Genetically engineered bacteria for synthesizing protocatechuic acid, construction method and application thereof

Abstract

The application relates to the technical field of biosynthesis of protocatechuic acid, and particularly relates to a genetically engineered bacterium for synthesizing protocatechuic acid, a construction method and application. The genetically engineered strain disclosed by the embodiment is obtained by taking bacillus licheniformis DW2 as a starting strain, introducing an expression plasmid for expressing qsuB, knocking out bsdBCD and pyk, up-regulating tkt, eno, zwf, aroA, aroB and aroC, and down-regulating aroD. The genetically engineered strain can utilize glucose to synthesize protocatechuic acid from scratch, and the raw material is green and environmentally friendly, and the price is low. The synthesis level is significantly higher than that of escherichia coli. The genetically engineered strain provides a green manufacturing method for high-level production of PCA by using a cheap culture medium, and is suitable for large-scale industrial production of protocatechuic acid.

Description

Technical Field

[0001] This application relates to the technical field of biosynthesis of protocatechuic acid, specifically to genetically engineered bacteria for synthesizing protocatechuic acid, construction methods, and applications. Background Technology

[0002] For a long time, most aromatic compounds have been produced using traditional fossil fuels. However, the consumption of fossil fuels is irreversible and pollutes the environment, prompting researchers to seek and develop new technologies for the sustainable and green production of aromatic compounds, such as biorefining, which features environmentally friendly processes and sustainable development. Protocatechuic acid (PCA) is a natural phenolic acid aromatic compound. PCA can be used as a building block for synthesizing high-performance polymers and bio-friendly plastics. PCA also possesses various pharmacological activities, such as antioxidant, anticancer, anti-inflammatory, and antiviral properties, making it a potential raw material for pharmaceuticals, functional foods, and cosmetics.

[0003] Due to the wide range of applications of PCA, its efficient production has received increasing attention in recent years. Although PCA can be directly extracted from plants such as onions, its low yield and high production cost make it unsuitable for industrial production. Chemical synthesis methods such as the demethylation of vanillic acid to produce PCA have drawbacks including environmental pollution and demanding production conditions. Therefore, microbial fermentation, with its environmental friendliness, economic feasibility, and sustainability, is one of the necessary options for the industrial production of PCA. Currently, the PCA yield from recombinant E. coli strains remains low, and the level of de novo microbial synthesis of PCA is limited, necessitating the further development of new PCA-producing strains. Summary of the Invention

[0004] The inventors of this application have creatively constructed a genetically engineered strain capable of de novo synthesis of protocatechuic acid (PCA) using Bacillus licheniformis as a microbial chassis cell. This strain can synthesize PCA de novo from glucose, using environmentally friendly and inexpensive raw materials, and achieving a significantly higher synthesis level than Escherichia coli. This genetically engineered strain provides a green manufacturing method for high-level PCA production using inexpensive culture media, suitable for large-scale industrial production of PCA. Therefore, this application discloses at least the following technical solutions:

[0005] In a first aspect, the embodiments disclose a genetically engineered strain of Bacillus licheniformis. The genetically engineered strain is obtained by transforming Bacillus licheniformis DW2 into an expression plasmid expressing qsuB, knocking out bsdBCD and pyk, upregulating tkt, eno, zwf, aroA, aroB, and aroC, and downregulating aroD.

[0006] Secondly, the embodiments disclose a method for constructing a genetically engineered strain of Bacillus licheniformis. The genetically engineered strain is obtained by transforming Bacillus licheniformis DW2 into an expression plasmid expressing qsuB, knocking out bsdBCD and pyk, upregulating tkt, eno, zwf, aroA, aroB, and aroC, and downregulating aroD. The construction method includes:

[0007] The starting strain DW2 was obtained, an expression plasmid for expressing qsuB was constructed, and the plasmid was transformed into the starting strain DW2. The first positive clone was obtained by screening. The accession number of the starting strain is CCTCCM2011344.

[0008] A first knockout plasmid for knocking out bsdBCD was constructed, and the plasmid was transferred into the first positive clone. The second positive clone was obtained by screening.

[0009] A second knockout plasmid for knocking out pyk was constructed, and the second positive clone was transferred into it. The third positive clone was then screened to obtain the third positive clone.

[0010] The first substitution plasmid for the tkt promoter replacement was constructed, transformed into the third positive clone, and screened to obtain the fourth positive clone.

[0011] A second substitution plasmid for the eno promoter was constructed, and the fourth positive clone was transformed into it. The fifth positive clone was then screened to obtain the fifth positive clone.

[0012] A third substitution plasmid with zwf promoter replacement was constructed, transformed into the fifth positive clone, and screened to obtain a sixth positive clone;

[0013] A fourth substitution plasmid with the aroA promoter replaced was constructed, transformed into the sixth positive clone, and the seventh positive clone was obtained by screening.

