A method for fermentative production of dipre-cercosporin

Abstract

The application discloses a method for fermenting and producing dipre-cercosporin, and belongs to the technical field of genetic engineering and microbial fermentation. The method of the application takes wild type Cercospora sp. JNU001 as an expression host, and realizes production of a new type of perylenequinone compound dipre-cercosporin by knocking out a CTB10 gene, with a yield of 6.29 mg / L. Compared with a chemical method for synthesizing perylenequinone derivatives, the method is simple and efficient, and can quickly realize mass preparation of some specific perylenequinone derivatives. In addition, compared with a constituent monomer pre-cercosporin, the compound has better photodynamic inhibition effect on some gram-positive bacteria and yeast, and has a wide application prospect in the field of photodynamic antibiosis.

Description

Technical Field

[0001] This invention relates to a method for producing dipre-cercosporin through fermentation, belonging to the fields of genetic engineering and microbial fermentation technology. Background Technology

[0002] Perylene quinones are a class of pigments widely found in nature, containing a specific 4,9-dihydroxyperylene-3,10-quinone pentacyclic conjugated structure. Most are produced by plant pathogens and include cercosporin, hypocrellin, phleichrome, and elsinochrome. When exposed to ambient light, these compounds can generate various reactive oxygen species (ROS) that can effectively kill some bacteria, fungi, and plant cells, serving as an important means of infecting the host. Based on their unique photosensitizing activity, these compounds have been widely used in environmental remediation, agricultural protection, medicine and health, materials science, and chemical synthesis. Furthermore, perylene quinones can also serve as excellent photosensitizers in photodynamic therapy (PDT) for tumors.

[0003] Although many perylene quinone compounds have been isolated and identified, the types of benzoquinone compounds with novel skeleton structures are very limited, greatly restricting further research and application of these compounds. Currently, perylene quinone compounds are prepared by two methods: chemical synthesis and microbial fermentation. Microbial fermentation is limited by the difficulty in isolating relevant strains and the protection of strain intellectual property rights, and can only produce a portion of perylene quinone compounds. Although chemical synthesis can achieve the synthesis of perylene quinone compounds with specific structures (Journal of the American Chemical Society, 2009, 131(26):9413-9425), it involves many steps and complex reaction conditions, making it difficult to prepare efficiently. Taking cercariaein, which has been studied extensively, as an example, its chemical synthesis requires 20 steps, with a total yield of only 2.8%. Therefore, producing perylene quinone compounds with novel skeleton structures through genetically engineered bacteria is a simple and efficient approach. Summary of the Invention

[0004] This invention provides a method for producing the novel perylene quinone compound dipre-cercosporin using recombinant Cercospora. This method, employing genetic engineering and microbial fermentation techniques, utilizes the wild-type Cercospora sp. JNU001 as the starting strain to achieve efficient production of the novel perylene quinone compound dipre-cercosporin.

[0005] This invention provides a genetically engineered bacterium, which is obtained by knocking out the CTB10 gene encoding a dehydrating enzyme in the host cell of Cetacea JNU001 (CCTCC NO:M 2017842). The mutant is then inoculated into a fermentation medium and cultured for a certain period of time. Finally, a perylene quinone compound, dipre-cercosporin, with a novel skeletal structure is obtained through isolation and purification.

[0006] In one embodiment of the present invention, the nucleotide sequence of the CTB10 gene is shown in SEQ ID NO.1.

[0007] The present invention also provides a perylenequinone compound, the structural formula of which is shown below:

[0008]

[0009] The present invention also provides a method for preparing the above-mentioned perylene quinone compound, wherein the method involves fermenting the above-mentioned genetically engineered bacteria.

[0010] In one embodiment of the present invention, the method involves inoculating the above-mentioned genetically engineered bacteria into a fermentation medium for fermentation culture to prepare a fermentation broth, and extracting the obtained fermentation broth to prepare a perylene quinone compound.

[0011] In one embodiment of the present invention, the fermentation culture conditions are as follows: fermentation for 7-10 days at a temperature of 22-28℃, an initial pH of 7.0-8.5, a rotation speed of 100-150 rpm, and continuous or intermittent light.

