Method for constructing escherichia coli producing ergothioneine

Abstract

The application discloses a method for constructing Escherichia coli for producing ergothioneine, and comprises the following steps: A. taking Escherichia coli BW25113 as a chassis strain, knocking out or weakening an L-cysteine degradation pathway to obtain a strain A; B. making the strain A overexpress ergothioneine synthase 1 from Neurospora sp. and ergothioneine synthase 2 from Neurospora crassa to obtain an engineered Escherichia coli strain for producing ergothioneine. The application further discloses an ergothioneine synthase 1 mutant capable of improving the ergothioneine expression level of the Escherichia coli.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to a method for constructing an ergothioneine-producing bacterium, specifically a method for constructing an engineered Escherichia coli bacterium that produces ergothioneine. Background Technology

[0002] Ergothioneine (L-ergothionine, EGT), chemically known as 2-mercaptohistidine trimethyl lactone, is the only naturally occurring 2-thioimidazolium amino acid discovered to date. Due to its unique thione structure and high redox potential, ergothioneine is a natural antioxidant. In its natural state, ergothioneine mainly exists in the form of thione, making it less prone to auto-oxidation compared to other antioxidants, exhibiting higher stability and making it a more powerful antioxidant than coenzyme Q10 or idebenone. As a potent antioxidant, its antioxidant function is mainly manifested in slowing down the aging process of human cells, improving skin cell activity, preventing photoaging, reducing melanin production, and brightening the skin. Therefore, ergothioneine, as a multifunctional cell-physiological protective agent, is widely used in cosmetics, beauty products, food, beverages, and health supplements.

[0003] The preparation of ergothioneine includes chemical synthesis and biosynthesis. Chemical synthesis is complex, prone to partial or complete chiral racemization, resulting in low product yields. Furthermore, the reagents used are expensive, leading to high product costs and hindering widespread adoption. Biosynthesis has two methods: submerged fermentation using fungal mycelia and biocatalytic synthesis using genetically engineered bacteria. Submerged fermentation refers to the preparation of L-ergothioneine using fungal mycelia. While this method has low fermentation costs and is easily scalable, the yield of ergothioneine is low, and the fermentation process produces numerous byproducts that are difficult to purify, thus preventing the large-scale production of high-purity ergothioneine. For example, CN102978121A discloses that the edible fungus *Pleurotus ostreatus* catalyzes the production of ergothioneine from histidine substrates, with a substrate conversion rate of up to 70%, but the product yield was not reported; CN103184246A discloses that the large filamentous fungus *Pleurotus ostreatus* produced 51 mg / L of ergothioneine through shake-flask fermentation for 10 days; WO2015180492A1 discloses that *Pleurotus ostreatus* produced 352 mg / L of ergothioneine through fermentation in a 75L fermenter for 14 days; CN103734022A discloses that *Pleurotus ostreatus* produced a maximum 143.7 mg / L of ergothioneine through fermentation for 7–15 days.

[0004] Biocatalytic synthesis using genetically engineered bacteria is a key research direction for ergothioneine. The synthesis of L-ergothioneine using L-histidine and L-cysteine ​​catalysis by genetically engineered bacteria has low fermentation costs, relatively simple extraction processes, and is easy to scale up, showing potential for industrial application. For example, WO2017150304A1 disclosed that *Streptomyces lividans* produced 900 mg / L of ergothioneine after 7 days of fermentation; CN107250347A disclosed that genetically engineered *Aspergillus*, after genetic engineering modification, could produce 438 mg / L of ergothioneine; *Escherichia coli*, after genetic engineering modification, heterologously expressed the mycobacterial ergothioneine gene synthesis cluster, produced 640 mg / L of ergothioneine; CN106661585A disclosed that *Escherichia coli*, after genetic engineering modification, produced 12 mg / L of ergothioneine through fermentation; CN201910664772.8A disclosed that a genetically engineered bacterium using *Bacillus subtilis* 168 as a host to express a foreign gene produced 568.4 mg / L of ergothioneine; and CN111534535A disclosed that an engineered bacterium using *Rhodotorula glutinis* as a host to express a foreign gene produced 1.5 g / L of ergothioneine through fermentation. Summary of the Invention

[0005] Since *Escherichia coli* is one of the fastest-growing microorganisms and the most widely used model organism in the field of genetic engineering, developing engineered *E. coli* strains that produce ergothioneine will promote the industrial application of ergothioneine production methods through fermentation. The inventors explored the construction of engineered *E. coli* strains, altered the metabolic pathway of *E. coli* BW25113, and conducted extensive screening and experimental comparisons of related proteins (including enzymes and transporters) / gene clusters for ergothioneine synthesis. By combining ergothioneine synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1) from *Neurospora sp.* and ergothioneine synthase 2 (NcEgt2, NCBI accession number: XP_001728131.1) from *Neurospora crassa*, they finally achieved ergothioneine expression. On the other hand, in order to improve the ergothioneine expression level in engineered Escherichia coli strains, ergothioneine synthase 1 (NsEgt1) and / or ergothioneine synthase 2 (NcEgt2) were modified using targeted mutagenesis of the methyltransferase functional region, resulting in enzyme mutants and engineered Escherichia coli strains that promote ergothioneine synthesis. Specifically, the present invention includes the following technical solutions:

[0006] A method for constructing ergothionein-producing Escherichia coli includes the following steps:

[0007] A. Using Escherichia coli BW25113, MG1655 or W3110 as the substrate bacteria, with Escherichia coli BW25113 being preferred as the substrate bacteria, the L-cysteine ​​degradation pathway was knocked out or weakened to obtain strain A.

