cercosporin A, a perylene quinone compound with enhanced photodynamic activity, and its applications

Abstract

The application discloses a perylenequinone compound cercosporin A with enhanced photodynamic activity and an application thereof, and belongs to the technical field of genetic engineering and microbial fermentation.The method takes a wild type Cercosporin Cercospora sp.JNU001 as an expression host, realizes production of a new type of perylenequinone compound cercosporin A by knocking out a CTB6 gene, and further improves the yield of the cercosporin A to 4.34 mg / L by inserting exogenous elcE and elcG genes.Compared with the reported perylenequinone compounds, the cercosporin A has good light stability and extremely low dark toxicity, and also has a good photodynamic inhibition effect on microorganisms such as yeasts, and has a wide application prospect in the field of photodynamic therapy and the like.

Description

Technical Field

[0001] This invention relates to cercosporin A, a perylene quinone compound with enhanced photodynamic activity, and its applications, belonging to the fields of genetic engineering and microbial fermentation technology. Background Technology

[0002] Perylene quinones are a class of pigments widely found in nature, containing a specific 4,9-dihydroxyperylene-3,10-quinone pentacyclic conjugated structure. Their unique core structure endows them with excellent photosensitivity. When exposed to ambient light, perylene quinones can generate various reactive oxygen species (ROS) with the help of oxygen, effectively killing some bacteria, fungi, and cells. Based on their unique photosensitivity, these compounds have been widely used in environmental remediation, agricultural protection, medicine and health, materials science, and chemical synthesis. However, currently studied perylene quinones, such as cercosporin and hypocrellin, generally suffer from poor photostability (Water Research, 2022, 215:118242) and high dark toxicity (Journal of the American Chemical Society, 2009, 131(26):9413-9425), which greatly limits their practical applications. Existing research (Journal of the American Chemical Society, 2009, 131(26):9413-9425) indicates that structural modification of perylene quinone compounds has a significant impact on their physical properties and biological activities. Therefore, structural modification of natural perylene quinone compounds can enhance their properties.

[0003] Currently, perylene quinones can be prepared by two methods: chemical synthesis and microbial fermentation. Microbial fermentation is limited by the difficulty in isolating relevant strains and the protection of intellectual property rights for these strains, making the discovery of novel perylene quinones extremely challenging. While chemical synthesis can achieve the synthesis of non-natural perylene quinones (Journal of the American Chemical Society, 2009, 131(26):9413-9425), it involves numerous steps and complex reaction conditions, making efficient preparation difficult. For example, the chemical synthesis of the simple perylene quinone compound (+)-fluramidine requires 17 steps, with a total yield of only 5.3%. Therefore, the construction of genetically engineered bacteria can enable the efficient and targeted production of perylene quinones with specific modified structures using wild-type Cercospora, thereby expanding the variety of perylene quinones and discovering novel perylene quinones with enhanced photodynamic activity. Summary of the Invention

[0004] This invention provides a method for producing novel perylene quinone compounds using recombinant Cercospora. This method, employing genetic engineering and microbial fermentation techniques, utilizes wild-type Cercospora sp. JNU001 as the starting strain to achieve the efficient production of cercosporin A, a novel perylene quinone compound with enhanced photodynamic activity.

[0005] This invention provides a genetically engineered bacterium, which uses Cercosporasp. JNU001 as the expression host, knocks out the CTB6 gene in its genome, and inserts the elcE and elcG genes from Parastagonosporanodorum SN15.

[0006] In one embodiment of the present invention, the nucleotide sequence of the CTB6 gene is shown in SEQ ID NO.1.

[0007] In one embodiment of the present invention, the elcE and elcG genes are numbered Q0UI06 and Q0UHZ8 in UniProtKB, respectively.

[0008] In one embodiment of the invention, the elcE and elcG genes derived from Parastagonospora nodorum SN15 are integrated at any site on the genome that does not affect its growth.

[0009] In one embodiment of the present invention, the elcE and elcG genes derived from Parastagonospora nodorum SN15 are integrated into the CTB5 and CTB12 gene loci on the genome, respectively.

[0010] In one embodiment of the present invention, the elcE gene expression cassette and the elcG gene expression cassette are integrated at the CTB5 and CTB12 gene loci on the genome, respectively.

[0011] The promoter and terminator of the elcE gene expression cassette are derived from the pyruvate kinase (gpkA) gene regulatory sequence of Aspergillus oryzae, that is: the elcE gene expression cassette contains pgkA promoter-elcE gene-pgkA terminator, and the nucleotide sequence is shown in SEQ ID NO.2;

[0012] The promoter and terminator of the elcG gene expression cassette are derived from the transcription enhancer factor (TEF-1) regulatory sequence of Aspergillus oryzae, that is: the elcG gene expression cassette contains TEF-1 promoter-elcG gene-TEF-1 terminator, and the nucleotide sequence is shown in SEQ ID NO.3.

[0013] The present invention also provides a perylenequinone compound, the structural formula of which is shown below:

[0014]

[0015] The present invention also provides a method for preparing the above-mentioned perylenequinone compound, wherein the compound is prepared by fermentation using the above-mentioned genetically engineered bacteria.

[0016] In one embodiment of the present invention, the method involves inoculating the above-mentioned genetically engineered bacteria into a fermentation medium for fermentation culture to prepare a fermentation broth, and extracting the obtained fermentation broth to prepare a perylene quinone compound.

[0017] In one embodiment of the present invention, the fermentation culture conditions are as follows: fermentation for 7-10 days at a temperature of 22-28℃, an initial pH of 7.0-8.5, a rotation speed of 100-150 rpm, and continuous or intermittent light.