[0012] In one embodiment of the present invention, the fermentation medium contains: 10-30 g / L glucose, 1-3 g / L soybean peptone, 0.5-2 g / L sodium acetate, 0.5-1.5 mg / L biotin, 2.5-7.5 mg / L L-phenylalanine, 50-150 mg / L sodium benzoate, 0.5-1.5 mg / L pyridoxal phosphate, 0.5-1.5 mg / L thiamine hydrochloride, 100-200 mg / L potassium dihydrogen phosphate, 3-10 mg / L calcium nitrate, 0.5-1.5 mg / L calcium pantothenate, 2.5-10 mg / L manganese chloride, 1-3 mg / L ferric chloride, 0.5-1.5 mg / L copper nitrate, 2-6 mg / L magnesium sulfate, and 1-5 mg / L zinc sulfate.

[0013] In one embodiment of the present invention, the fermentation medium contains: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L L-phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, and 4.4 mg / L zinc sulfate.

[0014] In one embodiment of the present invention, the fermentation broth after fermentation is completed is extracted with 0.5-2 times the volume of dichloromethane or ethyl acetate to separate the organic phase, water is removed using anhydrous sodium sulfate, and the solvent is removed by rotary evaporation to obtain crude perylene quinone compound.

[0015] In one embodiment of the present invention, the fermentation method of the dipre-cercosporin is as follows: recombinant Cercosporin is added to the fermentation medium at a rate of 10 bacterial blocks (1 cm in diameter × 0.8 cm in thickness) / L of medium. Fermentation is carried out for 8 days at a temperature of 25°C, an initial pH of 8.0, a rotation speed of 135 rpm, and continuous or intermittent light.

[0016] In one embodiment of the present invention, the extraction method of dipre-cercosporin is as follows: the fermentation broth after fermentation is completed is filtered through a single layer of gauze to separate the bacterial cells and the fermentation broth; the bacterial cells are dried in a freeze dryer and then extracted with an equal volume of ethyl acetate; the fermentation broth is directly extracted with an equal volume of dichloromethane. The organic phase is separated, water is removed using anhydrous sodium sulfate, and the solvent is removed by rotary evaporation to obtain crude dipre-cercosporin.

[0017] In one embodiment of the present invention, the separation and purification method of dipre-cercosporin is as follows: the obtained crude dipre-cercosporin is dissolved in dichloromethane, and preliminary separation is performed by thin-layer chromatography using methanol and dichloromethane as eluents at a volume ratio of 1:20. The main red band fraction is collected to obtain dipre-cercosporin with a purity greater than 80%. The obtained sample is dissolved in acetonitrile and further purified by semi-preparative separation using a mobile phase of 50% water and 50% acetonitrile (both containing 0.1% formic acid by volume), finally obtaining a dipre-cercosporin standard with a purity greater than >98%.

[0018] The present invention also provides the application of the above-mentioned recombinant Cercospora sp. JNU001 in the preparation of dipre-cercosporin or products containing dipre-cercosporin.

[0019] This invention also provides the application of the above-mentioned genetically engineered bacteria or the above-mentioned method in the preparation of perylene quinone compounds or products containing perylene quinone compounds;

[0020] The structural formula of the perylenequinone compound is:

[0021]

[0022] The present invention also provides a pharmaceutical composition comprising the above-described compound or its stereoisomer or racemate or tautomer.

[0023] In one embodiment of the present invention, the drug is a photodynamic drug, a photosensitizer, or a tumor fluorescent labeling reagent.

[0024] The present invention also provides the use of the above-mentioned compound or its stereoisomer or its racemate or its tautomer in the preparation of pharmaceuticals.

[0025] In one embodiment of the present invention, the drug is a photodynamic drug, a photosensitizer, or a tumor fluorescent labeling reagent.

[0026] Beneficial effects

[0027] This invention utilizes wild-type Cercospora sp. JNU001 as the expression host and achieves the production of a novel perylene quinone compound, dipre-cercosporin, through genetic engineering and fermentation engineering, with a yield of 6.29 mg / L. Compared with existing technologies, this invention has the following characteristics and beneficial effects:

[0028] (1) Compared with the chemical synthesis of perylene quinone derivatives, the method of preparing the compound dipre-cercosporin of the present invention is not only simple to operate, but also can quickly obtain and prepare large quantities of these compounds at a lower cost.

[0029] (2) Compared with the perylene quinone compounds reported so far, the compound dipre-cercosporin prepared in this invention has a stronger ultraviolet-visible light absorption capacity and its absorption spectrum has a significant red shift, which to some extent overcomes the common problem of short absorption wavelength of perylene quinone compounds and has obvious advantages in photodynamic therapy of tumors.