[0014] The fifth substitution plasmid with the aroB promoter replaced was constructed, transformed into the seventh positive clone, and the eighth positive clone was obtained by screening.

[0015] The sixth substitution plasmid with the aroC promoter replaced was constructed, transformed into the eighth positive clone, and screened to obtain the ninth positive clone;

[0016] A seventh substitution plasmid with the aroD promoter replaced was constructed, transformed into the ninth positive clone, and the genetically engineered strain of Bacillus licheniformis was obtained by screening.

[0017] Thirdly, the embodiments disclose a method for biosynthesizing protocatechuic acid, which includes:

[0018] Obtain the genetically engineered strain described in the first aspect, or the genetically engineered strain obtained by the construction method described in the second aspect;

[0019] The genetically engineered strain was inoculated into a culture medium containing glucose for fermentation;

[0020] The protocatechuic acid was recovered from the fermentation broth.

[0021] Fourthly, the embodiments disclose the application of the genetically engineered strains described in the first aspect or the genetically engineered strains obtained by the construction method described in the second aspect in the synthesis of protocatechuic acid. Attached Figure Description

[0022] Figure 1 The colony PCR verification electrophoresis results of the first positive clone (A), second positive clone (B), third positive clone (C), fourth positive clone (D), fifth positive clone (E) and sixth positive clone (F) provided for the example are shown in the figure; M: DL5000 Marker (5000, 3000, 2000, 1500, 1000, 750, 500, 250, 100bp).

[0023] Figure 2 The colony PCR verification electrophoresis results of the seventh positive clone (A), eighth positive clone (B), ninth positive clone (C), and tenth positive clone (D) provided for the example are shown in the figure; M: DL5000 Marker (5000, 3000, 2000, 1500, 1000, 750, 500, 250, 100bp).

[0024] Figure 3 The fermentation PCA results of the genetically engineered strains (P-1 and P-20) provided for the examples. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0026] Bacillus licheniformis possesses advantages such as biocompatibility, rapid growth, simple genetic manipulation, and strong stress resistance, making it an excellent microbial chassis cell factory for producing various important biochemical substances. In this application, Bacillus licheniformis was used as a microbial chassis cell to construct a genetically engineered strain capable of de novo synthesis of protocatechuic acid (PCA) using glucose as a carbon source. This genetically engineered strain can de novo synthesize PCA from glucose, using environmentally friendly and inexpensive raw materials, and achieving a significantly higher synthesis level than Escherichia coli. This genetically engineered strain provides a green manufacturing method for high-level PCA production using inexpensive culture media, suitable for large-scale industrial production of PCA.

[0027] The term "de novo synthesis" refers to biosynthesis using microorganisms as catalysts, with glucose as the primary carbon source, and the synthesis of the target product guided by glucose carbon metabolism. For example, protocatechuic acid can be synthesized via a biochemical metabolic pathway using *Bacillus licheniformis* or genetically engineered *Bacillus licheniformis* strains. The genetically engineered *Bacillus licheniformis* strain is a wild-type *Bacillus licheniformis* strain (e.g., DW2) that has been genetically modified, including modifications to the nuclear genome or extranuclear genes.

[0028] To this end, in a first aspect, embodiments disclose a genetically engineered strain of Bacillus licheniformis. This strain is derived from Bacillus licheniformis DW2 as the starting strain, by introducing an expression plasmid expressing qsuB, knocking out bsdBCD and pyk, upregulating tkt, eno, zwf, aroA, aroB, and aroC, and downregulating aroD. In some embodiments, the starting strain is the bacitracin industrial production strain Bacillus licheniformis DW2, with the strain accession number CCTCCM2011344.

[0029] In some embodiments, the nucleotide sequence of qsuB is shown in SEQ ID NO.1, the nucleotide sequence of bsdBCD is shown in SEQ ID NO.2, the nucleotide sequence of pyk is shown in SEQ ID NO.3, the nucleotide sequence of tkt is shown in SEQ ID NO.4, the nucleotide sequence of eno is shown in SEQ ID NO.5, the nucleotide sequence of zwf is shown in SEQ ID NO.6, the nucleotide sequence of aroA is shown in SEQ ID NO.7, the nucleotide sequence of aroB is shown in SEQ ID NO.8, the nucleotide sequence of aroC is shown in SEQ ID NO.9, and the nucleotide sequence of aroD is shown in SEQ ID NO.10.

[0030] Secondly, the embodiments disclose a method for constructing a genetically engineered strain of Bacillus licheniformis. The genetically engineered strain is obtained by transforming Bacillus licheniformis DW2 into an expression plasmid expressing qsuB, knocking out bsdBCD and pyk, upregulating tkt, eno, zwf, aroA, aroB, and aroC, and downregulating aroD.