[0008] B. Overexpressing ergothionein synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1, amino acid sequence as shown in SEQ ID NO:2) or its mutant (amino acid sequence as shown in SEQ ID NO:6) from Neurospora sp. and ergothionein synthase 2 (NcEgt2, NCBI accession number: XP_001728131.1, amino acid sequence as shown in SEQ ID NO:4) from Neurospora crassa in strain A, positive clones were screened to obtain ergothionein-producing engineered Escherichia coli.

[0009] In one embodiment, step A above involves knocking out the ygeA gene (NCBI accession number: GI:446771403) and the sseA gene (NCBI accession number: GI:446030771) to obtain the BW25113-ΔYS host bacterium A.

[0010] Optionally, the knockout of the ygeA and sseA genes can be performed using CRISPR-Cas9 gene editing technology.

[0011] Step B above may involve transforming an expression plasmid of ergothioneine synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1, amino acid sequence as shown in SEQ ID NO:2) or its mutant (amino acid sequence as shown in SEQ ID NO:6) from Neurospora sp., or an expression plasmid of ergothioneine synthase 2 (NcEgt2, NCBI accession number: XP_001728131.1, amino acid sequence as shown in SEQ ID NO:4) from Neurospora crassa into competent cells of strain A.

[0012] In an optional embodiment, step B above may involve cloning the ergothioneine synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1) gene or its mutant gene from Neurospora sp. together with the ergothioneine synthase 2 (NcEgt2, NCBI accession number: XP_001728131.1) gene from Neurospora crassa into the Escherichia coli genome.

[0013] Preferably, the nucleotide sequence of the gene encoding ergothioneine synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1, amino acid sequence as shown in SEQ ID NO:2) is shown in SEQ ID NO:1; the nucleotide sequence of the gene encoding the ergothioneine synthase 1 mutant (amino acid sequence as shown in SEQ ID NO:6) is shown in SEQ ID NO:5; and the nucleotide sequence of the gene encoding ergothioneine synthase 2 (NcEgt2, NCBI accession number: XP_001728131.1, amino acid sequence as shown in SEQ ID NO:4) is shown in SEQ ID NO:3.

[0014] When NsEgt1 and NcEgt2 are expressed using plasmids, the coding gene for ergothioneine synthase 1, i.e., NsEgt1 or its mutant, and the coding gene for ergothioneine synthase 2, i.e., NcEgt2, are cloned on the same plasmid for co-expression.

[0015] Optionally, in the above plasmids, the coding genes for ergothioneine synthase 1, i.e., NsEgt1 or its mutants, and the coding genes for ergothioneine synthase 2, i.e., NcEgt2, are respectively placed under the regulation of the trc promoter.

[0016] The aforementioned plasmid vectors can be any plasmid suitable for expression in Escherichia coli, such as pET vectors pET22b, pET24a, pET28a, pSH, pTrc99a, pETDuet 1, pRSFDuet 1 plasmids, etc.

[0017] In one embodiment, the co-expression plasmid described above uses the pTrc99a plasmid as a backbone vector and the trc promoter as a promoter for gene expression. The co-expression plasmid pTrc99a-trc-NsEgt1 / mutant-trc-NcEgt2 containing NsEgt1 / mutant and NcEgt2 is constructed by gene fragment recombination.

[0018] A second aspect of the present invention provides an ergothioneine synthase mutant, which may have the amino acid sequence shown in SEQ ID NO:6, and may be named NsEgt1mut herein, which is a (E88G, K239S, V316A) mutant of NsEgt1. It should be understood that the above-mentioned ergothioneine synthase 1 mutant is not limited to the mutant NsEgt1mut with the amino acid sequence of SEQ ID NO:6, but also includes polypeptides whose amino acid sequence has 85% or more, preferably 90% or more, preferably 95% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO:6, and whose enzyme activity is increased compared to SEQ ID NO:6.

[0019] A third aspect of the invention provides a gene encoding the aforementioned ergothioneine synthase mutant NsEgt1mut.

[0020] For example, the nucleotide sequence of the NsEgt1mut encoding gene is shown in SEQ ID NO:5.

[0021] A fourth aspect of the present invention provides the use of the above-mentioned ergothioneine synthase mutant NsEgt1mut or the above-mentioned gene, such as SEQ ID NO:6, in promoting microbial production of ergothioneine; or provides the use of the above-mentioned ergothioneine synthase mutant NsEgt1mut in enzymatic synthesis of ergothioneine.

[0022] The fifth aspect of the present invention provides an ergothionein-producing bacterium, which is constructed by the method described above.

[0023] Another aspect of the present invention provides the use of the above-mentioned ergothioneine-producing bacteria in the fermentation production of ergothioneine.

[0024] In one embodiment, since histidine, methionine, and cysteine ​​are precursors for ergothioneine synthesis in both the aerobic and anaerobic biosynthetic pathways, L-histidine can be added to the fermentation medium, and L-methionine and / or L-cysteine ​​can also be added.

[0025] After fermentation by the aforementioned ergothioneine-producing bacteria, ergothioneine is extracted from the fermentation broth without the need for cell disruption treatment of the fermentation cells, which helps to reduce production costs.

[0026] This invention constructs an engineered strain of *E. coli* that produces ergothioneine using genetic engineering techniques; and through targeted mutagenesis of the NsEgt1 methyltransferase functional region, it obtains an ergothioneine synthase 1 mutant, NsEgt1mut, which can increase the expression level of ergothioneine in *E. coli*, effectively improving the L-histidine conversion rate and ergothioneine production rate, increasing the ergothioneine yield by 3.1 times to as high as 5 g / L, thus opening up a new route for the fermentation production of ergothioneine by *E. coli*. Attached Figure Description

[0027] Figure 1 This is a schematic diagram of the spectral structure of the plasmid pTrc99a-trc-NsEgt1-trc-NcEgt2 constructed in this invention.

