Escherichia coli and application of the same in high-efficiency synthesis of bilirubin
Patent Information
- Application Number
- CN202311415208.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-30
- Publication Date
- 2026-09-25
- Estimated Expiration
- 2043-10-30
AI Technical Summary
目前的研究报道显示,由血红素加氧酶催化的血红素转化速率,远低于由胆绿素还原酶催化的胆绿素转化速率,导致难以利用低成本的血红素为底物进行两步生物催化
[0081](1)本发明成功筛选到了高活力的血红素加氧酶和胆绿素还原酶,同时筛选到恰当的伴侣蛋白进一步提高血红素加氧酶的催化效率。此外,对血红素加氧酶和伴侣蛋白进行截短突变,显著提高可溶性表达水平。大肠杆菌内共表达上述基因,同时偶联高活力甲酸脱氢酶,成功实现了在单个细胞中重构完整的血红素降解级联反应,同时无需外源添加NADPH,利用细胞内源性辅酶即可达到高催化活力,催化过程中无中间产物胆绿素的积累。以血红素为底物,经过多酶一锅级联催化,胆红素最终产量可达415.5mg/L。
Smart Images

Figure CN117487733B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a recombinant Escherichia coli strain and its application in the efficient synthesis of bilirubin, belonging to the field of biocatalysis engineering. Background Technology
[0002] Bilirubin (CAS No. 635-65-4) is the main pigment in bile. Excessive accumulation of bilirubin in the body (especially in newborns) can easily lead to various diseases. For example, bilirubin deposition in the central nervous system can cause bilirubin encephalopathy in newborns, impairing hearing, motor function, and mental function; and high concentrations of free bilirubin in plasma can easily cause jaundice. Therefore, for a long time, bilirubin was considered a metabolic waste product.
[0003] However, in recent years, with in-depth research on bile pigments, their beneficial physiological effects have been gradually discovered and reported. Bilirubin has antioxidant properties, physiologically preventing the oxidation of biomolecules such as fats and proteins and scavenging oxygen free radicals; appropriate concentrations of bilirubin in serum can prevent cardiovascular and metabolic diseases; it plays a key role in reducing neuronal damage in the central nervous system; in addition, due to its significant anti-inflammatory, antioxidant, and antiviral effects, bilirubin has also been used in the treatment of systemic complications of COVID-19 infection. In 2022, the global bilirubin market reached 10.065 billion yuan, and the Chinese bilirubin market reached 3.199 billion yuan. The global bilirubin market is projected to reach 14.137 billion yuan by 2028, representing a compound annual growth rate of 5.36%.
[0004] Given the important role and potential market value of bilirubin, its production methods have been developed and reported. Traditional preparation methods involve extraction from the bile of livestock such as pigs and cattle. Recent research progress has mainly focused on the development of extraction and purification processes. However, this method is limited by the availability of pig bile resources, resulting in low extraction rates and yields that cannot meet market demand. With the development of synthetic biology, biocatalysis, as a green manufacturing method, has attracted widespread attention in the synthesis of high-value-added bio-organic molecules in recent years. Biocatalysis has natural advantages, such as mild reaction conditions, environmental friendliness, almost no byproduct formation, and high stereoselectivity.
[0005] Eukaryotes typically possess a complete bilirubin synthesis pathway. A key metabolic intermediate in this pathway is heme. Heme undergoes ring-opening oxidation catalyzed by heme oxygenase (HO, EC 1.14.14.18) to form the intermediate biliverdin. Biliverdin then undergoes hydrogenation reduction catalyzed by biliverdin reductase (BVR, EC 1.3.1.24) to revert to bilirubin. The reaction equation is as follows: Figure 9 As shown.
[0006] Currently, there are limited reports on the biosynthesis of bilirubin and its key intermediates. For example, Yan Sihan et al. constructed a heme oxygenase and glutamate dehydrogenase coenzyme regeneration system derived from Clostridium tetani and displayed it on a membrane surface. Using whole-cell E. coli as a catalyst, they achieved a biliverdin yield of 76.3 mg / L. Jianfeng Mei et al. used biliverdin as a substrate and E. coli as a host to express biliverdin reductase derived from cyanobacteria as a whole-cell catalyst, achieving a bilirubin yield of 325 mg / L. Current research reports indicate that the heme conversion rate catalyzed by heme oxygenase is much lower than that catalyzed by biliverdin reductase, making it difficult to utilize low-cost heme as a substrate for two-step biocatalysis. Summary of the Invention
[0007] Heme oxygenase lacks a coenzyme-binding domain and cannot directly acquire electrons and reducing power from NADPH. The electron transfer to the substrate heme requires the participation of redox chaperone proteins, which contain FAD, FMN, or Fe-S clusters and transfer electrons from NADPH to the heme molecule through conformational rearrangement. Therefore, introducing chaperone proteins into the catalytic system may help improve the catalytic efficiency of heme oxygenase, making the route for the two-step bio-cascade synthesis of bilirubin from heme a more feasible and promising research prospect.
[0008] This invention screened a series of heme oxygenases (HOs) and biliverdin reductases (BVRs) from different sources based on the bilirubin biosynthesis pathway. Using the model strain *Escherichia coli* BL21(DE3) as the expression host, all protein sequences were codon-optimized. To improve the soluble expression levels of the proteins, truncated mutants were constructed based on the wild-type enzymes, resulting in a significant increase in the content of catalytically active proteins in the same concentration of whole-cell catalyst. The optimal HOs and BVRs were further screened by determining the product formation using high-performance liquid chromatography (HPLC). Since the catalytic function of heme oxygenases requires at least one of several chaperone proteins—cytochrome P450 reductase (CPR), ferricyanide (Fd), and ferricyanide reductase (FNR)—to assist electron transfer, the optimal chaperone protein was also screened based on enzyme activity. Two engineered strains were constructed for catalyzing the conversion of heme to the intermediate product biliverdin and biliverdin to the final product bilirubin, respectively. To further reduce production costs, NADP was additionally expressed in all engineered strains. +Formate-dependent dehydrogenase is used for the regeneration of coenzyme NADPH, achieving highly efficient catalysis without the addition of exogenous coenzymes. Finally, the genes involved in the two-step catalytic reaction are integrated into the same strain, realizing a highly efficient one-pot synthesis of bilirubin, laying a solid foundation for its industrial production.
[0009] This invention provides a recombinant *Escherichia coli* strain expressing heme oxygenase from *Saccharomyces cerevisiae*, biliverdin reductase from *Mus musculus*, and NADP from *Azospirillum palustre*. + It is a formate-dependent dehydrogenase and also expresses cytochrome P450 reductase from Saccharomyces cerevisiae or feroxin and feroxin reductase from Arabidopsis thaliana.
[0010] In one embodiment of the present invention, the recombinant Escherichia coli is expressed as E. coli BL21(DE3).
[0011] In one embodiment of the present invention, the recombinant Escherichia coli is expressed using pET28a(+) or pETDuet-1 as an expression vector.
[0012] In one embodiment of the present invention, the heme oxygenases from different sources are respectively derived from *Homosapiens* (HsHO, NP_002124.1), *Rattus norvegicus* (RnHO, AAA41346.1), *Glycine max* (GmHO, NP_001304379.2), *Arabidopsis thaliana* (AtHO, ABE65721.1), *Plasmodium falciparum* (PfHO, CZT98369.1), *Saccharomyces cerevisiae* (ScHO, GHM92019.1), *Synechocystis* sp. PCC 6803 (SynHO, BAA18219.1), *Clostridium tetani* (CtHO, WP_035111656.1), and *Corynebacterium*. glutamicum (CgHO, BAV23840.1).