[0030] (3) The compound dipre-cercosporin prepared in this invention not only has extremely strong photodynamic inhibitory activity against Gram-positive bacteria, but also has a good inhibitory effect on fungi that are difficult to kill, and can be used as a broad-spectrum photodynamic antibacterial drug.

[0031] (4) Compared with its constituent monomer pre-cercosporin, the compound dipre-cercosporin prepared in this invention has significantly improved photodynamic activity. Attached Figure Description

[0032] Figure 1 The results are PCR verification results for the Cercospora JNU001ΔCTB10 mutant strain.

[0033] Figure 2 Plate morphology of Cercospora JNU001ΔCTB10 mutant strain.

[0034] Figure 3 This is a liquid phase analysis diagram of the metabolites of the Cercospora JNU001ΔCTB10 mutant strain.

[0035] Figure 4 The structural formula for dipre-cercosporin is given.

[0036] Figure 5 The crystal structure of dipre-cercosporin is shown.

[0037] Figure 6 This is a high-resolution mass spectrum of dipre-cercosporin.

[0038] Figure 7 For dipre-cercosporin 1 H spectrum (CDCl3, 600MHz).

[0039] Figure 8 For dipre-cercosporin 13 C spectrum (CDCl3, 600MHz).

[0040] Figure 9 For dipre-cercosporin 1 H- 1 H COSY spectrum (CDCl3, 600MHz).

[0041] Figure 10 For dipre-cercosporin 1 H- 1 H TOCSY spectrum (CDCl3, 600MHz).

[0042] Figure 11 For dipre-cercosporin 1 H- 1 H NOESY spectrum (CDCl3, 600MHz).

[0043] Figure 12 For dipre-cercosporin 1 H- 13 C HSQC spectrum (CDCl3, 600MHz).

[0044] Figure 13 For dipre-cercosporin 1 H- 13 C HMBC spectrum (CDCl3, 600MHz).

[0045] Figure 14 This is the standard curve for high-performance liquid chromatography analysis of dipre-cercosporin.

[0046] Figure 15 The curves show the inhibition of the compound on three bacterial strains.

[0047] Figure 16 The curves show the inhibition of the compound on three yeast strains.

[0048] Figure 17 UV-Vis absorption spectroscopy analysis of dipre-cercosporin. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments.

[0050] The Staphylococcus aureus, Exiguobacterium acetylicum, Bacillus megaterium, and Yarrowia lipolytica used in the following examples were isolated from the environment and preserved in our laboratory; Pichia pastoris X33 was purchased from Invitrogen; and Saccharomyces cerevisiae BY4742 was purchased from the American Type Culture Collection (ATCC).

[0051] The pre-cercosporin mentioned in the following examples is the monomeric structure of dipre-cercosporin, which was isolated and purified from Cercospora JNU001 in our laboratory; the specific structure is as follows:

[0052]

[0053] The culture media designed in the following examples are as follows:

[0054] S-7O solid culture medium: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, 4.4 mg / L zinc sulfate, and 20 g / L agar.

[0055] S-7O liquid fermentation medium: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, 4.4 mg / L zinc sulfate.

[0056] Lysozyme: Purchased from the Institute of Microbiology, Guangdong Academy of Sciences.

[0057] Hygromycin resistance selection medium: 4 g / L PDA, 50 mg / L hygromycin.

[0058] The buffer solutions used in the following examples are as follows:

[0059] Osmotic buffer: 1.0M magnesium sulfate, 100mM potassium phosphate buffer (pH 5.8).

[0060] STC buffer: 1.2M sorbitol, 50mM calcium chloride, sterilized by filtration, stored at 4°C.

[0061] PEG6000 buffer: 25% (w / v) PEG6000, 0.1M calcium chloride, 0.6M potassium chloride, sterilized by filtration, stored at 4°C.

