorescently labeled donkey anti-rabbit IgG and incubated at 4°C in the dark for 30 min. The cells were washed three times with pre-cooled PBS to remove unbound fluorescent donkey anti-rabbit IgG, resulting in positive and negative cell-antibody-secondary antibody complexes.

[0108] In addition, positive and negative cells were used as blank controls, which only bound to the secondary antibody.

[0109] The cell-antibody-secondary antibody complexes and cell-secondary antibody complexes were resuspended in 300 μL PBS and detected by flow cytometry. The flow cytometry results were analyzed using CytExpert software.

[0110] The chimeric antibody specifically recognizes LL / 2-Luc2 cells. Then, a fluorescently labeled donkey anti-rabbit secondary antibody is used to recognize this chimeric antibody. Therefore, cells displaying fluorescence with the secondary antibody are considered positive cells capable of binding to the chimeric antibody. Flow cytometry results are shown below. Figure 5 As shown in Table 5, Figure 5 The results are obtained by flow cytometry analysis of the specific binding of the chimeric antibody containing the 501 antibody sequence to LL / 2-Luc2 cells. The chimeric antibody containing the 501 antibody sequence showed a binding rate of 35.84% to LL / 2-Luc2 positive cells and approximately 3.36% to negative cells, verifying that the chimeric antibody can specifically bind to LL / 2-Luc2 cells.

[0111] Table 5 Positive binding rate of chimeric antibodies targeting LL / 2-Luc2 cells

[0112]

[0113]

[0114] Example 5: Immunocytochemical detection of chimeric antibodies

[0115] (1) Preparation of cell slides:

[0116] Positive and negative cells in the exponential growth phase were collected separately, digested with trypsin, and thoroughly pipetted to form a single-cell suspension. The suspension was centrifuged at 1000 rpm for 5 minutes, the supernatant was removed, and the cells were resuspended in an appropriate amount of complete culture medium for counting. The cell density was adjusted to 1–2 × 10⁶ cells / year. 5per mL.

[0117] Remove the sterile 6-well plate. Depending on the size of the slides, first place a small amount of culture medium in each well where you intend to place the cell slides, then place the slides in the wells. This prevents the slides from floating up when adding the cell suspension, which could result in a double layer of cells adhering to the slide. Then, seed each well with 2 mL of the prepared cell suspension (dropping the cell suspension onto the slide one drop at a time) to achieve a cell density of approximately 2 × 10⁻⁶ cells / well. 5 Cells per well, capped and incubated at 37°C with 5% CO2 until cells are fully adhered.

[0118] (2) Immunocytochemical detection:

[0119] ① Fixation: Remove the well plate, aspirate the culture medium, gently wash the cells twice with PBS, and then fix with 4% paraformaldehyde for 30 min;

[0120] ② Blocking: Take the fixative, wash twice with PBS, add goat serum blocking solution dropwise for 5 min each time, and incubate at room temperature for 20 min;

[0121] ③ Primary antibody: Add chimeric antibody solution and incubate overnight at 4°C;

[0122] ④ Secondary antibody: Add biotin-labeled goat anti-rabbit IgG, incubate at 37℃ for 30 min; wash with PBS 3 times, 5 min each time;

[0123] ⑤ Add horseradish enzyme-labeled streptavidin working solution, incubate at 37℃ for 30 min; wash with PBS 3 times, 5 min each time;

[0124] ⑥ DAB color development: Using a DAB color development kit, mix the reagents and drop them onto the cell slides. Incubate at room temperature and control the reaction time under a microscope, generally around 2 minutes. Wash with distilled water.

[0125] ⑦ Lightly counterstain with hematoxylin, dehydrate, clear, and mount with neutral resin.

[0126] ⑧ The BA200 Digital trinocular microscopic imaging system manufactured by Macody Industrial Group Co., Ltd. was used to acquire images of the slides.

[0127] Positive cells and negative cells that only bind to the secondary antibody were used as blank control groups.