[0018] In one embodiment of the present invention, the fermentation medium contains: 10-30 g / L glucose, 1-3 g / L soybean peptone, 0.5-2 g / L sodium acetate, 0.5-1.5 mg / L biotin, 2.5-7.5 mg / L L-phenylalanine, 50-150 mg / L sodium benzoate, 0.5-1.5 mg / L pyridoxal phosphate, 0.5-1.5 mg / L thiamine hydrochloride, 100-200 mg / L potassium dihydrogen phosphate, 3-10 mg / L calcium nitrate, 0.5-1.5 mg / L calcium pantothenate, 2.5-10 mg / L manganese chloride, 1-3 mg / L ferric chloride, 0.5-1.5 mg / L copper nitrate, 2-6 mg / L magnesium sulfate, and 1-5 mg / L zinc sulfate.

[0019] In one embodiment of the present invention, the fermentation medium contains: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, and 4.4 mg / L zinc sulfate.

[0020] In one embodiment of the present invention, the fermentation method of cercosporin A is to add wild-type Cercosporin or recombinant Cercosporin to the fermentation medium at a rate of 10 bacterial blocks (1 cm in diameter × 0.8 cm in thickness) / L of medium.

[0021] In one embodiment of the present invention, fermentation is carried out for 8 days under the conditions of a temperature of 25°C, an initial pH of 8.0, a rotation speed of 135 rpm, and continuous or intermittent light.

[0022] In one embodiment of the present invention, the purification method of cercosporin A is as follows: an equal volume of dichloromethane is added to the fermentation broth after fermentation for extraction, the organic phase is separated, and water is removed using anhydrous sodium sulfate to obtain crude cercosporin A. The obtained crude cercosporin A is first subjected to thin-layer chromatography (developing solvent: methanol: dichloromethane = 1:20) for crude separation, and then further purified using a semi-preparative solution relative to the target product.

[0023] The present invention also provides the application of the above-mentioned recombinant Cercospora sp. JNU001 in the preparation of cercosporin A or products containing cercosporin A.

[0024] This invention also provides the application of the above-mentioned genetically engineered bacteria or the above-mentioned method in the preparation of perylene quinone compounds or products containing perylene quinone compounds; the structural formula of the perylene quinone compound is:

[0025]

[0026] The present invention also provides a pharmaceutical composition comprising the above-described compound or its stereoisomer or racemate or tautomer.

[0027] In one embodiment of the present invention, the drug is a photodynamic drug, a photosensitizer, or a tumor fluorescent labeling reagent.

[0028] The present invention also provides the use of the above-mentioned compound or its stereoisomer or its racemate or its tautomer in the preparation of pharmaceuticals.

[0029] In one embodiment of the present invention, the drug is a photodynamic drug, a photosensitizer, or a tumor fluorescent labeling reagent.

[0030] Beneficial effects

[0031] This invention uses wild-type Cercospora sp. JNU001 as the expression host. By knocking out the CTB6 gene, a novel perylene quinone compound, cercosporin A, was produced. Further insertion of exogenous elcE and elcG genes yielded the Cercospora ΔCTB6::elcE / elcG mutant strain, increasing the cercosporin A yield to 4.34 mg / L. Compared with existing technologies, this invention has the following characteristics and beneficial effects:

[0032] (1) Compared with the chemical synthesis of perylene quinone derivatives, the method of preparing compound cercosporin A in this invention is not only simple to operate, but also can quickly obtain and prepare large quantities of these compounds at a lower cost.

[0033] (2) The compound cercosporin A prepared in this invention has significantly enhanced photostability compared with reported perylene quinone compounds, and has great application prospects in photodynamic therapy.

[0034] (3) The compound cercosporin A prepared in this invention has significantly reduced dark toxicity compared with similar compounds, while maintaining excellent photodynamic activity, which has obvious advantages in photodynamic therapy of tumors.

[0035] (4) The compound cercosporin A prepared in this invention has good photodynamic inhibitory activity against microorganisms. Compared with similar compounds, cercosporin A has a significantly enhanced inhibitory effect on yeast and can be used as an antifungal drug. Attached Figure Description

[0036] Figure 1 PCR verification diagram for the CTB6 knockout mutant strain JNU001ΔCTB6.

[0037] Figure 2 Plate morphology of Cercospora JNU001ΔCTB6 mutant strain.

[0038] Figure 3 The structure diagram of the carrier pXS-ΔCTB5::elcE is shown.

[0039] Figure 4 This is a PCR verification diagram of the JNU001ΔCTB6 / ΔCTB5::elcE / ΔCTB12::elcG mutant strain.

[0040] Figure 5 Liquid chromatography chromatograms of wild-type Cercospora JNU001, mutant Cercospora JNU001ΔCTB6, and JNU001ΔCTB6::elcE / elcG.

[0041] Figure 6 This is the structural formula for cercosporin A.

[0042] Figure 7 This is a high-resolution mass spectrum of cercosporin A.

[0043] Figure 8 For cercosporin A 1 H spectrum (CDCl3, 600MHz).

[0044] Figure 9 For cercosporin A 13 C spectrum (CDCl3, 600MHz).

[0045] Figure 10 For cercosporin A 1 H- 1 H COSY spectrum (CDCl3, 600MHz).

[0046] Figure 11 For cercosporin A 1 H- 1 H NOESY spectrum (CDCl3, 600MHz).

[0047] Figure 12 For cercosporin A 1 H- 13 C HSQC spectrum (CDCl3, 600MHz).

[0048] Figure 13 For cercosporin A 1 H- 13 C HMBC spectrum (CDCl3, 600MHz).

[0049] Figure 14 This is the standard curve for high-performance liquid chromatography analysis of cercosporin A.

[0050] Figure 15 The graph shows the inhibition curves of cercosporin A and its homologues on HTC116 cells.

[0051] Figure 16 The graph shows the inhibition curves of cercosporin A and its homologues on bacteria.