[0062] Example 1: Construction of the Cercospora JNU001ΔCTB10 mutant strain

[0063] The specific steps are as follows:

[0064] (1) Preparation of Cercospora protoplasts

[0065] Cercospora JNU001 was inoculated onto S-7O plates and cultured for 7 days in a 25°C light incubator. Two bacterial blocks (1 cm diameter × 0.8 cm thickness) were punched and inoculated into 250 mL shake flasks containing 100 mL of S-7O liquid fermentation medium. The flasks were then incubated at 25°C and 135 rpm under light for 5 days. The bacterial cells were collected by filtering through a single layer of sterile gauze. The cells were thoroughly ground in a sterile mortar and resuspended in 100 mL of S-7O liquid fermentation medium in a 250 mL shake flask for 12 hours to recover. The recovered cells were collected using a sterile single layer of gauze and washed 2-3 times with an appropriate amount of osmotic buffer. 10 mL of osmotic buffer containing 200 mg of lysozyme was added, and the mixture was incubated at 30°C and 100 rpm for 3 hours. After incubation, filter the bacterial culture through 6 layers of sterile gauze to remove residue. Add an equal volume of STC buffer to the filtrate, centrifuge at 6000 rpm for 15 min, and discard the supernatant. Add twice the volume of STC buffer for enzyme digestion, centrifuge at 6000 rpm for 8 min, and discard the supernatant. Resuspend the bacterial cells in an appropriate amount of STC buffer to achieve a protoplast concentration of 2 × 10⁻⁶. 7 Protoplast concentration was determined by counting cells / mL using a hemocytometer. The cells were aliquoted into 200 μL tubes and stored at -80°C.

[0066] (2) Obtaining the knockout fragment

[0067] The CTB10 gene reading frame (SEQ ID NO.1) was found in the genome of Cercospora JNU001. 1500 bp fragments upstream and downstream of the CTB10 gene reading frame were cloned, and the upstream and downstream sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0068] SEQ ID NO.2CTB10-up(1500bp):

[0069]

[0070] SEQ ID NO.3CTB10-down(1500bp):

[0071]

[0072] The hygromycin resistance expression cassette consists of the hph gene, the PgpdA promoter derived from Aspergillus nidulans, and the TtrpC terminator, as shown in SEQ ID NO.4.

[0073] SEQ ID NO.4: Hygromycin resistance expression cassette (containing gpdA promoter (underlined) - hph gene - trpC terminator (underlined))