[0013] Preferably, the heme oxygenase is ScHO (GHM92019.1), whose nucleotide sequence is shown in SEQ ID NO.1; or the heme oxygenase is ScHO (GHM92019.1), which is obtained by sequentially deleting amino acids 289-318 at its C-terminus.
[0014] SEQ ID NO.1:
[0015] atggaagatagcagcaacaccatcatcccgtccccgaccgatgttggcgccctggcgaaccgtatcaacttccagacccgcgatgcgcacaacaaaatcaacaccttcatgggtatcaaaatggcgatcgcaatgcgtcacggcttcatctaccgccagggcatcctggcgtactactacgttttcgacgcgatcgaacaggaaatcgatcgtctgctgaacgatccggtgaccgaagaagaattgcagacctccaccatcctgaaacagttctggctggaggacttccgccgtagcacccagatctacaaagatctgaaactgctgtacagcaacaccttcaaatccaccgaaagcctgaacgagttcctggcgaccttccagaaaccgccgctgctgcaacagttcatcaacaacatccatgaaaacatccacaaagaaccgtgcaccatcctgtcctactgccacgttctgtacctggccctgttcgcgggcggcaaactgatccgttccaacctgtaccgtcgcctgggtctgttcccgaacttcgaaaaactgtctcagaaagaactggttaaaaaaggcaccaacttcttcaccttctccgacctgggcccgaccgaagaaacccgcctgaaatgggaatataaaaagaactacgaactggcaacccgtaccgaactgaccgaagcgcagaaactgcaaatcatctccgttgcggaaggtatcttcgactggaactttaacatcgtggcggaaatcggcgaactgaaccgtcgtgaactgatgggcaaattctctttcaaatgcatcacctacctgtacgaagaatggatgttcaacaaagatagcgcgacccgccgtgcgctgcacaccgttatgctgctgatgctgagcatcatcgcgatctgggttctgtacttcctggtgaaaaaatctttcctgagcatcgtttaa
[0016] In one embodiment of the present invention, the biliverdin reductases from different sources are respectively derived from Homosapiens (HsBVR, NP_000703.2), Rattus norvegicus (RnBVR, NP_446302.2), Mus musculus (MmBVR, XP_030102511.1), Bos taurus (BtBVR, NP_001091040.1), Sus scrofa (SsBVR, XP_003134937.1), Cavia porcellus (CpBVR, XP_003470146.1), Rhinopithecus bieti (RbBVR, XP_017750420.1), Felis catus (FcBVR, XP_023105956.1), and Mycobacterium. tuberculosis (MtBVR, WP_003899157.1), Synechocystis sp. PCC 6803 (SynBVR, BAA16797.1).
[0017] Preferably, the biliverdin reductase is MmBVR (XP_030102511.1), with the nucleotide sequence shown in SEQ ID NO.2.
[0018] SEQ ID NO.2:
[0019] atgagcaccgaaccgaaacgtaaattcggcgttgttgttgttggtgttggtcgcgcgggcagcgttcgtatccgtgatctgaaagatccgcactctagcgcgttcctgaa
[0020] cctgatcggttacgtttctcgtcgtgaactgggcagcctggataacgttcgtcagatctctctggaagatgcgctgcgtagccaggaagttgatgttgcatacatctgcac
[0021] tgaatcctcttcccacgaggactacatccgtcagttcctccaggcgggtaaacacgttctggttgaatacccgatggcgctgagcttcgcggcggcgcaggaactgtg
[0022] ggaactggcggcgcagaaaggtcgtgttctgcacgaagaacacatcgaactgctgatggaagaatttgagttcctgaaacgtgaagttgcaggcaaagaactgctga
[0023] aaggcagcctgcgtttcaccgcgagcccgctggaagaagaaaaattcggcttcccggcgttcagcggcatctctcgtctgacctggctggtgtctctgttcggtgaact
[0024] gtctctgatcagcgcgactatggaaaaccgtaaagaagatcagtatatgaaaatgaccgttcagctggaaacccagaacaaatctccgctgagctggattgaagaaaa
[0025] aggtccgggcctgaaacgtaaccgtcacatcagcatccacttcaaatccggcagcctggaagaagttccgaacgttggtgttaacaaaaacatcttcctgaaagatca
[0026] ggatattttcatccagaaactgctgggccaggttagcgcggaagatctggcggcggaaaagaaacgtatcctgcactgcctggaactggcgagcgatattcagcgtc
[0027] tgtgccaccgtaaacagtaa
[0028] In one embodiment of the present invention, the chaperone protein has two different types, each adapted to heme oxygenase from different sources.
[0029] The first type consists of a single protein, namely cytochrome P450 reductase, which is derived from Homo sapiens (HsCPR, NP_001382342.1), Rattus norvegicus (RnCPR, NP_113764.1), Candida albicans (CaCPR, XP_720425.2), and Saccharomyces cerevisiae (ScCPR, NP011908.1).
[0030] The preferred one is ScCPR(NP_011908.1), whose nucleotide sequence is shown in SEQ ID NO.3, or cytochrome P450 reductase with amino acids 1-24 of the N-terminus of ScCPR(NP_011908.1) deleted sequentially.
[0031] SEQ ID NO.3:
[0032]
[0033] The second type consists of two proteins: ferricyanin and ferricyanin reductase.
[0034] The ferroredoxins were derived from Glycine max (GmFd, XP_014619795.1), Pseudomonasputida (PpFd, PDB code 1PDX), and Arabidopsis thaliana (AtFd, NP_176291.1), respectively.
[0035] The preferred nucleotide sequence is AtFd(NP_176291.1), whose nucleotide sequence is shown in SEQ ID NO.4;
[0036] SEQ ID NO.4:
[0037] atggcgtctaccgcgctgagcagcgcgatcgttggcaccagcttcatccgtcgtagcccggcgccgatcagcctgcgtagcctgccgagcgcgaacacccagagc
[0038] ctgttcggcctgaaaagcggcaccgcgcgtggcggtcgtgttaccgcgatggcgacctacaaagttaaattcatcaccccggaaggtgaactggaagttgaatgcga
[0039] tgatgatgtttacgttctggatgcggcggaagaagcgggcatcgatctgccgtacagctgccgtgcgggctcttgcagcagctgcgcgggcaaagttgttagcggta
[0040] gcgttgatcagtctgatcagagcttcctggatgatgaacagatcggcgaaggcttcgttctgacctgcgcggcgtacccgaccagcgatgttaccatcgaaacccaca
[0041] aagaagaagatattgtttaa
[0042] The ferroreductases were derived from Pisum sativum (PsFNR, XP_050906496.1), Arabidopsis thaliana (AtFNR, CAB52472.1), Pseudomonas putida (PpFNR, PDB code1Q1R), and Zea mays (ZmFNR, NP_001336742.1).
[0043] The preferred one is AtFNR (CAB52472.1), whose nucleotide sequence is shown in SEQ ID NO.5.