[0031] The construction method includes: obtaining the starting strain DW2, constructing an expression plasmid for expressing qsuB, transforming it into the starting strain DW2, and screening to obtain a first positive clone (the preservation number of the starting strain is CCTCCM2011344); constructing a first knockout plasmid for knocking out bsdBCD, transforming it into the first positive clone, and screening to obtain a second positive clone; constructing a second knockout plasmid for knocking out pyk, transforming it into the second positive clone, and screening to obtain a third positive clone; constructing a first substitution plasmid for tkt promoter replacement, transforming it into the third positive clone, and screening to obtain a fourth positive clone; constructing a second substitution plasmid for eno promoter replacement, transforming it into the first positive clone, and screening to obtain a fourth positive clone; and constructing a second substitution plasmid for eno promoter replacement, transforming it into the first positive clone, and screening to obtain a fourth positive clone. Four positive clones were selected, and a fifth positive clone was obtained. A third substitution plasmid with the zwf promoter was constructed and transferred into the fifth positive clone, and a sixth positive clone was obtained. A fourth substitution plasmid with the aroA promoter was constructed and transferred into the sixth positive clone, and a seventh positive clone was obtained. A fifth substitution plasmid with the aroB promoter was constructed and transferred into the seventh positive clone, and an eighth positive clone was obtained. A sixth substitution plasmid with the aroC promoter was constructed and transferred into the eighth positive clone, and a ninth positive clone was obtained. A seventh substitution plasmid with the aroD promoter was constructed and transferred into the ninth positive clone, and the genetically engineered strain of Bacillus licheniformis was obtained.

[0032] In some embodiments, the expression plasmid for expressing qsuB carries the qsuB gene as shown in SEQ ID NO.1.

[0033] In some embodiments, the first knockout plasmid is a gene editing plasmid carrying a gene knockout fragment of bsdBCD.

[0034] In some embodiments, the second knockout plasmid is a gene editing plasmid carrying a gene knockout fragment of pyk.

[0035] In some embodiments, the first substitution plasmid is an expression plasmid carrying a tkt gene expression unit with the promoter replaced by PbacA.

[0036] In some embodiments, the second substitution plasmid is an expression plasmid carrying an eno gene expression unit with the promoter replaced by PUTR12.

[0037] In some embodiments, the third substitution plasmid is an expression plasmid carrying a zwf gene expression unit with the promoter replaced by PbacA.

[0038] In some embodiments, the fourth substitution plasmid is an expression plasmid carrying an aroA gene expression unit with the promoter replaced by PbacA.

[0039] In some embodiments, the fifth substitution plasmid is an expression plasmid carrying an aroB gene expression unit with the promoter replaced by PbacA.

[0040] In some embodiments, the sixth substitution plasmid is an expression plasmid carrying an aroC gene expression unit with the promoter replaced by R55.

[0041] In some embodiments, the seventh substitution plasmid is an expression plasmid carrying the aroD gene expression unit, which includes the upstream homologous arm of the aroD gene, the terminator TamyL, the promoter R47, and the downstream homologous arm of the aroD gene.

[0042] Thirdly, the embodiments disclose a method for biosynthesizing protocatechuic acid, which includes:

[0043] Obtain the genetically engineered strain described in the first aspect, or the genetically engineered strain obtained by the construction method described in the second aspect;

[0044] The genetically engineered strain was inoculated into a culture medium containing glucose for fermentation;

[0045] The protocatechuic acid was recovered from the fermentation broth.

[0046] Fourthly, the embodiments disclose the application of the genetically engineered strains described in the first aspect or the genetically engineered strains obtained by the construction method described in the second aspect in the synthesis of protocatechuic acid.

[0047] The present application will be described below with more specific embodiments, but these do not constitute a limitation on the implementation of the present application.

[0048] Example 1: Obtaining the first positive clone

[0049] In this step, the starting strain DW2 was obtained, an expression plasmid for expressing qsuB was constructed, and the plasmid was transformed into the starting strain DW2. The first positive clone was obtained through screening. The accession number of the starting strain is CCTCCM2011344. The specific steps include:

[0050] (1) Using plasmid pHY-R27-GFP (DOI:10.1016 / j.ymben.2023.06.004) and the gene qsuB of Corynebacterium glutamicum (SEQ ID NO.1) as templates, the vector pHY-R27 was amplified by PCR using primers T5-F (tgatccttcctcctttagatctg) and T5-R (aagagcagagaggacggatttcc), and the fragment qsuB was amplified by PCR using primers qsuB-F (ctaaaggaggaaggatcaatgcgtacatccattgccactg) and qsuB-R (tccgtcctctctgctcttctagttggggattccccgctcgag), and the DNA was recovered.