[0028] Figure 2 This is a schematic diagram of the spectral structure of the plasmid pTargetF-ygeA-sseA constructed in this invention.

[0029] Figure 3This is a standard curve for the detection of ergothionein using a spectrophotometer.

[0030] Figure 4 This is the HPLC chromatogram of the ergothioneine product detected in this embodiment of the invention. Detailed Implementation

[0031] It is well known in the field of biology that Escherichia coli has a rapid passage rate and is one of the free-living bacteria with the shortest known generation time, making it an excellent chassis cell for constructing expression systems.

[0032] While many microorganisms, including mycobacteria, streptomyces, molds, and yeasts, possess the ability to synthesize ergothioneine, *Escherichia coli* generally cannot. Therefore, to express ergothioneine using *E. coli*, the metabolic system of *E. coli* must be genetically engineered.

[0033] One advantage of Escherichia coli as an ergothioneine producer is that most of the ergothioneine produced by the strain is secreted into the fermentation broth. As an extracellular product, ergothioneine does not require cell disruption during fermentation, which is extremely beneficial for the extraction and purification of the product ergothioneine. This eliminates the need for complex separation and extraction post-processing steps, thus reducing production costs.

[0034] Not all Escherichia coli can achieve ergothioneine biosynthesis through metabolic system modification, because different subspecies have different genetic characteristics, physiological traits, and metabolic pathways. Through metabolic pathway analysis and screening experiments, Escherichia coli BW25113 was found to be well-suited as a chassis cell for ergothioneine expression.

[0035] In addition to knocking out / weakening the L-cysteine ​​degradation pathway in Escherichia coli BW25113 by knocking out the ygeA gene (GenBank accession number: 446771403) and the sseA gene (GenBank accession number: 446030771) (step A), this invention also requires the introduction of an ergothioneine synthesis gene cluster encoding an ergothioneine synthase (system) (step B).

[0036] It should be understood that in the specific operation of constructing the genetically engineered bacteria of the present invention, the order of steps A and B is not fixed according to the English alphabetical order from front to back. They can be operated in a cross or reversed manner, as long as each step can achieve its own function and complete the directional change of the host cell genotype.

[0037] In *Nereidium crassa*, the ergothioneine synthase system includes two key enzymes, egt1 and egt2. In Fe... 2+In the presence of O2, egt1 catalyzes the synthesis of Cys-HER from HER and cysteine, and then egt2 catalyzes the conversion of Cys-HER into ergothioneine (Irani S, Naowarojna N, Tang Y, et al. Snapshots of C–S cleavage in Egt2 reveals substance specificity and reaction mechanism. Cell Chem Biol, 2018, 25(5):519-529.e4.DOI:10.1016 / j.chembiol.2018.02.002).

[0038]

[0039] However, our study found that the combination of egt1 and egt2 from *Neurospora crassa* did not promote ergothioneine synthesis in *Escherichia coli* BW25113. This may be due to significant differences in physiological characteristics and metabolic pathways between *Neurospora* and *E. coli*. Therefore, we screened and compared egt1 and egt2 and their isoenzymes from numerous microbial sources. Ultimately, we discovered that the combination of egt2 (NcEgt2, amino acid sequence SEQ ID NO:4) from *Neurospora crassa* and egt1 (NsEgt1, amino acid sequence SEQ ID NO:2) from another *Neurospora* sp. could achieve ergothioneine expression in *E. coli* BW25113.

[0040] In this document, for the sake of simplicity, the name of a protein, such as egt1, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, egt1, when used to describe enzyme function or class, refers to the protein; when used as a gene description, it refers to the gene encoding that enzyme.

[0041] The ergothioneine yield produced by the recombinant engineered strain pTrc99a-trc-NsEgt1-trc-NcEgt2 / Ecoli BW25113-ΔYS was low. Analysis suggests that increasing the enzyme activity of NsEgt1 should improve the ergothioneine expression level.

[0042] In this article, the terms "recombinant bacteria" and "(genetically) engineered bacteria (strain)" have the same meaning, referring to strains that have been genetically modified from wild-type Escherichia coli BW25113 to achieve ergothioneine expression or increase the amount of ergothioneine expression.

[0043] We attempted to use targeted mutagenesis to mutate NsEgt1, focusing on the methyltransferase functional region of NsEgt1, in order to obtain a mutant enzyme with significantly increased enzyme activity compared to the wild-type enzyme NsEgt1.

[0044] In this document, the terms "wild-type", "wild-type enzyme", and "wild-type enzyme" have the same meaning, referring to wild-type ergothioneine synthase 1 (NsEgt1, GenBank accession number: KAJ4380386.1, amino acid sequence as shown in SEQ ID NO:2). Similarly, the terms "ergothioneine synthase 1 mutant", "mutant ergothioneine synthase 1", "mutant ergothioneine synthase 1", and "mutant enzyme" have the same meaning, referring to mutants formed by mutations in individual amino acid residues in the amino acid sequence of ergothioneine synthase 1, such as SEQ ID NO:6 (NsEgt1mut). Sometimes, for the sake of convenience, wild-type enzyme NsEgt1 and its mutants such as NsEgt1mut may be collectively referred to as "ergothioneine synthase 1 (NsEgt1)" in this document, such as in the examples.

[0045] The terms “enzyme activity”, “enzyme activity”, or “enzyme synthesis activity” in this article specifically refer to the catalytic performance of an enzyme in catalyzing the production of the ergothioneine precursor S-(histidine betaine)-2-yl-L-cysteine ​​S-oxide from the substrate histidine.