[0052] Figure 17 The graph shows the inhibition curves of cercosporin A and its homologues on yeast.

[0053] Figure 18 This is a photostogram showing the photostability of cercosporin A.

[0054] Figure 19 The structural formula is for an isomer of cercosporin A. Detailed Implementation

[0055] The present invention will be further described below with reference to specific embodiments.

[0056] The Staphylococcus aureus, Exiguobacterium acetylicum, Bacillus megaterium, and Yarrowia lipolytica used in the following examples were isolated from the environment and preserved in our laboratory; Pichia pastoris X33 was purchased from Invitrogen; and Saccharomyces cerevisiae BY4742 was purchased from the American Type Culture Collection (ATCC).

[0057] The human colon cancer cells HTC116, human gastric cancer cells (undifferentiated) HGC-27, human monocytic leukemia cells THP-1, human cervical cancer cells HeLa, and human ovarian granulosa cell tumor KGN involved in the following examples were all purchased from Wuhan Boster Biological Engineering Co., Ltd.

[0058] The cercarin and bamboo red fungus involved in the following examples were isolated and preserved in our laboratory from wild-type Cercarium japonicum JNU001 and Bambusa textilis; their structural formulas are shown below:

[0059]

[0060] The culture media designed in the following examples are as follows:

[0061] S-7O solid culture medium: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, 4.4 mg / L zinc sulfate, and 20 g / L agar.

[0062] S-7O liquid fermentation medium: 20 g / L glucose, 2 g / L soybean peptone, 1 g / L sodium acetate, 1 mg / L biotin, 5 mg / L phenylalanine, 100 mg / L sodium benzoate, 1 mg / L pyridoxal phosphate, 1 mg / L thiamine hydrochloride, 136 mg / L potassium dihydrogen phosphate, 1 mg / L calcium nitrate, 1 mg / L calcium pantothenate, 5 mg / L manganese chloride, 3 mg / L ferric chloride, 1.3 mg / L copper nitrate, 3.6 mg / L magnesium sulfate, 4.4 mg / L zinc sulfate.

[0063] Lysozyme: Purchased from the Institute of Microbiology, Guangdong Academy of Sciences.

[0064] Hygromycin resistance selection medium: 4 g / L PDA, 50 mg / L hygromycin.

[0065] Henzimidoxazole resistance selection medium: 4 g / L PDA, 50 mg / L henzimidoxazole.

[0066] DMEM medium: purchased from White Shark Biotechnology Co., Ltd., with additional additions of 10% volume fetal bovine serum (Gibco), 100 μg / ml streptomycin and 100 U / ml penicillin.

[0067] DMEM / F12 medium: purchased from White Shark Biotechnology Co., Ltd., with additional additions of 10% fetal bovine serum (Gibco), 100 μg / ml streptomycin, and 100 U / ml penicillin.

[0068] The buffer solutions used in the following examples are as follows:

[0069] Osmotic buffer: 1.0M magnesium sulfate, 100mM potassium phosphate buffer (pH 5.8).

[0070] STC buffer: 1.2M sorbitol, 50mM calcium chloride, sterilized by filtration, stored at 4°C.

[0071] PEG6000 buffer: 25% (w / v) PEG6000, 0.1M calcium chloride, 0.6M potassium chloride, sterilized by filtration, stored at 4°C.

[0072] Example 1: Construction of the Cercospora JNU001ΔCTB6 mutant strain

[0073] The specific steps are as follows:

[0074] (1) Preparation of Cercospora protoplasts

[0075] *Cercospora JNU001* was inoculated onto S-7O plates and cultured for 7 days in a 25°C light incubator. Two bacterial blocks (1 cm diameter × 0.8 cm thickness) were punched and inoculated into 250 mL shake flasks containing 100 mL of S-7O liquid fermentation medium. The flasks were then incubated at 25°C and 135 rpm under light for 5 days. The bacterial cells were collected by filtering through a single layer of sterile gauze. The cells were thoroughly ground in a sterile mortar and resuspended in 100 mL of S-7O liquid fermentation medium in a 250 mL shake flask for 12 hours of recovery. The recovered cells were collected using a sterile single layer of gauze and washed 2-3 times with an appropriate amount of osmotic buffer. 10 mL of osmotic buffer containing 200 mg of lysozyme was added, and the mixture was incubated at 30°C and 100 rpm for 3 hours. After incubation, filter the bacterial culture through 6 layers of sterile gauze to remove residue. Add an equal volume of STC buffer to the filtrate, centrifuge at 6000 rpm for 15 min, and discard the supernatant. Add twice the volume of STC buffer for enzyme digestion, centrifuge at 6000 rpm for 8 min, and discard the supernatant. Resuspend the bacterial cells in an appropriate amount of STC buffer to achieve a protoplast concentration of 2 × 10⁻⁶. 7 Protoplast concentration was determined by counting cells / mL using a hemocytometer. The cells were aliquoted into 200 μL tubes and stored at -80°C.

[0076] (2) Obtaining the knockout fragment

[0077] The CTB6 gene (SEQ ID NO.1) reading frame was found in the Cercospora genome, and 1500 bp fragments upstream and downstream of the CTB6 gene reading frame were cloned. The upstream and downstream sequences are shown below.

[0078] CTB6-up (1500bp):

[0079]

[0080] CTB6-down(1500bp):

[0081]

[0082] The hygromycin resistance expression cassette consists of the hph gene, the PgpdA promoter derived from Aspergillus nidulans, and the TtrpC terminator, as shown below.