[0074] GAATTCCCTTGTATCTCTACACACAGGCTCAAATCAATAAGAAGAACGGTTCGTCTTTTTCGTTTATAT CTTGCATCGTCCCAAAGCTATTGGCGGGATATTCTGTTTGCAGTTGGCTGACTTGAAGTAATCTCTGCAGATCTTTC GACACTGAAATACGTCGAGCCTGCTCCGCTTGGAAGCGGCGAGGAGCCTCGTCCTGTCACAACTACCAACATGGAGT ACGATAAGGGCCAGTTCCGCCAGCTCATTAAGAGCCAGTTCATGGGCGTTGGCATGATGGCCGTCATGCATCTGTAC TTCAAGTACACCAACGCTCTTCTGATCCAGTCGATCATCCGCTGAAGGCGCTTTCGAATCTGGTTAAGATCCACGTC TTCGGGAAGCCAGCGACTGGTGACCTCCAGCGTCCCTTTAAGGCTGCCAACAGCTTTCTCAGCCAGGGCCAGCCCAA GACCGACAAGGCCTCCCTCCAGAACGCCGAGAAGAACTGGAGGGGTGGTGTCAAGGAGGAGTAAGCTCCTTATTGAA GTCGGAGGACGGAGCGGTGTCAAGAGGATATTCTTCGACTCTGTATTATAGATAAGATGATGAGGAATTGGAGGTAG CATAGCTTCATTTGGATTTGCTTTCCAGGCTGAGACTCTAGCTTGGAGCATAGAGGGTCCTTTGGCTTTCAATATTC TCAAGTATCTCGAGTTTGAACTTATTCCCTGTGAACCTTTTATTCACCAATGAGCATTGGAATGAACATGAATCTGA GGACTGCAATCGCCATGAGGTTTTCGAAATACATCCGGATGTCGAAGGCTTGGGGCACCTGCGTTGGTTGAATTTAG AACGTGGCACTATTGATCATCCGATAGCTCTGCAAAGGGCGTTGCACAATGCAAGTCAAACGTTGCTAGCAGTTCCA GGTGGAATGTTATGATGAGCATTGTATTAAATCAGGAGATATAGCATGATCTCTAGTTAGCTCACCACAAAGTCAG ACGGCGTAACCAAAAGTCACACAACACAAGCTGTAAGGATTTCGGCACGGCTACGGAAGACGGAGAAGCCACCTTCA GTGGACTCGAGTACCATTTAATTCTATTGTGTTTGATCGAGACCTAATACAGCCCCTACACGACCATCAAAGTCG TATAGCTACCAGTGAGGAAGTGGACTCAAATCGACTTCAGCAACATCTCCTGGATAAACTTTAAGCCTAAACTATAC AGAATAAGATAGGTGGAGAGCTTATACCGAGCTCCCAAATCTGTCCAGATCATGGTTGACCGGTGCCTGGATCTTCC TATAGAATCATCCTTATTCGTTGACCTAGCTGATTCTGGAGTGACCCAGAGGGGTCATGACTTGAGCCTAAAATCCGC CGCCTCCACCATTTGTAGAAAAATGTGACGAACTCGTGAGCTCTGTACAGTGACCGGTGACTCTTTCTGGCATGCGG AGAGACGGACGGACGCAGAGAGAAGGGCTGAGTAATAAGCCACTGGCCAGACAGCTCTGGGCGGCTCTGAGGTGCAGT GGATGATTATTAACCGGGACCGGCCGCCCCTCCGCCCCGAAGTGGAAAGGCTGGTGTGCCCCTCGTTGACCAAGAA TCTATTGCATCATCGGAGAATATGGAGCTTCATCGAATCACCGGCAGTAAGCGAAGGAGAATGTGAAGCCAGGGGTG TATAGCCGTCGGCGAAATAGCATGCCATTAACCTAGGTACAGAAGTCCAATTGCTTCCGATCTGGTAAAGATTCAC GAGATAGTACCTTCTCGAAGTAGGTAGAGCGAGTACCCGCGCGTAAGCTCCCTAATTGGCCCATCCGGCATCTGT AGGGCGTCCAAATATCGTGCCTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGCCGCTCAGGAGCTGGCCAGCG GCGCAGACCGGGAACACAAGCTGGCAGTCGACCCATCCGGTGCTCTGCACTCGACCTGCTGAGGTCCCTCAGTCCCT GGTAGGCAGCTTTGCCCCGTCTGTCCGCCCGGTGTGTCGGCGGGGTTGACAAGGTCGTTGCGTCAGTCCAACATTTG TTGCCATATTTTCCTGCTCTCCCCACCAGCTGCTCTTTTCTTTTCTCTTTCTTTTCCCATCTTCAGTATATTCATCT TCCCATCCAAGAACCTTTATTTCCCCTAAGTAAGTACTTTGCTACATCCATACTCCATCCTTCCCATCCCTTATTCC TTTGAACCTTTCAGTTCGAGCTTTCCCACTTCATCGCAGCTTGACTAACAGCTACCCCGCTTGAGCAGACATCACC AGTAGATGCCGACCGATCCACTTAACGTTACTGAAATCATCAAACAGCTTGACGAATCT GGATATAAGATCGTTGGTGTCGATGTCAGCTCCGGAGTTGAGACAAATGGTGTTCAGGATCTCGATAAGATACGTTC ATTTGTCCAAGCAGCAAAGAGTGCCTTCTAGTGATTTAATAGCTCCATGTCAACAAGAATAAAACGCGTTTTCGGGT TTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGACTGCAACCTAGTAACGCCTTCAGGCTCCGGC GAAGAGAAGAATAGCTTAGCAGAGTCTATTTTCATTTTCGGGAGACGAGATCAAGCAGATCAACGGTCGTCAAGAGA CCTACGAGACTGAGGAATCCGCTCTTGGCTCCACGCGACTATATATTTGTCTCTAATTGTACTTTGACATGCTCCTC TTCTTTACTCTGATAGCTTGACTATGAAAATTCCGTCACCAGCCCCTGGGTTCGCAAAGATAATTGCACTGTTTCTT CCTTGAACTCTCAAGCCTACAGGACACACATTCATCGTAGGTATAAACCTCGAAATCATTCCTACTAAGATGGGTA TACAATAGTAACCATGGTTGCCTAGTGAATGCTCCGTAACACCCAATACGCCGGCCGAAACTTTTTTACAACTCTCC TATGAGTCGTTTACCCAGAATGCACAGGTACACTTGTTTAGAGGTAATCCTTCTTTCTAGAAGTCCTCGTGTACTGT GTAAGCGCCCACTCCACATCTCCACTCGA

[0075] The upstream sequence, hygromycin resistance expression cassette, and downstream sequence were integrated into the vector pXS (published in Liu J, Chai X, Guo T, Wu J, Yang P, Luo Y, Zhao H, Zhao W, Nkechi O, Dong J, Bai J, Lin Q (2019) Disruption of the ergosterol biosynthetic pathway results in increased membrane permeability, vausing overproduction and secretion of extracellular Monascus Pigments in submerged fermentation. J Agric Food Chem 67(49):13673-13683 doi:https: / / doi.org / 10.1021 / acs.jafc.9b05872), resulting in the complete plasmid pXS-ΔCTB10.