[0044] SEQ ID NO.5:
[0045] atggcggcggcgatcagcgcggcggttagcctgccgtcctccaaaagctctagcctgctgaccaaaatctccagcgtgagcccgcagcgtatcttcctgaaaaaga
[0046] gcaccgtgtgctaccgccgtgttgtgtccgttaaagcgcaggttaccactgataccaccgaagcgccgccggtgaaagttgtgaaagaaagcaaaaaacaggaaga
[0047] aggtatcgttgtgaacaaattcaaaccgaaaaacccgtacaccggccgttgcctgctgaacaccaaaattaccggtgacgatgctccgggtgaaacctggcacatcgt
[0048] gtttaccaccgaaggtggcgttccgtaccgtgaaggccagagcatcggcgttattccggaaggcatcgacaaaaacggcaaaccgcacaaactgcgcctgtatagc
[0049] attgcttcttctgcgattggtgatttcggtgatagcaaaaccgtttctctgtgcgttaaacgcctggtgtacaccaacgatggtggtgaaattgtgaaaggtgtttgcagca
[0050] acttcctgtgcgatctgaaaccgggcgatgaagctaaaatcaccggcccggtgggtaaagaaatgctgatgccgaaagacccgaacgcgaccatcatcatgctggg
[0051] caccggtactggcatcgcgccgttccgtagcttcctgtggaaaatgttcttcgaagaacacgaagattacaaattcaacggcctggcctggctgttcctgggcgttccg
[0052] acctcctcttctctgctgtacaaagaagagttcgaaaaaatgaaagagaaaaacccggacaacttccgtctgggcttctccgtttcccgtgaacagaccaacgaaaaa
[0053] ggcgaaaaaatgttcatccagacccgtatggcagaatacgctgaagaactgtgggaactgctgaaaaaagataacactttcgtttatatgtgcggcctgaaaggcatg
[0054] gaaaaaggcatcgatgacatcatggttagcctggcggcgaaagacggcatcgactggctggaatttaaaaaacagctgaaacgtagcgaacagtggaacgttgaag
[0055] ttttctaa
[0056] In one embodiment of the present invention, the truncated mutant of the protein refers to the truncated mutant ScHOΔ10-ScHOΔ30 formed by sequentially deleting amino acids 289-318 from the C-terminus of the wild-type ScHO; and the truncated mutant ScCPRΔ8-ScCPRΔ24 formed by sequentially deleting amino acids 1-24 from the N-terminus of the wild-type ScCPR.
[0057] In one embodiment of the present invention, the formate dehydrogenase is NADP derived from Azospirillum palustre (WP_098736599.1). + The formate-dependent dehydrogenase, named ApFDH, has the nucleotide sequence shown in SEQ ID NO.6.
[0058] SEQ ID NO.6:
[0059]
[0060] In one embodiment of the present invention, the high-performance liquid chromatography detection method refers to detecting the content of biliverdin, a product catalyzed by heme oxygenase, or the content of bilirubin, a product catalyzed by biliverdin reductase.
[0061] In one embodiment of the present invention, the enzyme activity of the heme oxygenase is measured by HPLC analysis of the peak area of the biliverdin product, which is obtained from a reaction using heme as a substrate. The screening of the heme oxygenase is performed by comparing enzyme activities.
[0062] In one embodiment of the present invention, the enzyme activity of the biliverdin reductase is measured by HPLC analysis of the peak area of the bilirubin product obtained from the reaction using biliverdin as a substrate. The screening of the biliverdin reductase is conducted by comparing enzyme activities.
[0063] In one embodiment of the present invention, the screening of the chaperone protein is carried out by using a preferred heme oxygenase as a catalyst and heme as a substrate, with the addition of one or more chaperone proteins, and the peak area of the product biliverdin is detected by HPLC and the corresponding enzyme activity is calculated, which is measured by the increase in enzyme activity compared with the control group.
[0064] The present invention also provides base sequences encoding the above-mentioned heme oxygenase, biliverdin reductase, formate dehydrogenase and chaperone protein.
[0065] The present invention also provides one or more recombinant vectors carrying the above-mentioned genes.
[0066] In one embodiment of the present invention, the recombinant vector is pET28a or pETDuet-1 as the expression vector.
[0067] The present invention also provides one or more recombinant cells expressing the above-mentioned genes or carrying the above-mentioned recombinant vectors.
[0068] In one embodiment of the present invention, the recombinant cells use Escherichia coli as the expression host.
[0069] In one embodiment of the present invention, the recombinant bacteria are constructed by PCR amplification of heme oxygenase (HOs), biliverdin reductase (BVRs), chaperone proteins (CPRs, Fds, FNRs), or formate dehydrogenase (ApFDH), cloned into plasmid pET28a, constructing recombinant plasmids pET28a-HOs, pET28a-CPRs, pET28a-BVRs, pET28a-FNRs, pET28a-Fds, pET28a-ApFDH, and constructing recombinant Escherichia coli whole-cell catalysts.
[0070] In another embodiment of the present invention, the recombinant bacteria are constructed by PCR amplification of a preferred heme oxygenase truncated mutant (ScHOΔ30), a preferred biliverdin reductase (MmBVR), a preferred chaperone protein or its truncated mutant (ScCPRΔ24, AtFNR, AtFd), and formate dehydrogenase (ApFDH), cloned into plasmid pETDuet-1, constructing the recombinant plasmid pETDuet-1-ScHOΔ30 / ScCPRΔ24 / MmBVR / ApFDH, and constructing the recombinant Escherichia coli whole-cell catalyst pETDuet-1-ScHOΔ30 / AtFNR / AtFd / MmBVR / ApFDH.
[0071] This invention provides a method for improving the bilirubin synthesis capacity of *Escherichia coli*. The method involves using *Escherichia coli* BL21(DE3) as the host cell and expressing heme oxygenase from *Saccharomyces cerevisiae*, biliverdin reductase from *Mus musculus*, and NADP from *Azospirillum palustre*. + It is a formate-dependent dehydrogenase and also expresses cytochrome P450 reductase from Saccharomyces cerevisiae or feroxin and feroxin reductase from Arabidopsis thaliana.
[0072] In one embodiment of the present invention, the heme oxygenase is the heme oxygenase with NCBI accession number GHM92019.1 or the heme oxygenase obtained by sequentially deleting amino acids 289-318 at its C-terminus; the biliverdin reductase has NCBI accession number XP_030102511.1; the cytochrome P450 reductase is the cytochrome P450 reductase with NCBI accession number NP_011908.1 or the cytochrome P450 reductase obtained by sequentially deleting amino acids 1-24 at its N-terminus; the ferredoxin has NCBI accession number NP_176291.1; and the ferredoxin reductase has NCBI accession number CAB52472.1.
[0073] The present invention also provides a method for whole-cell catalytic synthesis of bilirubin, wherein the method comprises using heme as a substrate and, under aeration conditions, using the above-mentioned recombinant cell lysate or the above-mentioned recombinant Escherichia coli whole-cell catalytic conversion to synthesize bilirubin.
[0074] In one embodiment of the present invention, the whole-cell catalytic system includes, but is not limited to, 1 mM heme (equivalent to 651 mg / L), an aeration rate of 10 vvm, and heme pre-dissolved in 50% of the total reaction volume of NaOH solution (100 mM). After complete dissolution, the pH is adjusted to 7.5 with HCl, and the reaction volume is made up with 50 mM ammonium formate solution (pH 7.5). The reaction time is 2 h, and the reaction temperature is 35 °C.
[0075] In one embodiment of the present invention, the whole-cell catalyst is obtained by culturing recombinant bacteria and inducing them to express heme oxygenase, biliverdin reductase, chaperone protein and formate dehydrogenase, and then collecting the recombinant bacterial cells.