[0046] In this article, the terms “(enzyme activity) increase” or “enhancement” as used above mean an increase of at least 100% compared to the reference level, such as at least about 1, at least about 2, or at least about 3, or at least about 5, or at least about 10, or at least about 20 times compared to the reference level.

[0047] Those skilled in the art should understand that the above-mentioned ergothionein synthase 1 mutant is not limited to the mutant NsEgt1mut with the amino acid sequence SEQ ID NO:6, but also includes polypeptides with an amino acid sequence that has more than 85%, preferably more than 90%, more preferably more than 95%, more preferably more than 98%, more preferably more than 99% homology with SEQ ID NO:6, and whose enzyme activity is increased compared with SEQ ID NO:6.

[0048] The term "mutation" includes, but is not limited to, the substitution, deletion, insertion, or chemical modification of amino acid residues, preferably a positive mutation, i.e., a mutation that increases enzyme activity. The substitution can be a non-conservative substitution, a conserved substitution, or a combination of both. A "conservative" amino acid substitution or mutation refers to the interchangeability of residues with similar side chains, and therefore generally includes the substitution of amino acids in a polypeptide with amino acids from the same or similar amino acid definition class. However, as used herein, if a conserved mutation can alternatively be an aliphatic to aliphatic, nonpolar to nonpolar, polar to polar, acidic to acidic, basic to basic, aromatic to aromatic, or restriction residue to restriction residue substitution, then a conserved mutation does not include hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing, or small residue to small residue substitution. As is known in the art, common examples of conservative substitutions include: substitutions between aromatic amino acids F, W, and Y; substitutions between hydrophobic amino acids L, I, and V; substitutions between polar amino acids Q and N; substitutions between basic amino acids K, R, and H; substitutions between acidic amino acids D and E; and substitutions between hydroxyl amino acids S and T. Furthermore, A, V, L, or I can be conservatively mutated to another aliphatic residue or another nonpolar residue. Exemplary conservative substitutions can be performed according to the table below, wherein amino acids belonging to the same partition in the second column can be substituted for each other, and preferably, amino acids in the same row in the third column can be substituted for each other:

[0049]

[0050] "Non-conservative substitution" refers to the substitution or mutation of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitution can be performed between, rather than within, the amino acids defined above. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the substituted region (e.g., proline replacing glycine), (b) charge or hydrophobicity, or (c) side chain volume.

[0051] "Deletion" refers to a modification of a peptide by removing one or more amino acids from a reference peptide. Deletion can include the removal of one or more amino acids, two or more amino acids, five or more amino acids, ten or more amino acids, fifteen or more amino acids, or twenty or more amino acids, up to 10% of the total number of amino acids constituting the reference enzyme, while preserving enzyme activity and / or the modified properties of the engineered aldolase. Deletion can target the interior and / or ends of the peptide. In several embodiments, the deletion can comprise a continuous segment or can be discontinuous.

[0052] "Insertion" refers to a modification of a polypeptide by adding one or more amino acids to a reference polypeptide. In some embodiments, modified engineered aldolases include inserting one or more amino acids into a naturally occurring aldolase and inserting one or more amino acids into other modified aldolase polypeptides. The insertion can be internal to the polypeptide, or at the carboxyl terminus or amino terminus. Insertions as used herein include fusion proteins as known in the art. The insertion can be a continuous amino acid segment or separated by one or more amino acids in a naturally occurring polypeptide.

[0053] The ergothioneine synthase 1 (NsEgt1 and NsEgt1mut) of the present invention has 881 amino acids, and the ergothioneine synthase 2 (NcEgt2) has 473 amino acids, with well-defined structures. Therefore, those skilled in the art can easily obtain their encoding genes, expression cassettes and plasmids containing these genes, and transformants containing the plasmids. These genes, expression cassettes, plasmids, and transformants can be obtained through genetic engineering construction methods well known to those skilled in the art.

[0054] To optimally express ergothioneine synthase 1 (NsEgt1 and NsEgt1mut) and ergothioneine synthase 2 (NcEgt2) in *E. coli*, one of the most commonly used organisms in genetic engineering, codon optimization was performed on the expression genes of these enzymes. Codon optimization is a technique that can be used to maximize protein expression in an organism by increasing the translation efficiency of genes of interest. Different organisms often exhibit a particular preference for one of a set of codons encoding the same amino acid due to mutational predisposition and natural selection. For example, in fast-growing microorganisms such as *E. coli*, optimized codons reflect the composition of their respective genomic tRNA repertoires. Therefore, in fast-growing microorganisms, low-frequency codons for amino acids can be used for high-frequency codon substitutions of the same amino acid. Thus, the expression of optimized DNA sequences is improved in fast-growing microorganisms.

[0055] For example, in order to express transaminase in Escherichia coli, the coding gene of codon-optimized NsEgt1 (SEQ ID NO:2) can be SEQ ID NO:1; the coding gene of mutant NsEgt1mut (SEQ ID NO:6) can be SEQ ID NO:5; and the coding gene of NcEgt2 (SEQ ID NO:4) can be SEQ ID NO:3.

[0056] The above-mentioned expression of the NsEgt1 encoding gene (SEQ ID NO:1), the NsEgt1mut encoding gene (SEQ ID NO:5), and the NcEgt2 encoding gene (SEQ ID NO:3) can be regulated using the trc promoter. Those skilled in the art will readily understand that the promoters regulating the expression of ergothioneine synthase 1 and ergothioneine synthase 2 can be the same or different, and include, but are not limited to, trc.