[0051] (2) The residual pHY-R27-GFP template in the vector backbone pHY-R27 was digested using DpnI enzyme.

[0052] (3) The vector backbone pHY-R27 and fragment qsuB were treated with the homologous recombinase (Exnase II) of Vazyme and reacted at 37℃ for 30 min to link the vector backbone pHY-R27 and fragment qsuB; the recombinant plasmid pHY-R27-qsuB was obtained.

[0053] (4) The obtained recombinant plasmid pHY-R27-qsuB was electroporated into Bacillus licheniformis DW2, and a tetracyclic antibiotic was used as a selection marker.

[0054] (5) Positive transformants were obtained by colony PCR screening using primers pHY-F (gtttattatccatacccttac) and pHY-R (cagatttcgtgatgcttgtc), which were then considered the first positive clones. The results are as follows: Figure 1 As shown in (A), it is named Bacillus licheniformis R27-qsuB-TamyL (P-1).

[0055] Example 2: Obtaining the second positive clone

[0056] In this step, a first knockout plasmid for knocking out bsdBCD is constructed, transferred into the first positive clone, and screened to obtain a second positive clone. The specific steps include:

[0057] (1) Using the sequence of the gene bsdBCD in the Bacillus licheniformis genomic DNA sequence (as shown in SEQ ID NO.2) as a template, primer pairs △bsdBCD-AF1 (ctgcagcccgggggatcctggaaaggcgttgtcgtg) and △bsdBCD-AR1 (cggatgcctccctttagattccctcttggtgcttcag) were synthesized to amplify the upstream homologous arm of bsdBCD by PCR. Primer pairs △bsdBCD-BF2 (ctgaagcaccaagagggaatctaaagggaggcatccg) and △bsdBCD-BR2 (gatcttttctacgagctccaattggctgtaccttggc) were synthesized to amplify the downstream homologous arm of bsdBCD by PCR. The upstream and downstream homologous arms of bsdBCD were then ligated together by SOE-PCR to obtain the gene knockout fragment of bsdBCD (as shown in SEQ ID NO.11).

[0058] (2) Using the plasmid T2(2)-ori (DOI:10.1007 / s00253-019-10110-y) preserved in our laboratory as a template, primers T2-T5-F (ggatcccccgggctgcaggaattc) and T2-T5-R (gagctcgtagaaaagatcaaagga) were synthesized as primer pairs, and the linear backbone fragment of T2(2)-ori was obtained by PCR amplification.

[0059] (3) The gene knockout fragments obtained in steps (1) and (2) and the linear backbone fragment of T2(2)-ori were ligated using the Nanjing Novizan one-step cloning kit. The ligation product was transformed into Escherichia coli DH5α by calcium chloride transformation. After culturing on a medium plate containing Kanr, the transformants were verified by colony PCR using the verification primers T2-F / T2-R to obtain the first knockout plasmid (named T2△bsdBCD) for knocking out bsdBCD. Then, the plasmid T2△bsdBCD was electroporated into Bacillus licheniformis DW2. After culturing on a medium plate containing Kanr, the transformants were verified by colony PCR using the verification primers T2-F(,atgtgataactcggcgta) / T2-R(gcaagcagcagattacgc).

[0060] (4) The converter obtained in step 3 is subjected to a temperature of 45°C, containing kan rThe culture was carried out three times on liquid medium, each time for 10-12 hours. Colony PCR was performed using T2-F and ΔbsdBCD-YR as verification primers. Next, the transformants were cultured several times on liquid medium at 37°C without Kanr. Colony PCR was then performed on selected transformants using double-crossover verification primers ΔbsdBCD-YF (gagtgaaagtgatggacgacc) and ΔbsdBCD-YR (cgtgttttccgtctgcgctg) to obtain strains with successful double crossover, which were considered the second positive clones. Figure 1 As shown in (B), it is named Bacillus licheniformis △bsdBCD.

[0061] Example 3: Obtaining the Third Positive Clone

[0062] In this step, a second knockout plasmid for knocking out pyk is constructed, transferred into the second positive clone, and screened to obtain a third positive clone. The specific steps are the same as in Example 2. The second knockout plasmid is a gene-editing plasmid carrying a gene knockout fragment of pyk, where the gene knockout fragment of pyk is formed by connecting the upstream and downstream homologous arms of pyk.

[0063] The sequence of the gene pyk is shown in SEQ ID NO.3. The upstream homologous arm primers for synthesizing pyk are (ctgcagcccgggggatccaccgttatcgatgccatcg) and (gccggcccaattgtacaaatcctcctcgggttttacactag), while the downstream homologous arm primers are (ctagtgtaaaacccgaggaggatttgtacaattgggccggc) and (gatcttttctacgagctccatccgacggacggcgcacaaaa). The gene knockout fragment of pyk is shown in SEQ ID NO.12.