[0076] In one embodiment of the present invention, the whole-cell catalyst is obtained by inoculating recombinant *E. coli* co-expressing heme oxygenase, biliverdin reductase, chaperone protein, and formate dehydrogenase into 100 mL LB medium at a 1% inoculation rate and culturing at 37°C. When OD... 600 When the pH reaches 0.4–0.6, add 0.5 mM IPTG to induce protein expression. After induction at 20°C for 16 h, centrifuge at 8,000 × g for 10 min to collect the bacterial cells. Wash the bacterial cells twice with 20 mM Tris-HCl (pH 7.5) buffer to obtain the final product.
[0077] In one embodiment of the present invention, the reaction conditions for whole-cell catalysis are: stirring speed 200 r / min, temperature 35℃, pH 7.5, aeration rate 10 vvm, and reaction time 1-4 h.
[0078] In one embodiment of the present invention, the amount of heme added is 0.5-4 mM (equivalent to 325-2604 mg / L), and the amount of catalyst added is 10-40 g / L.
[0079] This invention provides the application of the above-described recombinant Escherichia coli or the above-described method in the preparation of bilirubin or products containing bilirubin.
[0080] Beneficial effects
[0081] (1) This invention successfully screened highly active heme oxygenase and biliverdin reductase, and simultaneously screened appropriate chaperone proteins to further improve the catalytic efficiency of heme oxygenase. Furthermore, truncated mutations of heme oxygenase and chaperone proteins significantly increased their soluble expression levels. The above genes were co-expressed in *E. coli*, and coupled with highly active formate dehydrogenase, a complete heme degradation cascade reaction was successfully reconstructed in a single cell. High catalytic activity was achieved using endogenous coenzymes without the need for exogenous NADPH addition, and no intermediate product biliverdin accumulated during the catalytic process. Using heme as a substrate, through a one-pot cascade catalysis of multiple enzymes, the final bilirubin yield reached 415.5 mg / L.
[0082] (2) The establishment of this whole-cell transformation system solves the problems of cumbersome steps, low yield and large wastewater discharge in the traditional biological tissue extraction method for producing bilirubin. It has good atom economy and realizes efficient and green synthesis of bilirubin using heme as substrate. According to all current data, the bilirubin yield of this invention is the highest level of biological synthesis. Attached Figure Description
[0083] Figure 1 Protein expression status of all genes to be screened.
[0084] Figure 2 Quantitative analysis of protein expression levels based on protein gel.
[0085] Figure 3 HPLC chromatograms and standard curves of biliverdin and bilirubin; where a, chromatogram of biliverdin; b, standard curve of biliverdin; c, chromatogram of bilirubin; d, standard curve of bilirubin.
[0086] Figure 4 Structural models of wild-type ScHO(a) and ScCPR(c) (hydrophobic peptides are marked in red), and hydrophobicity analysis of the amino acid sequences of ScHO(b) and ScCPR(d) based on PortScale.
[0087] Figure 5 Comparison of protein expression levels between ScHO and the truncated mutant RnHOΔ30; (a) and (b) comparison of protein expression levels between ScCPR and the truncated mutant ScCPRΔ24.
[0088] Figure 6 Reaction progress curves of recombinant E. coli-ScHOΔ30 / ScCPRΔ24 / MmBVR / ApFDH at different substrate concentrations.
[0089] Figure 7 Standard curve of heme.
[0090] Figure 8 Reaction progress curves of recombinant Escherichia coli-ScHOΔ30 / ScCPRΔ24 / MmBVR / ApFDH at a 2L scale.
[0091] Figure 9 : Bilirubin reaction formula. Detailed Implementation
[0092] The preparation of nucleic acid gels involved in the following examples:
[0093] 50×TAE buffer: Accurately weigh 242g of Tris and 37.2g of Na2EDTA·2H2O into a 1L volumetric flask, add 800mL of ultrapure water to dissolve thoroughly and shake well. Then add 57.1mL of glacial acetic acid, shake well, and add deionized water to bring the volume to 1L. Prepare the 50×TAE buffer, then dilute it 50 times to make 1×TAE buffer. Using the 1×TAE buffer as a solvent, prepare a 0.9% agarose solution (dissolved by heating). After the agarose is completely dissolved, add the nucleic acid dye (1.5μL / 20mL), gently shake to mix evenly, avoiding the formation of bubbles, pour into a nucleic acid gel mold and cool to obtain an agarose gel.
[0094] The gel electrophoresis involved in the following examples:
[0095] Place the gel in an electrophoresis tank containing 1×TAE buffer. Set the electrophoresis conditions to 160V for 15 min. After electrophoresis, observe the bands under UV light. Template digestion: Take 50 μL of the PCR product that tested positive on electrophoresis, add 1 μL of the restriction enzyme DpnⅠ and 5 μL of the corresponding buffer to remove the methylated template DNA. The reaction conditions are 37℃ for 3 h. After the reaction, incubate at 65℃ for 10 min to inactivate DpnⅠ.
[0096] The product purification involved in the following examples:
[0097] according to The product instructions for the FastPure Gel DNA Extraction Mini Kit specify the purification of digestion products.
[0098] Homologous recombination involved in the following embodiments:
[0099] according to The ClonExpress II One Step Cloning Kit product instructions describe using homologous recombination to ligate a truncated, mutated DNA fragment into a linearized vector to obtain a recombinant plasmid.
[0100] The transformation of recombinant plasmids involved in the following examples:
[0101] All the homologous recombination reaction solution was added to E. coli BL21(DE3) competent cells, mixed well, and placed on ice for 30 min; then heat-shocked in a 42℃ water bath for 90 s, quickly transferred to an ice bath for 5 min, added 600 μL of LB medium, and cultured at 37℃ and 200 rpm for 1 h; 50 μL was plated on LB plates containing the corresponding antibiotic and incubated upside down at 37℃ for 12 h; single colonies were picked for sequencing verification, and strains that had been correctly introduced with the recombinant plasmid were preserved.
[0102] The detection methods involved in the following embodiments are as follows:
[0103] SDS-PAGE gel electrophoresis:
[0104] Prepare the BBI blocking-free SDS-PAGE denaturing acrylamide color gel rapid preparation kit and prepare the protein gel according to the instructions. Sample preparation: Take wet bacterial cells containing the target protein, prepare a 20 g / L cell suspension with PB buffer (pH 7.4, 50 mM), and sonicate on ice (450 W, 1 s on, 4 s off, for a total of 10 min). Centrifuge at 12,000 × g, 4 °C for 1 min to separate the supernatant and precipitate. Take 20 μL of the supernatant, mix with 8 μL of loading buffer, heat in a boiling water bath for 10 min, centrifuge at 12,000 × g for 5 min, and set aside.
[0105] Electrophoresis. Protein gel loading volume: 10 μL sample, 3 μL marker; Electrophoresis conditions: 160 V, 60 min; Electrophoresis buffer (g / L): glycine 14.4, SDS 1, Tris 3.
[0106] Staining: Immerse the protein gel in staining solution (Coomassie Brilliant Blue R250 1g, methanol 450mL, acetic acid 100mL, water 450mL) for 15 minutes, then wash twice with water. Destaining: Immerse in destaining solution (ethanol 10%, acetic acid 10%, water 80%) and gently shake, replacing with fresh destaining solution until the bands are clearly visible.