[0057] This promoter, along with the downstream NsEgt1 / NcEgt2 coding gene and the terminator, constitutes the NsEgt1 / NcEgt2 gene expression cassette. In the engineered bacteria constructed in this invention, the egt1 gene exists in the form of a gene expression cassette. In this document, the terms "ergothioneine synthase gene expression cassette," "gene expression cassette," and "expression cassette" have the same meaning and can be used interchangeably.

[0058] These genes can be constructed separately on suitable plasmids, and then the two plasmids can be transformed together into E. coli BW25113 for co-expression; alternatively, the encoding genes of NsEgt1 and NcEgt2 can be cloned into the same plasmid to form a co-expression plasmid, and then the plasmid can be transformed into E. coli BW25113 for co-expression.

[0059] For example, the pTrc99a plasmid can be used as a backbone vector to place the two genes under the regulation of the trc promoter, and a co-expression plasmid pTrc99a-trc-NsEgt1 / NsEgt1mut-trc-NcEgt2 can be constructed.

[0060] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0061] This article involves the addition amount, content and concentration of various substances. Unless otherwise specified, the percentage content mentioned refers to the mass percentage.

[0062] Example

[0063] Materials and methods

[0064] The whole genome synthesis, primer synthesis, and sequencing in this article were all completed by Suzhou Genewiz Biotechnology Co., Ltd.

[0065] The molecular biology experiments in this article, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were based on Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments when necessary.

[0066] Main culture media and solutions:

[0067] LB medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride. (LB solid medium with an additional 20 g / L agar powder.)

[0068] TB medium: 24 g / L yeast extract, 12 g / L tryptone, 16.43 g / L K₂HPO₄·3H₂O, 2.31 g / L KH₂PO₄, 5 g / L glycerol, pH 7.0-7.5. (TB solid medium with an additional 20 g / L agar powder.)

[0069] Nutrient broth medium: 10 g / L tryptone, 3 g / L beef extract, 5 g / L sodium chloride, pH 7.0. (For solid medium, add 15 g / L agar powder.)

[0070] Ergothioneine standard was purchased from Aladdin Chemical Reagent Company.

[0071] Ergothionein HPLC detection conditions: Agilent HPLC 1260 Infinity II, SB-AQ 250mm × 4.6mm, 5μm; detection wavelength 258nm; mobile phase A:B (95:5); operating temperature 40℃; flow rate 0.5ml / min; mobile phase A: 0.1% ammonium acetate; mobile phase B: acetonitrile.

[0072] Amino acid HPLC detection conditions: Waters Symmetry (250*4.6mm, 5µm) column, flow rate 1ml / min, wavelength: 338nm, column temperature: 35℃, injection volume 20µl, mobile phase A:B (40:60).

[0073] Mobile phase A: 2.72 g / L sodium acetate, 0.018% triethylamine, 0.3% tetrahydrofuran (pH 7.20).

[0074] Mobile phase B: 50% acetonitrile, 50% methanol.

[0075] Example 1: Construction of L-ergothionein-producing genetically engineered Escherichia coli

[0076] 1. Expression plasmid construction

[0077] Using the pTrc99a plasmid as a backbone vector and the trc promoter as the gene expression promoter, a co-expression plasmid pTrc99a-trc-NsEgt1-trc-NcEgt2 containing ergothioneine synthase 1 (NsEgt1) from Neurospora sp. and ergothioneine synthase 2 (NcEgt2) from Neurosporacrassa was constructed through gene fragment recombination. The steps are as follows:

[0078] Based on the amino acid sequence SEQ ID NO:2 of ergothioneine synthase 1 (NsEgt1, GenBank sequence number: KAJ4380386.1) from Neurospora sp., codon optimization was performed according to E. coli preferences, and the coding gene sequence SEQ ID NO:1 was synthesized. Using SEQ ID NO:1 as a template, NsEgt1-F and NsEgt1-R primers were used for amplification. The amplified fragment was 2646 bp in size, and the NsEgt1 fragment was prepared by gel extraction.

[0079] Based on the amino acid sequence SEQ ID NO:4 of ergothioneine synthase 2 (NcEgt2, NCBI sequence number: XP_001728131.1) from Neurospora crassa, codon optimization was performed according to E. coli preferences, and the coding gene sequence SEQ ID NO:3 was synthesized. Amplification was performed using trc-NcEgt2-F1 and ter-NcEgt2-R primers. The amplified fragment was 1480 bp in size, and the NcEgt2 fragment was prepared by gel extraction.

[0080] Using pTrc99a plasmid as a template, NsEgt1-trc-F and trc-R primers were used for amplification, resulting in a 95 bp fragment. The trc fragment was then prepared by gel extraction. Using NcEgt2 and trc fragments as templates, NsEgt1-trc-F and ter-NcEgt2-R primers were used for amplification. The amplified fragment was 1540 bp, and the trc-NcEgt2 fragment was prepared by gel extraction.

[0081] Using pTrc99a plasmid as a template, ter-F and trc-R primers were used for amplification. The amplified fragment was 4122 bp in size, and the pTrc99a vector fragment was prepared by gel extraction and recovery.

[0082] The pTrc99a vector fragment, NsEgt1 fragment, and trc-NcEgt2 fragment were transported via TransGen Biotech. The Seamless Cloning and Assembly Kit was used to reconstitute ergothioneine synthase 1 and ergothioneine synthase 2 co-expression plasmid pTrc99a-trc-NsEgt1-trc-NcEgt2. (See attached image for plasmid map.) Figure 1 .

[0083] The specific PCR operations in the above construction process are as follows:

[0084] The 50 μL PCR reaction system includes: 10 ng plasmid template, 10 pmol primer pair, 1x KOD plus buffer, 0.2 mM dNTP, 1.5 mM MgSO4, and 5 units of KOD-plus DNA polymerase.