[0083] Hygromycin resistance expression cassette (containing gpdA promoter (underlined) - hph gene - trpC terminator (underlined))

[0084] gaattcccttgtatctctacacacaggctcaaatcaataagaagaacggttcgtctttttcgtttata tcttgcatcgtcccaaagctattggcgggatattctgtttgcagttggctgacttgaagtaatctctgcagatctt tcgacactgaaatacgtcgagcctgctccgcttggaagcggcgaggagcctcgtcctgtcacaactaccaacatgg agtacgataagggccagttccgccagctcattaagagccagttcatgggcgttggcatgatggccgtcatgcatct gtacttcaagtacaccaacgctcttctgatccagtcgatcatccgctgaaggcgctttcgaatctggttaagatcc acgtcttcgggaagccagcgactggtgacctccagcgtccctttaaggctgccaacagctttctcagccagggcca gcccaagaccgacaaggcctccctccagaacgccgagaagaactggaggggtggtgtcaaggaggagtaagctcct tattgaagtcggaggacggagcggtgtcaagaggatattcttcgactctgtattatagataagatgatgaggaatt ggaggtagcatagcttcatttggatttgctttccaggctgagactctagcttggagcatagagggtcctttggctt tcaatattctcaagtatctcgagtttgaacttattccctgtgaaccttttattcaccaatgagcattggaatgaac atgaatctgaggactgcaatcgccatgaggttttcgaaatacatccggatgtcgaaggcttggggcacctgcgttg gttgaatttagaacgtggcactattgatcatccgatagctctgcaaagggcgttgcacaatgcaagtcaaacgttg ctagcagttccaggtggaatgttatgatgagcattgtattaaatcaggagatatagcatgatctctagttagctca ccacaaaagtcagacggcgtaaccaaaagtcacacaacacaagctgtaaggatttcggcacggctacggaagacgg agaagccaccttcagtggactcgagtaccatttaattctatttgtgtttgatcgagacctaatacagcccctacaa cgaccatcaaagtcgtatagctaccagtgaggaagtggactcaaatcgacttcagcaacatctcctggataaactt taagcctaaactatacagaataagataggtggagagcttataccgagctcccaaatctgtccagatcatggttgac cggtgcctggatcttcctatagaatcatccttattcgttgacctagctgattctggagtgacccagagggtcatga cttgagcctaaaatccgccgcctccaccatttgtagaaaaatgtgacgaactcgtgagctctgtacagtgaccggt gactctttctggcatgcggagagacggacggacgcagagagaagggctgagtaataagccactggccagacagctc tggcggctctgaggtgcagtggatgattattaatccgggaccggccgcccctccgccccgaagtggaaaggctggt gtgcccctcgttgaccaagaatctattgcatcatcggagaatatggagcttcatcgaatcaccggcagtaagcgaa ggagaatgtgaagccaggggtgtatagccgtcggcgaaatagcatgccattaacctaggtacagaagtccaattgc ttccgatctggtaaaagattcacgagatagtaccttctccgaagtaggtagagcgagtacccggcgcgtaagctcc ctaattggcccatccggcatctgtagggcgtccaaatatcgtgcctctcctgctttgcccggtgtatgaaaccgga aaggccgctcaggagctggccagcggcgcagaccgggaacacaagctggcagtcgacccatccggtgctctgcact cgacctgctgaggtccctcagtccctggtaggcagctttgccccgtctgtccgcccggtgtgtcggcggggttgac aaggtcgttgcgtcagtccaacatttgttgccatatttcctgctctccccaccagctgctcttttctttctctt tcttttcccatcttcagtattcatcttcccatccaagaacctttatttcccctaagtaagtactttgctacatc catactccatccttcccatcccttattcctttgaacctttcagttcgagctttcccattcatcgcagcttgacta acagctaccccgcttgagcagacatcacc agtagatgccgaccg atccacttaacgttactgaaatcatcaaacagcttgacgaatctggatataagatcgttggtgtcgatgtcagctc cggagttgagacaaatggtgttcaggatctcgataagatacgttcatttgtccaagcagcaaagagtgcctttag tgatttaatagctccatgtcaacaagaataaaacgctttttcgggtttacctcttccagatacagctcatctgcaa tgcattaatgcattgactgcaacctagtaacgcttcaggctccgggcgaagagaagaatagcttagcagagtctat tttcattttcgggagacgagatcaagcagatcaacggtcgtcaagagacctacgagactgaggaatccgctcttgg ctccacgcgactatatatttgtctctaattgtactttgacatgctcctcttcttactctgatagcttgactatga aaattccgtcaccagcccctgggttcgcaaagataattgcactgtttcttccttgaactctcaagcctacaggaca cacattcatcgtaggtataaacctcgaaaatcattcctactaagatgggtatacaatagtaaccatggttgcctag tgaatgctccgtaacacccaatacgccggccgaaacttttttacaactctcctatgagtcgtttacccagaatgca caggtacacttgtttagaggtaatccttctttctagaagtcctcgtgtactgtgtaagcgcccactccacatctcc actcga

[0085] The upstream sequence, hygromycin resistance expression cassette, and downstream sequence were integrated into the vector pXS (published in Liu J, Chai X, Guo T, Wu J, Yang P, Luo Y, Zhao H, Zhao W, Nkechi O, Dong J, Bai J, Lin Q (2019) Disruption of the ergosterol biosynthetic pathway results in increased membrane permeability, vausing overproduction and secretion of extracellular Monascus Pigments in submerged fermentation. J Agric Food Chem 67(49):13673-13683 doi:https: / / doi.org / 10.1021 / acs.jafc.9b05872), resulting in the complete plasmid pXS-ΔCTB6.