[0107] Biliverdin and bilirubin testing
[0108] Mobile phase: A (25 mM ammonium acetate, pH adjusted to 3.5 with acetic acid); B (acetonitrile:methanol:isopropanol = 8:1:1); A:B = 5:95; Column temperature: 35℃; Column: C18; Injection volume: 5 μL; Run time: 10 min; Detection wavelength: 400 nm. Chromatograms of biliverdin and bilirubin, and the corresponding standard curves are attached to the instruction manual. Figure 3 As shown.
[0109] The proteins to be screened obtained from gene mining involved in the following examples are shown in Table 1.
[0110] Table 1. Proteins to be screened obtained from gene mining.
[0111]
[0112] Example 1: Gene Synthesis and Expression
[0113] The specific steps are as follows:
[0114] (1) Construction of recombinant vector
[0115] Amino acid sequences of heme oxygenase, biliverdin reductase and chaperone proteins with catalytic potential were obtained by screening the NCBI database. The corresponding NCBI numbers or GenBank numbers are shown in Table 1.
[0116] Furthermore, highly active NADP was obtained through sequence and structure alignment. + The protein sequence of the formate dehydrogenase-dependent mutant was obtained. The obtained amino acid sequence was submitted to Sangon Biotech (Shanghai) Co., Ltd. for codon optimization, gene synthesis, and construction of recombinant vectors. The commonly used E. coli expression plasmid pET28a(+) was selected as the vector. Each synthesized gene sequence was inserted between the BamHI and XhoI restriction enzyme recognition sites of pET28a(+) in the 5'- to 3'- direction to obtain the corresponding recombinant plasmids: pET28a(+)-HO, pET28a(+)-BVR, pET28a(+)-CPR, pET28a(+)-Fd, and pET28a(+)-FNR.
[0117] (2) Construction of recombinant strains
[0118] Escherichia coli BL21(DE3) was selected as the expression host. The recombinant plasmids obtained in step (1) were introduced into competent E. coli BL21(DE3) cells and plated onto LB solid medium plates containing kanamycin sulfate (Kan). Positive transformants were picked and preserved to obtain the corresponding engineered strains.
[0119] (3) Protein expression
[0120] The obtained engineered strains were inoculated into test tubes containing LB liquid medium of Kan and cultured at 37°C and 200 rpm for 8-10 h to obtain seed culture. The seed culture was then inoculated into shake flasks containing LB liquid medium of Kan at a 1% inoculation rate (100 mL / 500 mL volume) and cultured at 37°C and 200 rpm until OD (dose elongation) was reached. 600Once the concentration reaches 0.4-0.6, add isopropyl-β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM, adjust the temperature to 20℃, and continue culturing for 16 h to induce protein expression; the fermentation broth is then obtained.
[0121] The obtained fermentation broth was centrifuged at low temperature under the following conditions: 8,000×g, 10 min, 4℃. After centrifugation, the supernatant was discarded, and the precipitate was washed twice with physiological saline to obtain wet bacterial cells containing the target protein. The obtained wet bacterial cells were ultrasonically disrupted under the following conditions: 400W, 0℃, working for 2 s, intermittent for 4 s, for a total time of 10 min, to obtain cell lysate, which is the catalyst to be added in the embodiments of the present invention.
[0122] The obtained cell lysates were analyzed by SDS-PAGE gel electrophoresis to verify the soluble expression of proteins. Protein expression was as follows: Figure 1 As shown, the results indicate that all synthesized genes were successfully heterologously expressed in E. coli and exhibited different expression levels.
[0123] Example 2: Screening of heme oxygenase
[0124] The specific steps are as follows:
[0125] First, the protein expression levels obtained in Example 1 were quantitatively analyzed. ImageJ was used to form a spectrum based on the size and intensity of the protein gel bands. The corresponding peaks were integrated, and a protein band with constant expression in the E. coli genome was selected as an internal control. The integration results were normalized to determine the relative expression levels of proteins from different sources, and the actual amount of crude enzyme solution added was calculated to ensure the same final concentration for each protein. The protein gel analysis results based on ImageJ (using ScCPR protein gel images as an example) are shown below. Figure 2 As shown in Table 2, the relative expression levels of each protein are shown in the table.
[0126] Table 2. Relative expression levels of proteins from different sources
[0127]
[0128] Following the method in Example 1, the cell lysate containing heme oxygenase was prepared. The actual amount of cells used was calculated based on the relative protein expression levels shown in Table 2 to ensure that the actual concentration of each heme oxygenase was equal. For example, if the relative expression level of CgHO was 100% and the relative expression level of SynHO was 49.1%, then when the concentration of the cell lysate containing CgHO was 10 g / L, the concentration of the cell lysate containing SynHO needed to reach 20.4 g / L to ensure that the amount of heme oxygenase in the two cell types was equal.
[0129] The specific steps are as follows:
[0130] (1) Preparation of cell lysate
[0131] Preparation of heme oxygenase lysis buffer: Weigh the corresponding mass of wet bacterial cells E coli BL21(DE3) / pET28a(+)-HO prepared in step (3) of Example 1, and sonicate them under ultrasonic conditions of 400W, 0℃, working for 2s, intermittent for 4s, and total time of 10min to obtain heme oxygenase lysis buffer. Use the lysis buffer as a catalyst to carry out the heme conversion reaction.
[0132] Preparation of mixed lysis buffer of redox chaperone proteins: Following the method in Example 1, 11 wet bacterial cells containing the target protein, namely E coli BL21(DE3) / pET28a(+)-CPR, E coli BL21(DE3) / pET28a(+)-Fd, and E coli BL21(DE3) / pET28a(+)-FNR, were mixed in equal proportions, with each cell accounting for 9.09%. The mixed lysis buffer was obtained by sonication at 400W, 0℃, with a working time of 2s and an intermittent time of 4s for a total time of 10min.
[0133] Transformation conditions: In a 1 mL reaction system, the crude heme oxygenase enzyme solution was added with 10 g / L of its cell lysis buffer (based on the highest expression level of CgHO; the amount of lysis buffer added was: first weigh 10 g / L of whole cells, then lyse them to obtain the required lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 4 mM NADPH, 40 g / L of mixed lysis buffer of redox chaperone proteins (the amount of lysis buffer added was: weigh whole cells in a 1:1:1:1:1:1:1:1:1:1:1 ratio, mix them, and the total amount of whole cells added was 10 g / L; after lysis, the required lysis buffer was obtained), and Tris-HCl buffer (pH 7.5, 50 mM) was added to a final volume of 1 mL. The mixture was then placed in a 2 mL container. In EP tubes, the reaction was carried out at 35℃ and 200 rpm for 10 min. After the reaction was completed, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was detected by HPLC. The concentrations of biliverdin produced by heme oxygenase from different sources are shown in Table 3.
[0134] Table 3. Concentrations of biliverdin produced by heme oxygenase from different sources.
[0135]
[0136] Based on the test results, the preferred heme oxygenases are ScHO, GmHO, SynHO, and CgHO; ScHO is the more preferred one.
[0137] Example 3: Screening of Chaperone Proteins
[0138] In Example 2, during the screening of heme oxygenases, the chaperone proteins used were a mixed lysis buffer of all chaperone proteins shown in Table 1 (including cytochrome P450 reductase, ferricyanide, and ferricyanide reductase). To further screen for the optimal chaperone protein, ScHO was used as a catalyst for the conversion of heme to biliverdin, and chaperone proteins from different sources were added individually for conversion experiments. There are two types of chaperone proteins: the first type consists of individual cytochrome P450 reductases with complete electron transport function; the second type consists of combinations of chaperone proteins with complete electron transport function, including ferricyanide and ferricyanide reductase. Therefore, the conversion experiments were conducted using the following two reaction systems.