[0064] The same T2(2)-ori plasmid was used. The primers used for PCR verification of the third positive clone were Δpyk-YF (aaagctgacagaacacgg) and Δpyk-YR (tgtgctcttcaagaagttcgc), and the verification results are as follows: Figure 1 As shown in (C), the third positive clone was named Bacillus licheniformis △pyk.

[0065] Obtaining the fourth positive clone

[0066] In this step, a first substitution plasmid for the tkt promoter is constructed, transformed into the third positive clone, and screened to obtain a fourth positive clone. Specifically, this includes:

[0067] (1) Using Bacillus licheniformis genomic DNA as a template, primers TKT-AF1(ctgcagcccgggggatccaacttgagctttccgaagcg) / AR1(ctgcagcccgggggatccaacttgagctttccgaagcg), TKT-BF2(caaaaaggagaatttttatatgaaaacgattgaattaaaatctg) / BR2(gatcttttctacgagctcttcaaatgtcccgcaagcg) and AT-F(ccaggaatatcttcaaggcgtcctgcgatttcggcgagattca) / AT-R(cagattttaattcaatcgttttcatataaaaattctcctttttg) were designed to amplify the upstream homologous arm of tkt, the downstream homologous arm of tkt, and the strong promoter PbacA (SEQ ID) respectively. As shown in NO.13), the upstream homologous arm of tkt, the promoter PbacA and the downstream homologous arm of tkt are sequentially linked together by SOE-PCR to form the tkt gene expression unit (as shown in SEQ ID NO.14).

[0068] (2) Design primers T2-T5-F (ggatcccccgggctgcaggaattc) / T2-T5-R (gagctcgtagaaaagatcaaagga), and use plasmid T2(2)-ori as a template to amplify the linear backbone fragment of T2(2)-ori by PCR.

[0069] (3) The gene knockout fragments obtained in steps (1) and (2) and the linear backbone fragment of T2(2)-ori were ligated using the Nanjing Novizan one-step cloning kit. The ligation product was then transformed into E. coli DH5α using the calcium chloride transformation method. r After culturing on culture plates, the transformants were validated by colony PCR using the verification primers T2-F / T2-R to obtain the tkt promoter replacement plasmid T2-PbacA-tkt. Then, the plasmid T2-PbacA-tkt was electroporated into Bacillus licheniformis DW2△pyk△bsdBCD, and further processed using a culture medium containing kan... r After culturing on culture medium plates, colony PCR was performed on the transformants using the verification primers T2-F / T2-R.

[0070] 4. The transformants obtained in step 3 were cultured three times at 45℃ on liquid medium containing kanamycin resistance, each time for 10-12 hours. Colony PCR was performed using T2-F and TKT-YR as verification primers. Next, the transformants were cultured several times in liquid medium at 37℃ without kanamycin. Colony PCR was performed on the selected transformants using the double crossover verification primers TKT-YF (tgcgatttcggcgagattc) / TKT-YR (agcacttcccaattcatcg) to verify the double crossover success, which is the fourth positive clone. Figure 1 As shown in (D), it is named Bacillus licheniformis PbacA-tkt(Down).

[0071] Obtaining the fifth positive clone

[0072] In this step, a second substitution plasmid for the eno promoter is constructed, transformed into the fourth positive clone, and screened to obtain a fifth positive clone. The specific steps are the same as in Example 4.

[0073] As shown in SEQ ID NO.5, primers ENO-F1 (ctgcagcccgggggatcctgaagcagcttcgcatcg) and ENO-12R1 (tatatattcctcctttctaatatacttatttttgaattaatgacg) amplify the upstream homologous arm of eno, and primers ENO-12F2 (gtatattagaaaggaggaatatataatgccatacattgttgatg) and ENO-R2 (gatcttttctacgagctcttgtgctcccatgcgaagtg) amplify the downstream homologous arm of eno. The nucleotide sequence of promoter PUTR12 is 5'-GTATATTAGAAAGGAGGAATATATA-3' as shown in SEQ ID NO.15. The upstream homologous arm of promoter eno, promoter PUTR12, and downstream homologous arm of eno are connected into one unit by SOE-PCR, which is the eno gene expression unit, and the sequence is shown in SEQ ID NO.16.

[0074] Using T2(2)-ori as the basic plasmid, the fifth positive clone was validated by PCR using the primer sequences Eno-12YF (gctttaaaggagagaaac) and Eno-YR (tgtttgaagcgcttcttcg). The validation results are as follows: Figure 1 As shown in (E), the fifth positive clone was named Bacillus licheniformis eno(Up)-PUTR12-eno(Down).