[0086] Using the intact plasmid pXS-ΔCTB6 as a template, PCR amplification of the knockout fragment containing the upstream and downstream sequences and the hygromycin expression cassette was performed using primers ΔCTB6-up-F (5'-CATGCGAGCGGGTCGAAGCAA-3') and ΔCTB6-down-R (5'-GTCCTTACCGGTATCCTGCGCC-3'). The PCR reaction was performed in a 50 μL system: 1.5 μL forward primer (10 μM), 1.5 μL reverse primer (10 μM), 1 μL template (10 ng), 22 μL double-distilled water, and 25 μL 2×Prime Star Maxpremix (Takara). The PCR program was as follows: denaturation, 98℃, 10 s; annealing, 60℃, 10 s; extension, 72℃, 40 s (5 s / kb), repeated for 30 cycles, with a final extension at 72℃ for 5 min. The amplified fragment was purified and recovered for later use.

[0087] (3) Protoplast transformation of Cercospora JNU001

[0088] Take 200 μL of *Cercospora JNU001* protoplasts, add 20 μg of the recovered knockout fragment obtained in step (2), mix gently, and incubate on ice for 1 h. Add 1.25 mL of PEG6000 buffer, mix well, and incubate at room temperature for 30 min. Add 5 mL of medium containing 1.2 M sorbitol, and incubate overnight at 25 °C and 135 rpm in a constant temperature shaker. Centrifuge at 6000 rpm for 15 min to collect the bacterial cells and spread them on plates containing hygromycin.

[0089] (4) Recombinant screening

[0090] Transformants selected from the resistant plates obtained in step (3) were cultured separately and their mycelia were collected for genomic extraction. Using the transformed genome as a template, PCR verification was performed using primers ΔCTB6-test-F (5'-CTTCGCCAATACTGCTCCTTGC-3') and ΔCTB6-test-R (5'-GAAGTGTTCGCGATTCGACAAC-3'). The PCR reaction used a 20 μL system: 1 μL (10 μM) forward primer, 1 μL (10 μM) reverse primer, 1 μL template (200 ng), 7 μL double-distilled water, and 10 μL 2x ES TaqMaster Mix (China, Kangwei Century). PCR program: denaturation, 95℃, 10 s; annealing, 60℃, 10 s; extension, 72℃, 90 s (30 s / kb), repeated 30 times, with a final extension at 72℃ for 10 min.

[0091] The PCR products were analyzed by agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, using wild-type Cercospora JNU001 as a control, the amplified fragment of the positive transformants (strains 2-8) was approximately 4600 bp, which was 1200 bp larger than the amplified fragment of the wild-type strain, proving that the CTB6 gene in the transformants was successfully replaced by a hygromycin resistance expression cassette. The Cercospora JNU001ΔCTB6 mutant strain was successfully obtained. Figure 2 ).

[0092] Example 2: Construction of Cercospora ΔCTB6::elcE / elcG mutant strain

[0093] (1) Preparation of protoplasts of Cercospora JNU001ΔCTB6 mutant strain

[0094] The method for preparing protoplasts is the same as in Example 1, except that the wild-type Cercospora is replaced with the JNU001ΔCTB6 mutant strain.

[0095] (2) Obtaining the inserted fragment

[0096] The chemically synthesized gene sequence is shown in SEQ ID NO.2, which contains the pgkA promoter-elcE gene-pgkA terminator, and the gene sequence is shown in SEQ ID NO.3, which contains the TEF-1 promoter-elcE gene-TEF-1 terminator.

[0097] (3) The elcE expression cassette and the elcG expression cassette were integrated into the genome of the JNU001ΔCTB6 mutant strain, respectively. The insertion sites of elcE and elcG were selected from the CTB5 and CTB12 gene sites in the Cercospora genome, which are homologous to them. The gene sequences of CTB5 and CTB12 are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0098] The reading frames of the CTB5 and CTB12 genes were identified from the Cercospora genome, and 1500 bp fragments upstream and downstream of each reading frame were cloned:

[0099] CTB5-up (1500bp):

[0100]

[0101] CTB5-down(1500bp):

[0102]

[0103] gagtcatcagtcttgtagtacgcgatttccttcccgaacgagatcttgtcctcaatgccagtcatgagctgagttctgCTB12-up(1500bp):

[0104]

[0105]

[0106] The CTB5-up, elcE expression cassette, genymycin expression cassette, and CTB5-down cassettes were sequentially linked and integrated into the vector pXS, forming the knock-in plasmid pXS-ΔCTB5::elcE( Figure 3 ).

[0107] The CTB12-up, elcG expression cassette, and CTB5-down sequence were ligated into the vector pXS, forming the knock-in plasmid pXS-ΔCTB12::elcG. The promoter and terminator of the ElcE expression cassette are derived from the pyruvate kinase (gpkA) gene regulatory sequence of *Aspergillus oryzae*, as shown in SEQ ID NO.2. The promoter and terminator of the ElcG expression cassette are derived from the transcription enhancer factor (TEF-1) regulatory sequence of *Aspergillus oryzae*, as shown in SEQ ID NO.3. The herbicides resistance expression cassette consists of the aph gene and the PtrpA promoter and TtrpC terminator derived from *Aspergillus nidus*, as shown below:

[0108] Genetic mycotoxin resistance expression cassette (containing trpC promoter (underlined) - aph gene - trpC terminator (underlined)):