[0128] (3) Results

[0129] like Figure 6The image shows the immunocytochemical detection results of the chimeric antibody containing the 501 antibody sequence specifically binding to LL / 2-Luc2 cells. LL / 2-Luc2 cells showed strong positive staining on the smear, while normal lung epithelial cells showed no obvious staining, indicating that the chimeric antibody containing the 501 antibody sequence can specifically bind to LL / 2-Luc2 cells.

[0130] Example 6: Growth inhibitory activity of chimeric antibodies

[0131] The growth-inhibiting effect of the chimeric antibody on LL / 2-Luc2 cells was detected using the CellTiter-Glo chemiluminescence immunoassay kit (Promega, Cat#: G7570). LL / 2-Luc2 cells in the exponential growth phase were digested and collected, centrifuged at 250g for 5 minutes, and then resuspended in complete culture medium. The cell density was adjusted to 1×10⁶ cells / year. 5 Cells / mL were added to each well of a 96-well plate with 50 μL of cell suspension and incubated overnight at 37°C. Antibodies were diluted to different concentrations with culture medium, and 50 μL of antibody dilution was added to each well of a 96-well plate, incubating for 3 days at 37°C. The 96-well plates were then incubated at room temperature for 30 minutes, and 100 μL / well of CellTiter-Glo chromogenic solution was added. Samples were then incubated at room temperature for 10 minutes in the dark. The plates were read using a PE Enspire reader. Growth inhibition activity (%) = [1 - (luminescent sample) / (luminescent mock control)] × 100. Rabbit IgG Isotype Control (Thermo Fisher Scientific, Cat#:02-6102) antibody was used as a negative control. Figure 7 As shown, the chimeric antibody containing the 501, Y009, and RA001 antibody sequences exhibited dose-dependent bioinhibitory activity against LL / 2-Luc2 cells. The maximum growth inhibition rate of the antibody against LL / 2-Luc2 cells is shown in Table 6.

[0132] Table 6. Maximum growth-inhibiting activity of chimeric antibodies against LL / 2-Luc2 cells.

[0133]

[0134] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions, and improvements made by those skilled in the art within the scope of the technology disclosed in the present invention, and within the spirit and principles of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A monoclonal antibody targeting LL / 2-Luc2 or an antigen-binding fragment thereof, said antibody or antigen-binding fragment comprising a heavy chain variable region (CDR) and a light chain variable region (CDR), wherein the heavy chain variable region (CDR) is CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region (CDR) is CDR-L1, CDR-L2, and CDR-L3. The CDR-H1 is the amino acid sequence shown in SEQ ID NO:1; CDR-H2 has the amino acid sequence shown in SEQ ID NO:6; CDR-H3 has the amino acid sequence shown in SEQ ID NO:9; CDR-L1 is the amino acid sequence shown in SEQ ID NO:14; CDR-L2 has the amino acid sequence shown in SEQ ID NO:18; and CDR-L3 is the amino acid sequence shown in SEQ ID NO:

24.

2. The monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that, The monoclonal antibody or its antigen-binding fragment has the amino acid sequence shown in SEQ ID NO:

30.

3. A DNA molecule, characterized in that, Encodes the monoclonal antibody or antigen-binding fragment thereof as described in claim 1 or 2.

4. An expression vector comprising a recombinant vector encoding the monoclonal antibody or its antigen-binding fragment as described in claim 1 or 2, characterized in that, The expression sequence of the IL-10 signal peptide—the monoclonal antibody or its antigen-binding fragment thereof—was cloned into the Not1 / Xba1 enzyme multiple cloning site of the pcDNA3.4 vector.

5. The expression vector according to claim 4, wherein the recombinant vector comprises the DNA molecule according to claim 3.

6. A eukaryotic host cell containing the expression vector as described in claim 4 or 5.

7. The eukaryotic host cell according to claim 6, wherein the eukaryotic host cell is a CHO cell.

Images