[0076] Using the intact plasmid pXS-ΔCTB10 as a template, PCR amplification of the knockout fragment containing the upstream and downstream sequences and the hygromycin expression cassette was performed using primers ΔCTB10-up-F (5'-AATCCACCGTCAATACCACATTCTTTGCG-3') and ΔCTB10-down-R (5'-CTCGCAGTACCATCCTTCTTAGAATCAAACATCT-3'). The PCR reaction was performed in a 50 μL system: 1.5 μL forward primer (10 μM), 1.5 μL reverse primer (10 μM), 1 μL template (10 ng), 22 μL double-distilled water, and 25 μL 2×Prime Star Max premix (Takara). The PCR program was as follows: denaturation, 98℃, 10 s; annealing, 60℃, 10 s; extension, 72℃, 40 s (5 s / kb), repeated for 30 cycles, with a final extension at 72℃ for 5 min. The amplified fragment was purified and recovered for later use.

[0077] (3) Protoplast transformation of Cercospora JNU001

[0078] Take 200 μL of *Cercospora JNU001* protoplasts, add 20 μg of the recovered knockout fragment obtained in step (2), mix gently, and incubate on ice for 1 h. Add 1.25 mL of PEG6000 buffer, mix well, and incubate at room temperature for 30 min. Add 5 mL of medium containing 1.2 M sorbitol, and incubate overnight at 25 °C and 135 rpm in a constant temperature shaker. Centrifuge at 6000 rpm for 15 min to collect the bacterial cells and spread them on plates containing hygromycin.

[0079] (4) Recombinant screening

[0080] Transformants selected from the resistant plates obtained in step (3) were cultured separately and their mycelia were collected to extract the genome. Using the genome of the transformants as a template, PCR verification was performed using primers ΔCTB10-test-F (5'-GAATCCAGCAGACACTCCTTCC-3') and ΔCTB10-test-R (5'-AGATACGCTGCTTATGCTAAGCAC-3'). The PCR reaction used a 20 μL system: 1 μL (10 μM) forward primer, 1 μL (10 μM) reverse primer, 1 μL template (200 ng), 7 μL double-distilled water and 10 μL 2xES Taq Master Mix (China, Kangwei Century).

[0081] PCR program: denaturation, 95℃, 10s; annealing, 60℃, 10s; extension, 72℃, 90s (30s / kb), repeat 30 cycles, with a final extension at 72℃ for 10min.

[0082] The PCR products were analyzed by agarose gel electrophoresis, with wild-type Cercospora JNU001 as a control. The results are as follows: Figure 1 As shown, transformants 4 and 5 are positive transformants, with amplified fragments of approximately 4000 bp, which is 500 bp larger than the amplified fragments of the wild type. This demonstrates that the CTB10 gene in the transformants has been successfully replaced by a hygromycin resistance expression cassette.

[0083] Successfully obtained the Cercospora JNU001ΔCTB10 mutant strain ( Figure 2 ).

[0084] Example 2: Fermentation production of dipre-cercosporin from the Cercospora JNU001ΔCTB10 mutant strain

[0085] The specific steps are as follows:

[0086] (1) Wild-type Cercospora JNU001 and JNU001ΔCTB10 mutant strains were inoculated onto S-7O solid medium and placed in a 25℃ light incubator for 7 days.

[0087] (2) Ten bacterial blocks (1cm diameter × 0.8cm thickness) of wild-type Cercospora JNU001 or recombinant Cercospora JNU001ΔCTB10 were added to a 2.5L barbed shake flask (containing 1L S-7O liquid fermentation medium, pH=8.0) and fermented for 8 days at 25℃, 135rpm and continuous light to obtain fermentation broth.

[0088] (3) The fermentation liquid after fermentation was completed was filtered through a single layer of gauze to separate the bacterial cells and the fermentation liquid;

[0089] The bacterial cells were dried in a freeze dryer and then extracted with 1 L of ethyl acetate.

[0090] The fermentation broth was directly added to an equal volume of dichloromethane for extraction.