[0109] cagaagatgatattgaaggagcactttttgggcttggctggagctagtggaggtcaacaatgaatgcc tattttggtttagtcgtccaggcggtgagcacaaaatttgtgtcatttgacaagatggttcatttaggcaactggt cagatcagccccacttgtagcagtagcggcggcgctcgaagtgtgactcttattagcagacaggaacgaggacatt attatcatctgctgcttggtgcacgataacttggtgcgtttgtcaagcaaggtaagtgaacgacccggtcatacct tcttaagttcgcccttcctccctttatttcagattcaatctgacttacctattctacccaagcatcgataagcttc gattaggaagtagccaccatgggcaaggagaagacccacgtctcccgcccccgtctcaactccaacatggacgctgacctctacggttacaagtgggcccgcgacaacgtcggccagtccggtgctaccatctaccgtctctacggcaagcccgacgcccctgagctgttcctcaagcacggcaagggctccgtcgctaacgatgtcaccgacgagatggtccgcctcaactggctcaccgagttcatgcccctccctaccatcaagcacttcatccgtacccctgacgacgcttggctcctcaccaccgctatccctggcaagaccgccttccaggtcctggaggagtaccccgactccggcgagaacatcgtcgatgccctcgctgtcttcctccgccgtctccactccatccccgtctgcaactgccctttcaactccgaccgtgtcttccgtctcgctcaggctcagtcccgcatgaacaacggtctcgtcgatgcctccgacttcgacgacgagcgtaacggctggcctgtcgagcaggtctggaaggagatgcacaagctcctccccttctcccctgactccgtcgtcacccacggcgacttctccctcgacaacctcatcttcgacgagggcaagctcatcggctgcatcgatgtcggtcgcgtcggcatcgctgaccgttaccaggacctcgccatcctctggaactgcctcggcgagttctccccctccctccagaagcgcctcttccagaagtacggcatcgacaaccctgacatgaacaagctccagttccacctcatgctcgacgagttcttctaa ctcgagag tagatgccgaccgggatccacttaacgttactgaaatcatcaaacagcttgacgaatctggatataagatcgttgg tgtcgatgtcagctccggagttgagacaaatggtgttcaggatctcgataagatacgttcatttgtccaagcagca aagagtgccttctagtgatttaatagctccatgtcaacaagaataaaacgcgtttcgggtttacctcttccagata cagctcatctgcaatgcattaatgcattggacctcgcaaccctagtacgcccttcaggctccggcgaagcagaaga atagcttagcagagtctattttcattttcggggagacgagatcaagcagatcaacggtcgtcaagagacctacgaga ctgaggaatccgctcttggctccacgcgactatatatttgtctctaattgtactttgacatgctcctcttctttac tctgatagcttgactatgaaaattccgtcaccagccc

[0110] Using plasmid pXS-ΔCTB5::elcE as a template, PCR amplification was performed using primers ΔCTB5-up-F (5'-ATCCGGAGATCAACAGACGTTCTGTG-3') and ΔCTB5-down-R (5'-CAGAACTCAGCTCATGACTGGCATTG-3') to amplify the knock-in fragment containing upstream and downstream sequences, as well as the elcE expression cassette and the genimycin expression cassette. Using plasmid pXS-ΔCTB12::elcG as a template, PCR amplification was performed using primers ΔCTB12-up-F (5'-ACGTGGTGAACAATTCTTCTTCTACAC-3') and ΔCTB12-down-R (5'-GGCTTTGTAGACCTTCGGTCTGGC-3') to amplify the knock-in fragment containing upstream and downstream sequences, as well as the elcG expression cassette.

[0111] (4) Protoplast transformation of Cercospora JNU001ΔCTB6 mutant

[0112] Take 200 μL of *Cercospora* JNU001ΔCTB6 mutant protoplasts, add 20 μg of fragment containing the elcE expression cassette and 20 μg of fragment containing the elcG expression cassette, gently mix, and incubate on ice for 1 h. Add 1.25 mL of PEG6000 buffer, mix, and incubate at room temperature for 30 min. Add 5 mL of medium containing 1.2 M sorbitol, and incubate overnight at 25 °C and 135 rpm in a constant temperature shaker. Centrifuge at 6000 rpm for 15 min to collect the bacterial cells and spread them on plates containing genistein.

[0113] (5) Screening of recombinant strains

[0114] Transformants selected from resistance plates were cultured separately and their mycelia were collected for genomic analysis. Using the transformed genomes as templates, PCR verification was performed using primers ΔCTB5-test-F (5'-CTTGCAATGACATTCAGCGTCTTG-3'), ΔCTB5-test-R (5'-CAACCTGAGAAACAAATTCTGGCAC-3') and primers ΔCTB12-test-F (5'-CTGTTCTCTGTCTCAGGCAGTCATC-3'), ΔCTB12-test-R (5'-CAACAGATGTCAAGCAAGAAGATGGA-3'). The results are as follows: Figure 4 As shown, the CTB5 and CTB12 fragments in wild-type Cercospora are both less than 2000 bp, while in positive transformants they increase to 4600 bp and 3500 bp, respectively (strain 17), indicating successful insertion of the elcE and elcG genes and genimycin.

[0115] A Cercospora mutant strain was successfully obtained (the CTB6 gene was knocked out in the Cercospora JNU001 genome, and the elcE gene was integrated at the CTB5 site and the elcG gene was integrated at the CTB12 site): Cercospora JNU001ΔCTB6 / ΔCTB5::elcE / ΔCTB12::elcG, named: JNU001ΔCTB6::elcE / elcG.

[0116] Example 3: Fermentation production of cercosporin A from Cercosporium mutant strains JNU001ΔCTB6 and JNU001ΔCTB6::elcE / elcG

[0117] The specific steps are as follows:

[0118] (1) Wild-type Cercospora JNU001, Cercospora JNU001ΔCTB6 mutant and Cercospora JNU001ΔCTB6::elcE / elcG mutant were inoculated on S-7O solid medium and placed in a 25℃ light incubator for 7 days.

[0119] (2) Ten bacterial blocks (1cm diameter × 0.8cm thickness) of wild-type Cercospora JNU001 or recombinant Cercospora were added to a 2.5L barbed shake flask (containing 1L S-7O liquid fermentation medium, pH=8.0) and fermented for 8 days at 25℃, 135rpm and continuous light to obtain fermentation broth.