[0085] The PCR reaction conditions were: 95℃ for 3 min; 98℃ for 10 s, 57℃ for 30 s, 68℃ for 1 min / kbp, 30 cycles; 68℃ for 10 min.

[0086] The primer sequences for plasmid construction are as follows:

[0087]

[0088]

[0089] Note: In primer names, "-F" indicates forward direction; "-R" indicates reverse direction.

[0090] 2. Construction of host strain Ecoli BW25113-ΔYS

[0091] The L-cysteine ​​degradation pathway in *E. coli* BW25113 was knocked out and weakened, specifically by knocking out the ygeA gene (GI:446771403) and the sseA gene (GI:446030771) using CRISPR-Cas9 gene editing technology. This included the following steps:

[0092] (1) Constructing the pTargetF-ygeA-sseA plasmid

[0093] Based on the gene sequences of ygeA (GI:446771403) and sseA (GI:446030771), sgRNA targeting the N20 sequence was designed. The design results are as follows:

[0094] ygeA gene N20 sequence: cctcagccagaatgtccccg

[0095] sseA gene N20 sequence: tctcagccccacgagcatgg

[0096] Using pTargetF plasmid as a template, circular PCR amplification was performed using ygeAspc and spc-R primers. A 2117 bp fragment was obtained. The PCR product was digested with Dpn I and then directly transformed into DH5α chemocompetent cells. The resulting positive clones were subjected to plasmid extraction to obtain the pTargetF-ygeA plasmid.

[0097] Using the same method, with sseAspc and spc-R primers, the pTargetF-sseA plasmid was finally obtained.

[0098] Using pTargetF-ygeA plasmid as a template, a 164bp fragment was amplified using primers ygeA-N20-EcoR-F and ygeA-N20-EcoR-R. The PCR product was digested with EcoR I, and then the ygeA-N20 fragment was prepared by gel extraction.

[0099] The pTargetF-sseA plasmid was digested with EcoRI, then treated with 1 μl of FastAP dephosphorylase, and finally the large fragment was recovered by gel extraction to prepare the pTargetF-sseA vector fragment.

[0100] The pTargetF-sseA vector fragment and the ygeA-N20 fragment were ligated using T4 DNA ligase. The ligation product was transformed into DH5α, ultimately yielding the ygeA and sseA dual-targeting sgRNA helper plasmid pTargetF-ygeA-sseA. The plasmid map is attached. Figure 2 .

[0101] The specific PCR operations in the above construction process are as follows:

[0102] The 50 μL PCR reaction system includes: 10 ng plasmid template, 10 pmol primer pair, 1x KOD plus buffer, 0.2 mM dNTP, 1.5 mM MgSO4, and 5 units of KOD-plus DNA polymerase.

[0103] The PCR reaction conditions were: 95℃ for 3 min; 98℃ for 10 s, 57℃ for 30 s, 68℃ for 1 min / kbp, 30 cycles; 68℃ for 10 min.

[0104] The primer sequences for plasmid construction are as follows:

[0105]

[0106]

[0107] (2) Construction of recombinant fragments

[0108] Preparation of ΔsseA recombinant fragment: Amplification was performed directly using primer pairs sseA-OF and sseA-OR, with primers serving as templates for each other. The PCR product was 129 bp in size. The PCR product was directly recovered using the kit and then concentrated under vacuum to a concentration exceeding 500 ng / μl before use.

[0109] Preparation of ΔygeA recombinant fragment: Amplification was performed directly using primer pairs ygeA-OF and ygeA-OR, with primers serving as templates for each other. The PCR product was 132 bp in size. The PCR product was directly recovered using the kit and then concentrated under vacuum to a concentration exceeding 500 ng / μl before use.

[0110] The specific PCR operations in the above construction process are as follows:

[0111] The 50 μL PCR reaction system includes: 50 pmol primer pair, 1x KOD plus buffer, 0.2 mM dNTP, 1.5 mM MgSO4, and 5 units of KOD-plus DNA polymerase.

[0112] The PCR reaction conditions were: 95℃ for 1 min; 98℃ for 10 s, 57℃ for 30 s, 68℃ for 20 s, 25 cycles; 68℃ for 10 min.

[0113] (3) Knockout of ygeA and sseA genes

[0114] Escherichia coli BW25113 competent cells were prepared, and then the pEcCas plasmid was transformed into Escherichia coli BW25113 by calcium chloride transformation. The pEcCas / Ecoli BW25113 bacteria were obtained by screening with kanamycin sulfate resistance plates.

[0115] To prepare electroporation competent cells of pEcCas / Ecoli BW25113 strain, 3 μl of pTargetF-ygeA-sseA plasmid, 3.5 μl of ΔsseA recombinant fragment, and 3.5 μl of ΔygeA recombinant fragment were added to 100 μl of electroporation competent cells. The electroporation conditions were: 0.2 cm electroporation cuvette, 2.5 kV, 200 ohms, and 25 μF. After electroporation, the products were incubated at 37 °C for 1 hour, and the cells were plated onto plates containing 50 μg / ml kanamycin sulfate and 50 μg / ml spectinomycin B antibody.

[0116] Colony PCR was performed using primer pairs ygeA-up480 / ygeA-dn267 and sseA-up243 / sseA-dn292, respectively. The PCR products with sizes of 767bp and 541bp were found to be from species in which both the ygeA and sseA genes were knocked out. After elimination with helper plasmids, the genetically engineered host strain Ecoli BW25113-ΔYS was finally obtained.

[0117] The primer sequences used are shown in the table below.