[0091] The organic phases in the above extraction system were separated, and water was removed using anhydrous sodium sulfate. The solvent was removed by rotary evaporation to obtain crude dipre-cercosporin.

[0092] A small amount of crude product was dissolved in acetonitrile and analyzed by HPLC. The analytical method was as follows: solvent A was acetonitrile containing 0.1% formic acid, and solvent B was water containing 0.1% formic acid. Elution was performed using a 5%-100% gradient with solvent A for 60 min. The results are as follows. Figure 3 As shown, compared with wild-type Cercosporin, the ΔCTB10 mutant strain produced three distinct new peaks in both the cell and supernatant, with peak 1 identified as dipre-cercosporin (…). Figure 4 ).

[0093] (4) The crude dipre-cercosporin obtained was dissolved in dichloromethane and preliminarily separated by thin-layer chromatography. The eluent was methanol and dichloromethane in a volume ratio of 1:20. The main red band was collected to obtain dipre-cercosporin with a purity greater than 80%.

[0094] The obtained sample was dissolved in acetonitrile and further purified by semi-preparative separation. The mobile phase used was 50% water and 50% acetonitrile (both containing 0.1% formic acid by volume). Finally, dipre-cercosporin with a purity greater than >98% was obtained.

[0095] The purified dipre-cercosporin prepared above was characterized in detail by crystal diffraction (Table 1), high-resolution mass spectrometry, and nuclear magnetic resonance. Figure 5-13 ).

[0096] Table 1: Partial crystal data of the compound dipre-cercosporin

[0097]

[0098] The results show: 1 H NMR (400MHz, CDCl3) δ16.17(s,2H),15.46(s,2H),12.29(s,2H),6.52(s,2H),4.23(s,6H),4.18(s,6H),4.13(s,6H),3.67(dt,J= 12.3, 5.9Hz, 4H), 3.42 (m, J = 20.9, 6.2Hz, 4H), 3.10 (dd, J = 12.8, 6.7Hz, 2H), 3.01 (dd, J = 12.9, 6.7Hz, 2H), 0.42 (t, J = 6.2Hz, 12H); 13 C NMR (101MHz, CDCl3) δ185.9,185.1,168.1,165.9,162.8,151.1,149.4,137.1,135.2,125.2,125.2,124. 6,123.8,121.4,106.9,106.8,103.7,103.6,68.6,68.4,61.8,61.7,61.6,56.8,56.7,42.4,42.2,22.9.

[0099] (5) A standard curve was plotted using purified dipre-cercosporin as a standard. Figure 14 The yield of dipre-cercosporin in the mutant strain ΔCTB10 was calculated to be 6.29 mg / L.

[0100] Example 3: Photodynamic inhibitory activity of Dipre-cercosporin against bacteria

[0101] The specific steps are as follows:

[0102] (1) The bacteria tested were Staphylococcus aureus, Exiguobacterium acetylicum and Bacillus megaterium.

[0103] All bacteria were inoculated into LB medium and cultured at 37°C and 200 rpm for 12 h to obtain a culture medium. The microorganisms in the culture medium were diluted with LB medium to OD600 nm = 0.1 and added to 99 μL per well of a 96-well plate.

[0104] (2) Photodynamic inhibitory activity of Dipre-cercosporin against microorganisms:

[0105] The photodynamic antibacterial activity of the novel perylene quinone compound dipre-cercosporin was evaluated using pre-cercosporin, the monomer of dipre-cercosporin, as a control.

[0106] The above compounds were prepared into 10 mM stock solutions using DMSO as solvent. 1 μL of each solution was added to different wells obtained in step (1), and eleven concentrations were prepared using a two-fold dilution method, resulting in final concentrations of 200, 100, 50, 25, 12.5, 6, 3, 1.5, 0.8, 0.4, and 0.2 μM. Three parallel wells were set up for each concentration, and a control well (without the compound) was also included.

[0107] The above systems were respectively subjected to a power density of 18 W / cm². 2 Incubate under fluorescent light for 12 hours.

[0108] The bacterial cell concentration in each well was counted using the plate coating method. The bacterial survival rate was calculated using the average of three parallel wells. The calculation formula was: Bacterial survival rate = (Experimental group / Control group) × 100%. Based on the changes in drug concentration and bacterial survival rate, the half-maximal inhibitory concentration (IC50) of the drug was calculated. 50 ), which is the drug concentration at which 50% of bacteria are inhibited.