[0139] System 1:
[0140] The reaction system consisted of 1 mL of heme oxygenase ScHO cell lysis buffer (10 g / L, prepared according to the method in Example 2, wherein the amount of lysis buffer added was: first weigh 10 g / L of whole cells, then break them to obtain the required lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 4 mM NADPH, and 20 g / L of cytochrome P450 reductase (prepared according to the method in Example 2, except that only E coli BL21(DE3) / pET28a(+)-CPR was added, wherein the amount of lysis buffer added was: first weigh 20 g / L of whole cells, then break them to obtain the required lysis buffer), and Tris-HCl buffer (pH 7.5, 50 mM) to a final volume of 1 mL. In an EP tube, the reaction was carried out at 35°C and 8,000×g for 10 min. After the reaction was completed, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000×g for 1 min. The supernatant was collected, and the biliverdin concentration was detected by HPLC.
[0141] System 2:
[0142] Preparation of ferric reductase lysate: Weigh the corresponding mass of wet E coli BL21(DE3) / pET28a(+)-FNR prepared in step (3) of Example 1, and sonicate them under ultrasonic conditions of 400W, 0℃, working for 2s, intermittent for 4s, and total time of 10min to obtain ferric reductase lysate.
[0143] Preparation of ferricoxane mixed lysis buffer: Weigh the corresponding mass of the wet bacterial cells E coli BL21(DE3) / pET28a(+)-Fd prepared in step (3) of Example 1, and mix the three wet bacterial cells (Glycine max, Pseudomonasputida, and Arabidopsis thaliana Fd) in equal proportions, with each bacterial cell accounting for 33.3%. The mixture was ultrasonically broken up under the conditions of 400W, 0℃, working for 2s, intermittent for 4s, and a total time of 10min to obtain the ferricoxane mixed lysis buffer.
[0144] The 1 mL reaction system contained: 10 g / L cell lysis buffer of heme oxygenase ScHO (prepared according to the method in Example 2, the amount of lysis buffer added was: first weigh 10 g / L of whole cells, then break them to obtain the required lysis buffer); 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl); 4 mM NADPH; 20 g / L of cell lysis buffer for oxoreductase based on the highest expression level PpFNR (the amount of lysis buffer added was: first weigh 20 g / L of whole cells, then break them to obtain the required lysis buffer); and 20 g / L of mixed lysis buffer for ferroredoxin (the amount of lysis buffer added was: weigh out the cells expressing Glycine max Pseudomonas putidaArabidopsis in a 1:1:1 ratio). Whole cells of Fd derived from thaliana were mixed, with a total addition amount of 20 g / L (the lysate after lysis was the corresponding amount to be added). Tris-HCl buffer (pH 7.5, 50 mM) was added to 1 mL and placed in a 2 mL EP tube. The reaction was carried out at 35 °C and 200 rpm for 10 min. After the reaction was completed, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was detected by HPLC.
[0145] The screening results of chaperone proteins are shown in Table 4.
[0146] Table 4. Concentrations of biliverdin produced by the addition of chaperone proteins from different sources.
[0147]
[0148] Based on the test results, the preferred combination is ScHO+ScCPR or ScHO+AtFNR+Fd mixed lysis buffer.
[0149] Using the preferred ScHO+AtFNR+Fd lysis buffer as a catalyst, ferricoxins were further screened. The reaction system is as follows:
[0150] 1 mL reaction system:
[0151] Cell lysis buffer for heme oxygenase ScHO (10 g / L, prepared according to the method in Example 2, the amount of lysis buffer added is: first weigh 10 g / L of whole cells, then break them to obtain the required lysis buffer), heme chloride 0.5 mM (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), NADPH 4 mM, cell lysis buffer for oxoreductase AtFNR (20 g / L, the amount of lysis buffer added is: first weigh 20 g / L of whole cells, then break them to obtain the required lysis buffer), ferroreductin based on the highest expression level GmFd, the corresponding cell lysis buffer added at 20 g / L (the amount of lysis buffer added is: first weigh 20 g / L of whole cells, then break them to obtain the required lysis buffer), Tris-HCl buffer (pH 7.5, 50 mM) added to 1 mL, placed in a 2 mL container. In an EP tube, the reaction was carried out at 35℃ and 200 rpm for 10 min. After the reaction was completed, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was detected by HPLC.
[0152] The screening results of ferroredoxin are shown in Table 5.
[0153] Table 5. Concentrations of biliverdin produced by the addition of ferricyanides from different sources.
[0154]
[0155] Based on the test results, the preferred combination is SchO+AtFNR+AtFd.
[0156] Based on all the screening results in this embodiment, the preferred combinations are ScHO+ScCPR and ScHO+AtFNR+AtFd. The more preferred combination is ScHO+ScCPR.
[0157] Example 4: Screening of biliverdin reductase
[0158] The specific steps are as follows:
[0159] In a 1 mL reaction system, biliverdin reductase cell lysis buffer was added at a concentration of 1 g / L based on RbBVR, the cell lysis buffer with the highest expression level (the amount of lysis buffer added was calculated by first weighing 1 g / L of whole cells, then lysing them to obtain the required lysis buffer). Biliverdin hydrochloride 0.5 mM, NADPH 1 mM, and Tris-HCl buffer (pH 7.5, 50 mM) were added to bring the total volume to 1 mL. The mixture was placed in a 2 mL EP tube and reacted at 35°C and 200 rpm for 10 min. After the reaction, 50 μL of the reaction solution was taken, and 950 μL of a mixture of DMSO and dichloromethane (volume ratio 5:1) was added. The mixture was centrifuged at 12,000 × g for 1 min, and the supernatant was collected. The bilirubin concentration was determined using the HPLC method described in Example 2. The screening results of biliverdin reductase are shown in Table 6.
[0160] Preparation of biliverdin reductase lysate: Weigh the corresponding mass of wet E coli BL21(DE3) / pET28a(+)-BVR prepared in step (3) of Example 1, and sonicate them under ultrasonic conditions of 400W, 0℃, working for 2s, intermittent for 4s, and total time of 10min to obtain biliverdin reductase lysate.
[0161] Table 6. Concentrations of bilirubin produced by biliverdin reductase from different sources
[0162]
[0163] Based on the test results, the preferred biliverdin reductase is MmBVR.
[0164] Example 5: Construction of truncated mutants
[0165] From the instruction manual Figure 1 It can be seen that the soluble expression levels of the selected ScHO and ScCPR proteins are not high, resulting in excessively low levels of effective catalytic components in the fermentation-harvested cells. These two proteins are membrane proteins bound to the inner mitochondrial membrane in their natural host, which is not conducive to soluble expression in the cytoplasm. Therefore, the hydrophobicity of their amino acid sequences was analyzed online using PortScale, and the results are as per the product manual. Figure 4 As shown in Table 7, amino acids 289-318 at the C-terminus of ScHO were identified as hydrophobic transmembrane peptides, as were amino acids 1-24 at the N-terminus of ScCPR. ScHO and ScCPR peptides of different truncated transmembrane peptide lengths were amplified by PCR using primers shown in Table 7, and recombinant plasmids pET28a(+)-ScHOΔ10 / 20 / 30 and pET28a(+)-ScCPRΔ8 / 16 / 24, as well as the recombinant strain E. coli BL21(DE3), were reconstructed according to the method in Example 1.