[0075] Obtaining the sixth positive clone

[0076] In this step, a third substitution plasmid with the zwf promoter replaced is constructed, transformed into the fifth positive clone, and screened to obtain a sixth positive clone. The specific steps are the same as in Example 4.

[0077] The zwf sequence is shown in SEQ ID NO.6. Primers ZWF-AF1 (ctgcagcccgggggatcctcttcacattctcgcatgg) and ZWF-AR1 (gaatctcgccgaaatcgcaggtttgactgcggggaggc) amplify the upstream homologous arm of zwf, primers ZWF-BF2 (caaaaaggagaatttttatttgaaaaaagatcaaatgg) and ZWF-BR2 (gatcttttctacgagctctctgcaccatttgctttcc) amplify the downstream homologous arm of zwf, and primers AZ-F (gcctccccgcagtcaaacctgcgatttcggcgagattc) and AZ-R (ccatttgatcttttttcaaataaaaattctcctttttg) amplify the promoter PbacA. The upstream homologous arm of zwf, the promoter PbacA, and the downstream homologous arm of zwf were sequentially linked together by SOE-PCR to form the zwf gene expression unit (SEQ ID NO.17).

[0078] Using T2(2)-ori as the basic plasmid, the sixth positive clone was validated by PCR using the primer sequences ZWF-YF (taatagtctccggcaagc) and ZWF-YR (tgtttgtccaaagcggctc). The validation results are as follows: Figure 1 As shown in (F), the sixth positive clone was named Bacillus licheniformis zwf(Up)-PbacA-zwf(Down).

[0079] Obtaining the seventh positive clone

[0080] In this step, a fourth substitution plasmid with the aroA promoter replaced is constructed, transformed into the sixth positive clone, and screened to obtain a seventh positive clone. The specific steps are the same as in Example 4.

[0081] The aroA sequence is shown in SEQ ID NO.7. Primer sequences AroA-AF1 (ctgcagcccgggggatccgatgagttgaacactg) and AroA-AR1 (tctcgccgaaatcgcaggccttatcatcggcatgttcg) are used to amplify the upstream homologous arm of aroA. Primer sequences AroA-AF2 (caaaaaggagaatttttatatgagcaacactgaacttg) and AroA-AR2 (gatcttttctacgagctccggcaagatcatactcatc) are used to amplify the downstream homologous arm of aroA. Primers AA-F (cgaacatgccgatgataaggcctgcgatttcggcgaga) and AA-R (caagttcagtgttgctcatataaaaattctcctttttg) are used to amplify the promoter PbacA. The upstream homologous arm of promoter aroA, promoter PbacA, and downstream homologous arm of aroA were sequentially linked together by SOE-PCR to form the aroA gene expression unit (SEQ ID NO.18).

[0082] Using T2(2)-ori as the basic plasmid, the seventh positive clone was validated by PCR. The primer sequences AroA-YF (ttgcctcatggaaatgcct) and AroA-YR (tggcttcttcaatatgctgcg) were used for validation. The validation results are as follows: Figure 2 As shown in (A), the seventh positive clone was named Bacillus licheniformis aroA(Up)-PbacA-aroA(Down).

[0083] Obtaining the eighth positive clone

[0084] In this step, a fifth substitution plasmid with the aroB promoter replaced is constructed, transformed into the seventh positive clone, and screened to obtain an eighth positive clone. The specific steps are the same as in Example 4.

[0085] The aroB sequence is shown in SEQ ID NO.8. Primers AB-F1 (ctgcagcccgggggatccgaatcgtcgaggtgattg) and AB-R1 (gaatctcgccgaaatcgcaggttaaaactccctcgcaagctttc) amplify the upstream homologous arm of aroB, primers AB-F2 (tcaaaaaggagaatttttatatgaaatcacttcaaatcgaaaccg) and AB-R2 (gatcttttctacgagctcaagcgtgctcaagcattcgg) amplify the downstream homologous arm of aroB, and primers AB-AF (gaaagcttgcgagggagttttaacctgcgatttcggcgagattca) and AB-AR (cggtttcgatttgaagtgatttcatataaaaattctcctttttga) amplify the promoter PbacA. The upstream homologous arm of promoter aroB, promoter PbacA, and the downstream homologous arm of aroB were sequentially linked together by SOE-PCR to form the aroB gene expression unit (SEQ ID NO.19).

[0086] Using T2(2)-ori as the basic plasmid, the eighth positive clone was validated by PCR using primers AAroB-YF (cctgcgatttcggcgagattc) and AAroB-YR (acaccatttcactgagctgg). The validation results are as follows: Figure 2 As shown in (B), the eighth positive clone was named Bacillus licheniformis PbacA-aroB(Down).