[0120] (3) The fermentation broth was extracted with an equal volume of dichloromethane. The organic phase was dehydrated with anhydrous sodium sulfate, and the solvent was removed by rotary evaporation. The product was dissolved in 10 mL of acetonitrile for HPLC analysis. The HPLC analysis method was as follows: Solvent A was acetonitrile containing 0.1% formic acid, and solvent B was water containing 0.1% formic acid. Elution was performed using a 5%-100% gradient with solvent A for 30 min. The results are as follows. Figure 5 As shown, compared with the wild-type Cercospora, both Cercospora mutants produced two new peaks.

[0121] (4) Following the methods described in steps (2) and (3), a large quantity of metabolites of the JNU001ΔCTB6::elcE / elcG mutant strain were prepared. First, thin-layer chromatography (methanol: dichloromethane = 1:20 as developing solvent) was used for crude separation, and then the target product was further purified using a semi-preparative solution.

[0122] Finally, purified products 1 and 2 were obtained. Figure 5 );

[0123] Product 1 was characterized by high-resolution mass spectrometry and nuclear magnetic resonance as cercosporin A. Figure 6-13 ). 1H NMR (600MHz, CDCl3) δ15.38(s,1H),15.11(s,1H),7.13(s,1H),7.12(s,1H),5.77–5.74(m,2H),4.30(s,3H),4.2 2(s,3H),3.77(s,1H),3.69(s,1H),3.64(d,J=13.7Hz,1H),2.38(d,J=13.7Hz,1H),1.88(s,3H),1.77(s,3H)ppm; 13 C NMR (151MHz, CDCl3) δ206.1,181.8,181.4,168.7,168.6,164.3,163.6,153.4,150.1,134.5,132.1,132.0,13 0.8,127.3,126.6,113.5,113.4,110.1,109.7,108.9,108.7,92.6,77.02,64.4,61.6,60.3,42.8,28.1,24.7.

[0124] Product 2 is a diastereomer of cercosporin A ( Figure 19 The difference between them lies in the chirality of the hydroxyl groups on their side chains.

[0125] (5) A standard curve was plotted using purified cercosporin A as a standard. Figure 14 The cercosporin A yield of the mutant strain JNU00ΔCTB6 was calculated to be 1.64 mg / L.

[0126] By inserting isozymes of CTB5 and CTB12, the cercosporin A yield of the mutant strain JNU001ΔCTB6::elcE / elcG was increased to 4.34 mg / L.

[0127] Example 4: Cytotoxicity and photodynamic activity of Cercosporin A against human tumor cells

[0128] The specific steps are as follows:

[0129] (1) Cell culture: The test cells were human colon cancer cells HTC116, human gastric cancer cells (undifferentiated) HGC-27, human monocytic leukemia cells THP-1, human cervical cancer cells HeLa, and human ovarian granulosa cell tumor KGN. Except for THP-1, the other cells were cultured in DMEM medium, and THP-1 cells were cultured in DMEM / F12 medium.

[0130] Preparation of cell suspensions: Human colon cancer cells HTC116, human gastric cancer cells (undifferentiated) HGC-27, human monocytic leukemia cells THP-1, human cervical cancer cells HeLa, and human ovarian granulosa cell tumor KGN were added to cell culture dishes containing the corresponding culture medium and incubated at 37°C in a 5% CO2 atmosphere for 2 days.

[0131] Cells were collected and resuspended in fresh culture medium. Cells were counted using a hemocytometer and the cell suspension concentration was adjusted to 50,000 cells / mL with culture medium. 99 μL of the suspension was added to each well of a 96-well plate and incubated at 37°C in a 5% CO2 atmosphere for 12 h.

[0132] (2) Cytotoxicity test:

[0133] The cytotoxicity of the novel perylene quinone compound cercosporin A was evaluated using cercosporin and cytosporin, which have been studied extensively, as controls.

[0134] The above compounds were prepared into dispersions of different concentrations (10, 30, 100, 300, 1000, 3000 and 10000 μM) using an aqueous solution containing 10% DMSO as the solvent.

[0135] Add 1 μL of the dispersion to different wells in step (1), with three parallel wells for each concentration. Also include blank wells (without cells) and control wells (without compound). Incubate in the dark for 48 h. Add 10 μL of CCK-8 solution to each well and incubate at 37°C for 2 h. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell viability using the average of the three parallel wells. The calculation formula is: Cell viability = (Experimental group - Blank) / (Control group - Blank) × 100%. 50 (Half-cytotoxic concentration) is the drug concentration at which 50% of the cells are destroyed.

[0136] (3) Photodynamic activity assay: The compounds used in the cytotoxicity assay were prepared into dispersions of different concentrations (3, 10, 30, 100, 300, 1000, and 3000 μM) using an aqueous solution containing 10% DMSO as the solvent. 1 μL of each dispersion was added to different wells, with three parallel wells for each concentration. Blank wells (without cells) and control wells (without the compound) were also included. The photodynamic activity assay was performed at a power density of 18 W / cm². 2Irradiate the cells under fluorescent light for 50 min, then incubate in the dark for 48 h. Add 10 μL of CCK-8 solution to each well and incubate at 37°C for 2 h. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell viability using the average of three parallel wells. The calculation formula is: Cell viability = (Experimental group - Blank) / (Control group - Blank) × 100%. Calculate the half-maximal cytotoxicity concentration (MCC) of CCK-8 based on the changes in cell viability under different drug concentrations. 50 The concentration at which 50% of cells are killed is used to evaluate the cytotoxicity and photodynamic activity of various drugs.

[0137] The results are shown in Table 1.

[0138] Table 1: Cytotoxicity of Cercosporin A against several human tumor cell lines

[0139]

[0140] The results showed that, compared with cercosporin and cercosporin, cercosporin A not only retained excellent photodynamic activity (under light conditions), but also exhibited a cytotoxicity reduction of tens of times (under dark conditions). Figure 15 It can be used as an excellent photosensitizer for precise photodynamic therapy of tumor cells.