[0118]

[0119]

[0120] 3. Construction of L-ergothionein-producing strains

[0121] The plasmid pTrc99a-trc-NsEgt1-trc-NcEgt2 was chemically transformed into the strain Ecoli BW25113-ΔYS, ultimately yielding the strain pTrc99a-trc-NsEgt1-trc-NcEgt2 / Ecoli BW25113-ΔYS. The fermentation levels of this strain in the fermenter for ergothioneine production are shown in Table 1.

[0122] After 72 hours of fermentation in a 5L fermenter, the ergothioneine yield of strain Strain was 0.66 g / L, and after 96 hours of fermentation, the ergothioneine yield was 1.59 g / L. To further improve its ergothioneine expression level, an attempt was made to enhance the ergothioneine synthesis capacity of the strain by mutating NsEgt1 and / or NcEgt2.

[0123] Example 2: Establishment and Screening of NsEgt1 Error-Prone Mutation Library

[0124] By mutating the methyltransferase functional region of ergothioneine synthase 1 (NsEgt1), strains with increased ergothioneine expression levels were obtained.

[0125] 1. Establishment of a library of error-prone mutations

[0126] Using the pTrc99a-trc-NsEgt1-trc-NcEgt2 plasmid as a template, the methyltransferase region of NsEgt1 was mutated to construct a fault-prone random mutation library of ergothionein synthase 1 (NsEgt1). The following primer pairs were designed:

[0127] Forward primer NsEgt1-F: 5'-ATGCCGTCCGCTGAAACCATG-3',

[0128] Reverse primer NsEgt1-R1200: 5'-CGGTTTTTCCAGCAGTTCTTCCTG-3'.

[0129] Error-prone PCR reaction system: 100 ng plasmid template, 20 μM primer pair NsEgt1-F and NsEgt1-R1200, 1×Taq buffer, 0.2 mM dGTP, 1 mM dATP, 1 mM dCTP, 0.2 mM dTTP, 7 mM MgCl2, and 5 units of Taq enzyme (Thermo). PCR reaction conditions: 95℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 2 min / kbp; 25-30 cycles; 72℃ for 10 min. A 1.2 kbp random mutant fragment was recovered from the gel as a large primer (Axygen DNA Gel Recovery Kit AP-GX-50). MegaPrimer PCR was performed using KOD-plus DNA polymerase: 94℃ for 5 min; 98℃ for 20 s, 60℃ for 40 s, 68℃ for 2 min / kbp, 30 cycles; 68℃ for 10 min. The plasmid template was digested with Dpn I restriction endonuclease (Thermo Biotechnology), and then electrotransformed into Escherichia coli BW25113-ΔYS to obtain a random mutant library of NsEgt1 with more than 300 clones.

[0130] 2. Preparation of Burkholderia cepacia bacterial suspension

[0131] Burkholderia cepacia (CGMCC 1.2787) cryopreserved strain was streaked onto solid nutrient broth plates and incubated at 30°C. Single colonies were then selected and inoculated into test tubes containing 5 ml of liquid nutrient broth and incubated overnight at 30°C and 250 rpm. Subsequently, the colonies were inoculated at 1% v / v into shake flasks containing 50 ml of liquid nutrient broth and incubated at 30°C and 250 rpm for 40-48 hours. The colonies were then collected by centrifugation at 10,000 rpm and resuspended in sterile water to a concentration of 20 g / L for later use.

[0132] 3. Standard curve for the determination of ergothioneine by spectrophotometry

[0133] Ergothioneine aqueous solutions of 0 mg / L, 25 mg / L, 50 mg / L, 75 mg / L, 100 mg / L, 150 mg / L, and 200 mg / L were prepared as standards. Then, 100 μL of the standard was added to 100 μL of the bacterial suspension obtained in step 2, and the mixture was incubated at 30°C for 30 min. The supernatant was then centrifuged, and the absorbance at 315 nm was measured using a microplate reader. The standard curve is attached. Figure 3 .

[0134] 4. High-throughput screening of mutant libraries

[0135] Transformants from the mutant library were selected and inoculated into 500 μL of LB liquid medium containing 50 μg / mL kanamycin in a 96-well deep-well plate. The plate was cultured overnight. Then, 80 μL of the overnight culture was transferred to 800 μL of TB liquid medium containing 50 μg / mL kanamycin. The plate was cultured at 37°C for 3 h. Then, 0.5 mM IPTG was added, the temperature was lowered to 30°C, and the plate was cultured for 4-8 h. The culture was centrifuged at 4500 rpm for 15 min, the supernatant was discarded, and the plate was resuspended in 500 μL of transformation medium. The plate was then cultured at 30°C for 40-48 h. Transformation medium formulation: 0.1 g / L corn steep liquor, 10 g / L ammonium sulfate, 5% glucose, 5 g / L magnesium sulfate, 2.5 g / L potassium dihydrogen phosphate, 0.2 g / L ferrous sulfate, 0.05 g / L manganese sulfate, 2 g / L L-histidine, 2 g / L L-methionine, 2 g / L L-cysteine, 0.5% calcium carbonate, pH 7.0. The culture medium was centrifuged at 5000 rpm for 20 min. 100 μl of the supernatant was collected, and 100 μl of the *Burkholderia cepacia* suspension prepared in step 2 was added. The mixture was incubated at 30 °C for 30 min, then centrifuged again. The supernatant was then measured at 315 nm using a microplate reader. The absorbance was compared with a standard curve to determine the ergothionein concentration, which was used to assess the ergothionein expression level of the transformants.