[0166] The primers involved, such as / pET28a(+)-ScHOΔ10 / 20 / 30 and E.coli BL21(DE3) / pET28a(+)-ScCPRΔ8 / 16 / 24, are shown in Table 7.
[0167] Table 7 Primers for truncated mutations and their amplification products
[0168]
[0169] Press Takara PCR amplification was performed according to the Max DNA Polymerase product instructions. Positive reactions were verified by template digestion. The specific method was the same as in Example 1, obtaining wet cells expressing ScHO and ScCPR mutants with different truncated lengths and ScHO and ScCPR mutants with the same truncated lengths. Transformation experiments were performed using the following two reaction systems to screen for the optimal ScHO and ScCPR truncated mutants.
[0170] System 1: A 1 mL reaction system was prepared by adding 10 g / L of ScHO truncated mutant cell lysis buffer (the amount of lysis buffer added was: first weigh 10 g / L of whole cells, then break them up to obtain the required amount of lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 4 mM NADPH, 50 g / L ScCPR cell lysis buffer (the amount of lysis buffer added was: first weigh 50 g / L of whole cells, then break them up to obtain the required amount of lysis buffer), and Tris-HCl buffer (pH 7.5, 50 mM) to a final volume of 1 mL. The mixture was placed in a 2 mL EP tube and reacted at 35 °C and 200 rpm for 10 min. After the reaction, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was determined by HPLC. The experimental results for different ScHO truncated mutants are shown in Table 8.
[0171] Table 8: Concentration of biliverdin produced by ScHO and truncated mutants
[0172]
[0173] Based on the test results, the preferred truncated mutant is SchOΔ30.
[0174] System 2: A 1 mL reaction system was prepared by adding 10 g / L ScCPR truncated mutant cell lysis buffer (the amount of lysis buffer added was: first weigh 10 g / L of whole cells, then break them up to obtain the required amount of lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 4 mM NADPH, 50 g / L ScHO cell lysis buffer (the amount of lysis buffer added was: first weigh 50 g / L of whole cells, then break them up to obtain the required amount of lysis buffer), and Tris-HCl buffer (pH 7.5, 50 mM) to a final volume of 1 mL. The mixture was placed in a 2 mL EP tube and reacted at 35 °C and 200 rpm for 10 min. After the reaction, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was determined by HPLC. The experimental results for different ScCPR truncated mutants are shown in Table 9.
[0175] Table 9. Concentrations of biliverdin produced by ScCPR and truncated mutants.
[0176]
[0177] Based on the test results, the preferred truncated mutant is ScCPRΔ24.
[0178] Using two preferred mutants as catalysts, the transformation experiment was carried out under the following reaction conditions:
[0179] A 1 mL reaction system was prepared by adding 10 g / L of ScHOΔ30 cell lysis buffer (the amount of lysis buffer added is: first weigh 10 g / L of whole cells, then break them to obtain the required amount of lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 4 mM NADPH, 10 g / L of ScCPRΔ24 cell lysis buffer (the amount of lysis buffer added is: first weigh 10 g / L of whole cells, then break them to obtain the required amount of lysis buffer), and Tris-HCl buffer (pH 7.5, 50 mM) to a final volume of 1 mL. The mixture was placed in a 2 mL EP tube and reacted at 35 °C and 200 rpm for 10 min. After the reaction, 50 μL of the reaction solution was taken, 950 μL of methanol was added, and the mixture was centrifuged at 12,000 × g for 1 min. The supernatant was collected, and the biliverdin concentration was determined by HPLC.
[0180] The biliverdin concentration detected in the reaction solution reached 81.4 mg / L, as per the instructions. Figure 5 As shown, the protein expression level was improved after truncation mutation.
[0181] Example 6: Construction of multi-enzyme co-expression engineered strains
[0182] By integrating multiple selected enzymes into the same strain of *E. coli*, the catalytic activity and industrial application prospects are further enhanced. The proteins to be co-expressed were identified as ScHOΔ30, ScCPRΔ24, AtFNR, AtFd, and HsBVR; to reduce the amount and cost of the coenzyme NADPH, NADP from *Azospirillum palustre* (WP_098736599.1) was additionally selected. + The formate-dependent dehydrogenase mutant ApFDH (nucleotide sequence shown in SEQ ID NO. 6) was co-expressed to achieve coenzyme cycling. Based on the screening results of Examples 2-5, the co-expression combinations were: ScHOΔ30+ScCPRΔ24+MmBVR+ApFDH, or ScHOΔ30+AtFNR+AtFd+MmBVR+ApFDH. Since integration of 4-5 with the enzyme was required, the plasmid pETDuet-1, which has two multiple cloning sites, was selected as the vector.
[0183] For ScHOΔ30+ScCPRΔ24+MmBVR+ApFDH, using pETDuet-1 and pET28a(+) containing ScHOΔ30, ScCPRΔ24, MmBVR, and ApFDH as templates, the recombinant plasmid pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH was constructed by performing four rounds of PCR using the primers shown in Table 10.
[0184] Table 10 Primers for constructing the recombinant plasmid pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH
[0185]
[0186] The recombinant plasmid was introduced into E. coli BL21(DE3) to obtain recombinant E. coli BL21(DE3) / pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH.
[0187] For ScHOΔ30+AtFNR+AtFd+MmBVR+ApFDH, based on the recombinant plasmid pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH, ScCPRΔ24 was replaced with AtFNR-AtFd. Specifically, two rounds of PCR were performed using the primers shown in Table 11 to construct the recombinant plasmid pETDuet-1-ScHOΔ30-AtFNR-AtFd-MmBVR-ApFDH.
[0188] Table 11 Primers for constructing the recombinant plasmid pETDuet-1-ScHOΔ30 / AtFNR / AtFd / MmBVR / ApFDH
[0189]
[0190] The recombinant plasmid was introduced into E. coli BL21(DE3) to obtain recombinant E. coli BL21(DE3) / pETDuet-1-ScHOΔ30-AtFNR-AtFd-MmBVR-ApFDH.
[0191] Cell culture was performed as shown in Example 1, and wet cells of the two different recombinant Escherichia coli were obtained. After being broken up, transformation experiments were carried out according to the following reaction system.
[0192] A 1 mL reaction system was prepared by adding 20 g / L of recombinant E. coli cell lysis buffer (the amount of lysis buffer added was calculated by first weighing 20 g / L of whole cells, then lysing them to obtain the required lysis buffer), 0.5 mM heme chloride (dissolved in 100 mM NaOH and adjusted to pH 7.5 with HCl), 5 mM ammonium formate, and Tris-HCl buffer (pH 7.5, 50 mM) to a final volume of 1 mL. The mixture was placed in a 2 mL EP tube and reacted at 35 °C and 200 rpm for 10 min. After the reaction, 50 μL of the reaction solution was taken and 950 μL of a mixture of DMSO and dichloromethane (volume ratio 5:1) was added. The mixture was centrifuged at 12,000 × g for 1 min, and the supernatant was collected. The bilirubin concentration was determined by HPLC. The experimental results are shown in Table 12.
[0193] Table 12 Concentrations of bilirubin synthesized by different recombinant Escherichia coli
[0194]
[0195] The test results showed that the preferred recombinant strain was E. coli BL21(DE3) / pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH.
[0196] Example 7: Recombinant Escherichia coli catalyzes the synthesis of bilirubin
[0197] Recombinant Escherichia coli BL21(DE3) / pETDuet-1-ScHOΔ30-ScCPRΔ24-MmBVR-ApFDH was used as the preferred catalyst for scale-up conversion experiments.