[0087] Obtaining the ninth positive clone

[0088] In this step, a sixth substitution plasmid with the aroC promoter replaced is constructed, transformed into the eighth positive clone, and screened to obtain a ninth positive clone. The specific steps are the same as in Example 4.

[0089] The aroC sequence is shown in SEQ ID NO.9. Primers AroC-AF1 (ctgcagcccgggggatccgtccaaatggagcttttttca) and AroC-AR1 (gcgaaaacataccacctatcagcttgtaaaaaatcggcatg) amplify the upstream homologous arm of aroC, primers AroC-BF2 (caaagggggagatttgtgtgaatacggttaagata) and AroC-BR2 (gatcttttctacgagctcgcaacaccagcacatctgcc) amplify the downstream homologous arm of aroC, and primers 55C-F (catgccgattttttacaagctgataggtggtatgttttcgc) and 55C-R (tatcttaaccgtattcacacaaatctccccctttg) amplify the promoter R55. The upstream homologous arm of aroC, promoter R55, and downstream homologous arm of aroC were sequentially linked together by SOE-PCR to form the aroC gene expression unit (SEQ ID NO.20).

[0090] Using the same T2(2)-ori as the basic plasmid, the ninth positive clone was validated by PCR using the primers AroC-YF (tcttcgagcacagcgcaaac) and AroC-YR (tcgtgataatcggccgcttcg). The validation results are as follows: Figure 2 As shown in (C), the ninth positive clone was named Bacillus licheniformis aroC(Up)-R55-aroC(Down).

[0091] Obtaining the tenth positive clone

[0092] In this step, a seventh substitution plasmid with the aroD promoter replaced is constructed, transformed into the ninth positive clone, and screened to obtain a tenth positive clone. The specific steps are the same as in Example 4.

[0093] The aroD sequence is shown in SEQ ID NO.10. Primers 47AD-AF1 (ctgcagcccgggggatcctctcaatatccggggacaacg) and 47AD-AR1 (aactctctccccttagcac) amplify the upstream homologous arm of aroD, and primers 47AD-BF2 (catataagaatgtcgcttctcaatgaaaccgatgtacggactg) and 47AD-BR2 (gatcttttctacgagctcagtctgcttctgcttcctg) amplify the downstream homologous arm of aroD. Amplification is terminated. Primers 47AD-TTF (gtgctaaggggagagagttaagagcagagaggacggatttcc), 47AD-TTR (gcgaaaacataccacctatcaccccgccttacctatgcg), 47AD-47F (cgcataggtaaggcggggtgataggtggtatgttttcgc), and 47AD-47R (cagtccgtacatcggtttcattgagaagcgacattcttatatg) were used to sequentially link the upstream homologous arm of aroD, the terminator TamyL, the promoter R47, and the downstream homologous arm of aroD into a single unit, which constitutes the aroD gene expression unit (SEQ ID NO.21).

[0094] Using the same T2(2)-ori plasmid as the base, the tenth positive clone was validated by PCR using the validation primers 47aroD-YF (tcttgctaaagcggccaagg) and 47aroD-YR (ttcgatgttcgggtgcatc). The validation results are as follows: Figure 2 As shown in (D), the tenth positive clone was named Bacillus licheniformis R47-aroD(Down), which is the final production strain P-20 that synthesizes protocatechuic acid de novo.

[0095] Synthesizing protocatechuic acid from scratch

[0096] This embodiment discloses a method for biosynthesizing protocatechuic acid. It includes: obtaining the genetically engineered strain described in the first aspect or the genetically engineered strain obtained by the construction method described in the second aspect; inoculating the genetically engineered strain into a glucose-containing culture medium for fermentation; and recovering the protocatechuic acid from the fermentation broth.

[0097] In some embodiments, the genetically engineered bacteria are seed-activated to obtain a seed-activated solution. Specifically, this includes: inoculating recombinant Bacillus licheniformis PCA20 (produced with high levels of protocatechuic acid) and control strain PCA1 into a 5 mL LB medium via a glycerol tube at a volume percentage of 1%, incubating at 230 rpm and 37°C for 12 hours; then, inoculating the activated bacterial solution at a volume percentage of 2% into a seed fermentation culture medium and incubating at 230 rpm and 37°C for 12 hours to obtain the seed culture solution.

[0098] In some embodiments, the seed culture of the genetically engineered bacteria is inoculated into a glucose-containing fermentation medium for fermentation. Specifically, this includes: adding 50 mL of protocatechuic acid liquid fermentation medium to a 500 mL Erlenmeyer flask, then inoculating the seed culture with the bacterial solution at an inoculation rate of 2% (volume percentage), a rotation speed of 230 r / min, a temperature of 37°C, and fermenting for 72 hours to obtain the bacterial solution produced by protocatechuic acid fermentation.