[0109] The results are shown in Table 2:

[0110] Table 2: Photodynamic antibacterial activity of Dipre-cercosporin against bacteria

[0111]

[0112] The results showed that the two perylene quinone compounds tested had varying degrees of inhibitory effects on the three Gram-positive bacteria tested. Figure 15 In particular, dipre-cercosporin showed significantly higher photodynamic antibacterial activity than the control pre-cercosporin, with a 5-fold and 2-fold increase in inhibitory effects against Microbacterium acetylcholine and Bacillus megaterium, respectively, indicating that dipre-cercosporin, a perylene quinone compound with a novel skeletal structure, possesses stronger photodynamic activity.

[0113] Example 4: Photodynamic inhibitory activity of Dipre-cercosporin against yeast

[0114] The three yeast strains tested were *Saccharomyces cerevisiae* BY4742, *Pichia pastoris* X33, and *Yarrowia lipolytica*. Culture media were obtained by culturing at 30°C and 200 rpm for 1 day. The microorganisms in the culture media were then diluted with YPD medium to an OD600 nm of 0.1, and 99 μL was added to each well of a 96-well plate.

[0115] The method for determining photodynamic inhibition activity is the same as in Example 3.

[0116] The results are shown in Table 3:

[0117] Table 3: Photodynamic antibacterial activity of Dipre-cercosporin against yeast

[0118]

[0119] The results showed that dipre-cercosporin had significantly higher photodynamic antibacterial activity against yeast than the control pre-cercosporin. Figure 16 This indicates that dipre-cercosporin has stronger photodynamic activity.

[0120] Example 5: Evaluation of the photophysical properties of Dipre-cercosporin

[0121] The specific steps are as follows: using pre-cercosporin as a control, acetonitrile was used as a solvent to prepare a 5 μM working solution, which was then placed in a quartz cuvette to measure the UV-Vis absorption spectra of the two compounds in acetonitrile.

[0122] The results are as follows Figure 17 As shown, compared with pre-cercosporin, the absorbance of the compound dipre-cercosporin is significantly enhanced; moreover, the absorption wavelength undergoes a significant red shift, with the maximum absorption wavelength increasing from 650 nm for pre-cercosporin to 750 nm. These photophysical properties indicate that dipre-cercosporin is a superior photosensitizer.

[0123] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The application of genetically engineered bacteria in the preparation of perylene quinone compounds or products containing perylene quinone compounds; wherein the structural formula of the perylene quinone compound is: The genetically engineered bacteria used *Cercospora japonica* JNU001 as the host cell, with the gene encoding a dehydratase knocked out from the host cell genome. CTB10 The obtained; the encoded dehydratase CTB10 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Fermentation was carried out using the genetically engineered bacteria.

3. The application as described in claim 2, characterized in that, The genetically engineered bacteria were inoculated into a fermentation medium for fermentation culture to prepare a fermentation broth. The obtained fermentation broth was then extracted to prepare a perylene quinone compound.

4. The application as described in claim 3, characterized in that, The fermentation culture conditions are as follows: fermentation for 7-10 days at a temperature of 22-28℃, an initial pH of 7.0-8.5, a rotation speed of 100-150 rpm, and continuous or intermittent light. The fermentation medium contains 10-30 g / L glucose, 1-3 g / L soybean peptone, 0.5-2 g / L sodium acetate, 0.5-1.5 mg / L biotin, 2.5-7.5 mg / L L-phenylalanine, 50-150 mg / L sodium benzoate, 0.5-1.5 mg / L pyridoxal phosphate, 0.5-1.5 mg / L thiamine hydrochloride, 100-200 mg / L potassium dihydrogen phosphate, 3-10 mg / L calcium nitrate, 0.5-1.5 mg / L calcium pantothenate, 2.5-10 mg / L manganese chloride, 1-3 mg / L ferric chloride, 0.5-1.5 mg / L copper nitrate, and 2-6 mg / L sodium nitrate. mg / L magnesium sulfate, 1-5 mg / L zinc sulfate.

5. The application as described in claim 4, characterized in that, The fermentation broth after fermentation was completed was extracted with 0.5-2 times its volume of dichloromethane or ethyl acetate to separate the organic phase. The organic phase was then removed by dehydration using anhydrous sodium sulfate and the solvent was removed by rotary evaporation to obtain the crude perylene quinone compound.

Images