[0141] Example 5: Photodynamic inhibitory activity of Cercosporin A against microorganisms

[0142] The specific steps are as follows:

[0143] (1) Microbial culture:

[0144] The tested microorganisms included three Gram-positive bacteria: *Staphylococcus aureus*, *Exiguobacterium acetylicum*, and *Bacillus megaterium*; and three yeasts: *Saccharomyces cerevisiae* BY4742, *Pichia pastoris* X33, and *Yarrowia lipolytica*. Bacteria were cultured in LB medium, and yeasts were cultured in YPD medium.

[0145] The above-mentioned microorganisms were inoculated into culture media. Bacteria were cultured at 37°C and 200 rpm for 12 h, and yeast was cultured at 30°C and 200 rpm for 1 day to obtain culture solutions. The microorganisms in the culture solutions were then diluted to the appropriate OD values ​​using the corresponding culture media. 600nm=0.1, add 99 μL to each well of the 96-well plate.

[0146] (2) Photodynamic inhibitory activity of Cercosporin A against bacteria:

[0147] The photodynamic antibacterial activity of the novel perylene quinone compound cercosporin A was evaluated using cercosporin and baicalin, which have been studied extensively, as controls.

[0148] Each compound was prepared into a 10 mM stock solution using DMSO as the solvent. 1 μL of each stock solution was added to different wells, and the solutions were diluted twofold to obtain 11 final concentrations: 100, 50, 25, 12.5, 6, 3, 1.5, 0.8, 0.4, 0.2, and 0.1 μM. Three parallel wells were prepared for each concentration, along with blank wells (without cells) and control wells (without the compound). The concentration was measured at a power density of 18 W / cm². 2 The bacteria were cultured under fluorescent lamps for 12 hours. The absorbance at 600 nm was measured using a microplate reader. The bacterial survival rate was calculated using the average of three parallel wells. The formula was: Bacterial survival rate = (Experimental group - Blank) / (Control group - Blank) × 100%. The IC50 (half-maximal inhibitory concentration) is the drug concentration at which 50% of the bacteria are inhibited.

[0149] (3) Photodynamic inhibitory activity of Cercosporin A on yeast: The method of determination is the same as that of Cercosporin A on bacterial photodynamic inhibitory activity, except that it is cultured under light conditions for 24 hours.

[0150] The results are shown in Table 2:

[0151] Table 2: Photodynamic antibacterial activity of Cercosporin A

[0152]

[0153] The results showed that all three perylene quinone compounds tested had good inhibitory effects on Gram-positive bacteria. Figure 16 Furthermore, compared to cercosporin and erythromycin, cercosporin A exhibited a stronger inhibitory effect on yeast. Figure 17 For different yeast strains, its photodynamic antibacterial activity was increased by several to tens of times.

[0154] Example 6: Photostability Analysis of Cercosporin A

[0155] The specific steps are as follows:

[0156] Cercosporanic acid and erythromycin were used as controls. Each compound was prepared into a 10 mM stock solution using DMSO as the solvent, and then diluted with acetonitrile to a working solution concentration of 2 μM. The solutions were irradiated with a 30W fluorescent lamp at 5 cm for 8 h. Samples were taken at 0, 0.5, 1, 2, 4, and 8 h for liquid chromatography analysis. The results are as follows: Figure 18 As shown.

[0157] The results showed that after 8 hours of light exposure, cercosporin and cyproterone both degraded by more than 50%, while cercosporin A still had a retention rate of more than 90%. This indicates that the special skeletal structure of cercosporin A endows it with excellent photostability and has a wider range of application prospects in photodynamic therapy.

[0158] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria used Cercospora JNU001 as the host cell, knocking out the genera of the host cell. CTB6 Genes, and integrated expression of genes derived from Parastagonospora nodorum SN15 elcE and elcG Genes; the stated CTB6 The nucleotide sequence of the gene is shown in SEQ ID NO.1; elcE , elcG The nucleotide sequences of the gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

2. The use of the genetically engineered bacteria of claim 1 in the preparation of a perylenequinone compound or a product containing a perylenequinone compound; the structural formula of the perylenequinone compound is: .

3. Use according to claim 2, characterized in that, The genetically engineered bacteria of claim 1 are fermented.

4. The use according to claim 3, wherein the compound is ###0002### The genetically engineered bacteria of claim 1 are inoculated into a fermentation medium for fermentation culture to obtain a fermentation liquor, the obtained fermentation liquor is extracted to obtain the perylenequinone compound.

5. The use according to claim 4, wherein the compound is ###0002### The culture conditions of the fermentation culture are as follows: the fermentation is carried out at a temperature of 22-28℃, an initial pH of 7.0-8.5, a rotation speed of 100-150 rpm, and under continuous or intermittent light for 7-10 d.

6. The use according to claim 5, wherein the compound is ###0002### The fermentation medium contains 10-30 g / L glucose, 1-3 g / L soybean peptone, 0.5-2 g / L sodium acetate, 0.5-1.5 mg / L biotin, 2.5-7.5 mg / L L-phenylalanine, 50-150 mg / L sodium benzoate, 0.5-1.5 mg / L pyridoxal phosphate, 0.5-1.5 mg / L thiamine hydrochloride, 100-200 mg / L potassium dihydrogen phosphate, 3-10 mg / L calcium nitrate, 0.5-1.5 mg / L calcium pantothenate, 2.5-10 mg / L manganese chloride, 1-3 mg / L ferric chloride, 0.5-1.5 mg / L copper nitrate, 2-6 mg / L magnesium sulfate, and 1-5 mg / L zinc sulfate.

Images