[0099] In some embodiments, protocatechuic acid is recovered from the fermentation broth. Specifically, this includes: harvesting the fermentation broth, centrifuging at 12,000 rpm for 2 min to remove bacteria, and recovering the protocatechuic acid from the supernatant obtained after centrifugation.

[0100] In one detection example, the supernatant from centrifugation was diluted appropriately with distilled water, filtered through a 0.22 μm aqueous filter membrane, and then analyzed by HPLC. Specifically, the sample was analyzed using high-performance liquid chromatography (HPLC) to detect protocatechuic acid. The detection conditions were: an Agilent 1260 HPLC system was used, with a C18 column (4.6 mm ID × 250 mm, 5 μm), a mobile phase of 100% methanol / 0.1% formic acid = 1 / 4, a flow rate of 0.6 mL / min, a column temperature of 30℃, an injection volume of 10.0 μL, a detection wavelength of 224 nm, and elution for 20 min. The yield of protocatechuic acid in the fermentation broth was calculated based on a standard curve prepared using protocatechuic acid standards. The detection results are as follows: Figure 3 As shown. The final protocatechuic acid yield of the genetically engineered strain P-20 reached 17.5 g / L, which is 10 times that of the first positive clone (P-1) and significantly higher than that of the biosynthesis method using Escherichia coli as the chassis cell (DOI:10.3389 / fbioe.2021.695704).

[0101] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A genetically engineered strain for synthesizing protocatechuic acid, wherein the genetically engineered strain is a strain obtained by transforming Bacillus licheniformis DW2 into an expression plasmid expressing the qsuB gene, knocking out the bsdBCD and pyk genes, upregulating the expression of tkt, eno, zwf, aroA, aroB, and aroC genes, and downregulating the expression of the aroD gene. The preservation number of Bacillus licheniformis DW2 is CCTCC No: M 2011344; The nucleotide sequence of the qsuB gene is shown in SEQ ID NO.1, the nucleotide sequence of the bsdBCD gene is shown in SEQ ID NO.2, the nucleotide sequence of the pyk gene is shown in SEQ ID NO.3, the nucleotide sequence of the tkt gene is shown in SEQ ID NO.4, the nucleotide sequence of the eno gene is shown in SEQ ID NO.5, the nucleotide sequence of the zwf gene is shown in SEQ ID NO.6, the nucleotide sequence of the aroA gene is shown in SEQ ID NO.7, the nucleotide sequence of the aroB gene is shown in SEQ ID NO.8, the nucleotide sequence of the aroC gene is shown in SEQ ID NO.9, and the nucleotide sequence of the aroD gene is shown in SEQ ID NO.

10. The upregulation of tkt, eno, zwf, aroA, aroB, and aroC gene expression is achieved by: replacing the promoters of tkt, zwf, aroA, and aroB genes with the PbacA promoter, thereby upregulating the expression of tkt, zwf, aroA, and aroB genes; the nucleotide sequence of the PbacA promoter is shown in SEQ ID NO. 13; replacing the promoter of the eno gene with the PUTR12 promoter, thereby upregulating the expression of the eno gene; the nucleotide sequence of the PUTR12 promoter is shown in SEQ ID NO. 15; and replacing the promoter of the aroC gene with the R55 promoter, thereby upregulating the expression of the aroC gene. The R55 promoter substitution is achieved through the aroC gene expression unit, the nucleotide sequence of which is shown in SEQ ID NO.20; The downregulation of aroD gene expression is achieved by replacing the promoter of the aroD gene with the R47 promoter, wherein the R47 promoter replacement is achieved through the aroD gene expression unit, and the nucleotide sequence of the aroD gene expression unit is shown in SEQ ID NO.

21.

2. A method for constructing the genetically engineered strain according to claim 1, wherein the genetically engineered strain is obtained by transforming Bacillus licheniformis DW2 into an expression plasmid expressing the qsuB gene, knocking out the bsdBCD and pyk genes, upregulating the expression of the tkt, eno, zwf, aroA, aroB, and aroC genes, and downregulating the expression of the aroD gene.

3. A method for biosynthesizing protocatechuic acid, comprising: To obtain the genetically engineered strain as described in claim 1 or the genetically engineered strain obtained by the construction method as described in claim 2; The genetically engineered strain was inoculated into a culture medium containing glucose for fermentation; The protocatechuic acid was recovered from the fermentation broth.

4. The application of the genetically engineered strain as described in claim 1 or the genetically engineered strain obtained by the construction method as described in claim 2 in the synthesis of protocatechuic acid.

Images