[0136] High-throughput screening revealed a mutant strain, BL9-M1278, exhibiting the greatest increase in ergothioneine production. Plasmids were extracted and sequenced by Genewiz Suzhou Co., Ltd. The NsEgt1-related fragment in the genome was compared with SEQ ID NO:1 to determine the amino acid sequence changes of NsEgt1. The comparison revealed that the nucleic acid sequence of the NsEgt1-related gene fragment was SEQ ID NO:5, and the corresponding amino acid sequence was SEQ ID NO:6. This confirmed that the obtained plasmid contained three amino acid mutations in the ergothioneine synthase 1 (NsEgt1) amino acid sequence: E88G, K239S, and V316A. This ergothioneine synthase 1 mutant was named NsEgt1mut.

[0137] Example 3: Comparison of fermentation in fermenter with different strains

[0138] To verify the function of NsEgt1mut, the nucleotide sequence of the encoding gene of NsEgt1mut, SEQ ID NO:5, was synthesized according to the method in Example 1. PCR amplification was performed using SEQ ID NO:5 as a template to construct the co-expression plasmid pTrc99a-trc-NsEgt1mut-trc-NcEgt2 for ergothioneine synthase 1 mutant and ergothioneine synthase 2. The engineered bacterium pTrc99a-trc-NsEgt1mut-trc-NcEgt2 / Ecoli BW25113-ΔYS was then constructed and named BL9-M1278.

[0139] Single clones of engineered bacteria pTrc99a-trc-NsEgt1-trc-NcEgt2 / Ecoli BW25113-ΔYS and BL9-M1278 were picked and inoculated into 5 ml of LB medium containing 100 μg / ml Amp resistance. They were cultured at 37°C for 20-24 h. Then, they were transferred at a ratio of 1% v / v to LB medium containing 100 μg / ml Amp resistance and cultured at 37°C until the OD600 was approximately 1.5. Then, they were transferred at a ratio of 5% v / v to 2 L of TB medium containing 100 μg / ml Amp resistance and cultured at 37°C and 350-400 rpm until the OD600 was approximately 3. Finally, 0.2 mM IPTG was added, and the culture was continued at 30°C for 6-8 hours. Centrifuge the culture medium at 5000 rpm for 10 min, collect the bacterial cells, and resuspend the cells in an equal volume of transformation medium (transformation medium formula: 0.8 g / L corn steep liquor, 10 g / L ammonium sulfate, 10% glucose, 5 g / L magnesium sulfate, 2.5 g / L potassium dihydrogen phosphate, 0.2 g / L ferrous sulfate, 0.05 g / L manganese sulfate, 5 g / L L-histidine, 5 g / L L-methionine, 5 g / L L-cysteine, 0.5 g / L antifoaming agent, pH 7.0; feeding: 50% glucose, 3% L-histamine, 3% L-methionine, 3% L-cysteine), at 30℃, at a speed of 400-600 rpm, with aeration of 200 L / h, ammonia water to control pH 7.0-7.5, glucose maintained at 5-10 g / L, and amino acids at 1-10 g / L. After fermentation for 72-96 hours, samples were taken to test the contents of ergothioneine and L-histidine. The results are listed in Table 1.

[0140] Table 1. Comparative experiment on the fermentation production of ergothioneine by two engineered bacteria

[0141]

[0142] Experimental results showed that, compared with the engineered strain pTrc99a-trc-NsEgt1-trc-NcEgt2 / Ecoli BW25113-ΔYS expressing the wild-type enzyme NsEgt1, the engineered strain BL9-M1278 expressing the mutant enzyme NsEgt1mut increased the yield of ergothionein by 3.1 times, and the conversion efficiency of the substrate L-histidine was also significantly improved, indicating great potential for industrial application.

Claims

1. A method for constructing ergothionein-producing Escherichia coli, characterized in that, Includes the following steps: A. Using Escherichia coli BW25113 as the substrate bacteria, the ygeA gene and sseA gene were knocked out to obtain strain A, wherein the GI number of the ygeA gene is 446771403 and the GI number of the sseA gene is 446030771. B. Strain A was overexpressed with ergothioneine synthase 1 (NsEgt1) or a mutant of ergothioneine synthase 1 with the amino acid sequence shown in SEQ ID NO: 6, derived from *Neurospora* sp., and ergothioneine synthase 2 (NcEgt2) derived from *Neurosporacrassa*. Positive clones were screened to obtain ergothioneine-producing engineered *Escherichia coli* strains. The nucleotide sequence of the gene encoding ergothioneine synthase 1, i.e., NsEgt1, is shown in SEQ ID NO: 1; the nucleotide sequence of the gene encoding the mutant ergothioneine synthase 1 is shown in SEQ ID NO: 5; and the nucleotide sequence of the gene encoding ergothioneine synthase 2, i.e., NcEgt2, is shown in SEQ ID NO:

3.

2. The method as described in claim 1, characterized in that, Step B involves transforming the expression plasmid of ergothioneine synthase 1 (NsEgt1) or the ergothioneine synthase 1 mutant with the amino acid sequence shown in SEQ ID NO: 6, and the expression plasmid of ergothioneine synthase 2 (NcEgt2) into strain A cells.

3. The method as described in claim 1, characterized in that, The coding gene for ergothioneine synthase 1 or a mutant of ergothioneine synthase 1, and the coding gene for ergothioneine synthase 2, are cloned on the same plasmid and co-expressed.

4. An ergothioneine synthase mutant, characterized in that, The amino acid sequence is shown in SEQ ID NO:

6.

5. The gene encoding the ergothionein synthase mutant as described in claim 4.

6. The use of the ergothioneine synthase mutant as described in claim 4 or the gene as described in claim 5 in promoting microbial production of ergothioneine.

7. An ergothionein-producing bacterium, which is constructed by the method described in any one of claims 1-3.

8. The use of the ergothionein-producing bacteria as described in claim 7 in the fermentation production of ergothionein.

Images