[0198] 1. Shaking flask experiment
[0199] (1) The substrate loading of the catalyst was first tested.
[0200] The reaction conditions were as follows: 100 mL reaction system, 20 g / L recombinant Escherichia coli cell lysis buffer (the amount of lysis buffer added is: first weigh 20 g / L of whole cells, and after lysis, it is the corresponding amount of lysis buffer to be added), the solvent is ammonium formate solution (pH 7.5, 50 mM), EDTA-Na2 2 mM, 35℃, 200 rpm.
[0201] Under the above reaction conditions, heme was added at concentrations of 0.5–4.0 mM (0.5 mM, 1 mM, 2 mM, 3 mM, 4 mM), and samples were continuously taken during the reaction. 50 μL of the reaction solution sample was added to a mixture of 950 μL of DMSO and dichloromethane (volume ratio 5:1), centrifuged at 12,000 × g for 1 min, and the supernatant was collected. The bilirubin concentration was then determined by HPLC.
[0202] The reaction results at different substrate concentrations are shown in the attached instructions. Figure 6 As shown.
[0203] The test results showed that the substrate heme had a certain inhibitory effect on the reaction process, and the heme concentration should not be too high. At a substrate loading of 1 mM, a good bilirubin yield of 402.5 mg / L was obtained, with a yield of 68.9%.
[0204] The final reaction conditions were determined as follows: 20 g / L of recombinant E. coli cell lysis buffer (the amount of lysis buffer added is: first weigh 20 g / L of whole cells, and after lysis, it is the corresponding lysis buffer to be added), 1 mM of heme, the solvent is ammonium formate solution (pH 7.5, 50 mM), 2 mM of EDTA-Na2, 35℃, 200 rpm.
[0205] 2. Upper tank experiment
[0206] The following reaction conditions were scaled up to a 5L bioreactor with a liquid volume of 2L for catalytic reaction.
[0207] Recombinant Escherichia coli cell lysis buffer 20 g / L (the amount of lysis buffer added is: first weigh 20 g / L of whole cells, break them and that is the corresponding amount of lysis buffer to be added), heme 1 mM, solvent is ammonium formate solution (pH 7.5, 50 mM), EDTA-Na2 2 mM, aeration rate 10 vvm, 35℃, 800 rpm.
[0208] The reaction process was continuously sampled, and the concentrations of bilirubin, biliverdin, and heme were detected by HPLC. The method was as follows: 950 μL of a mixture of DMSO and dichloromethane (volume ratio 5:1) was added to 50 μL of the reaction solution sample, centrifuged at 12,000 × g for 1 min, and the supernatant was collected for bilirubin concentration detection by HPLC; another 50 μL of the reaction solution sample was taken, 950 μL of methanol was added, centrifuged at 12,000 × g for 1 min, and the supernatant was collected for biliverdin concentration detection by HPLC; another 50 μL of the reaction solution sample was taken, 950 μL of NaOH (100 mM) was added, centrifuged at 12,000 × g for 1 min, and the supernatant was collected for heme concentration detection by HPLC.
[0209] The detection conditions for heme are as follows: Mobile phase: A (0.5% trifluoroacetic acid aqueous solution); B (acetonitrile:methanol = 9:1). Injection program: 0 min, 20% A, 0-30 min, 20% → 90% A, 30-31 min, 90% → 20% A, 31-35 min, 20% A. Column temperature: 40℃, chromatographic column: C18, injection volume: 5 μL, run time: 35 min, detection wavelength: 400 nm. The standard curve for heme is attached to the instruction manual. Figure 7 As shown in the attached diagram. Based on HPLC detection results, the curves showing the changes in the substrate heme, intermediate product biliverdin, and final product bilirubin in the 2L system as a function of the reaction are as indicated in the instruction manual. Figure 8 As shown in Table 13, the specific data is as follows.
[0210] Table 13. Changes in the concentrations of heme, biliverdin, and bilirubin over time during the reaction process.
[0211] 0 651 1.8 0 5 538.2 2.3 82.0 10 439.3 0.8 157.4 15 346.5 0 221.9 20 253.7 0.9 292.7 25 147.9 0.7 373.8 30 58.4 1.2 403.5 40 18.4 1.1 415.5 50 9.2 0 411.9 60 8.4 0 405.4 90 6.3 0 401.5 120 7.1 0 397.8
[0212] The results showed that the bilirubin yield reached its highest value of 415.5 mg / L after 40 min of reaction, with a yield of 71.2%.
[0213] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A recombinant Escherichia coli, characterized in that, The recombinant Escherichia coli expressed a gene derived from... Saccharomyces cerevisiae Heme oxygenase, derived from Mus musculus biliverdin reductase, derived from Azospirillum palustre NADP + Formate-dependent dehydrogenase, and also expresses enzymes derived from... Saccharomyces cerevisiae Cytochrome P450 reductase; The heme oxygenase is obtained by deleting amino acids 289-318 from the C-terminus of the heme oxygenase with NCBI accession number GHM92019.1; the biliverdin reductase has NCBI accession number XP_030102511.1; the cytochrome P450 reductase is obtained by deleting amino acids 1-24 from the N-terminus of the cytochrome P450 reductase with NCBI accession number NP_011908.1; the NADP... + The NCBI accession number for formate-dependent dehydrogenase is WP_098736599.1; The recombinant Escherichia coli used E. coli BL21(DE3) as the expression host; The recombinant Escherichia coli was expressed using pETDuet-1 as the expression vector.
2. A method for improving the bilirubin synthesis capacity of Escherichia coli, characterized in that, The method involves using *Escherichia coli* BL21(DE3) as the host cell to express a gene derived from... Saccharomyces cerevisiae Heme oxygenase, derived from Mus musculus biliverdin reductase, derived from Azospirillum palustr e's NADP + Formate-dependent dehydrogenase, and also expresses enzymes derived from... Saccharomyces cerevisiae Cytochrome P450 reductase; The heme oxygenase is obtained by deleting amino acids 289-318 from the C-terminus of the heme oxygenase with NCBI accession number GHM92019.1; the biliverdin reductase has NCBI accession number XP_030102511.1; the cytochrome P450 reductase is obtained by deleting amino acids 1-24 from the N-terminus of the cytochrome P450 reductase with NCBI accession number NP_011908.1; the NADP... + The NCBI accession number for formate-dependent dehydrogenase is WP_098736599.
1.
3. A method for the whole-cell catalytic synthesis of bilirubin, characterized in that, The method involves using heme as a substrate and the recombinant Escherichia coli or its lysate as described in claim 1 as a catalyst to catalyze the whole-cell conversion into bilirubin.
4. The method according to claim 3, characterized in that, The reaction conditions for whole-cell catalysis are: stirring speed 200 r / min, temperature 35 ℃, pH 7.5, aeration rate 10 vvm, and reaction time 1~4 h.
5. The method according to claim 4, characterized in that, The amount of heme added is 0.5~4 mM, and the amount of catalyst added is 10~40 g / L.
6. The recombinant Escherichia coli of claim 1 or the method of any one of claims 2 to 5, used in the preparation of bilirubin or products containing bilirubin.
Citation Information
Patent Citations
Recombinant strain and method for producing bilirubin through whole-cell catalysis of recombinant strain
CN114891707A
Method for improving catalytic synthesis of biliverdin by recombinant escherichia coli through enhanced electron transfer
CN114891711A