A nucleic acid aptamer targeting esophageal squamous cell carcinoma cell, a screening method and application thereof

Abstract

The application discloses a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells, a screening method and application thereof. Based on the Cell-SELEX technology, the nucleic acid aptamer EA1 which is specifically combined with the esophageal squamous cell carcinoma cells is obtained through repeated multiple rounds of screening with KYSE150 cells as positive cells and HEEC cells as reverse cells. The aptamer is a small molecule single-stranded DNA, and the sequence is 5'-ATGGCTTAGTGGCACGATTAGGTCAGGAATCG-3'. Further in-vivo and in-vitro verification shows that the EA1 aptamer has very high affinity and specificity to the esophageal squamous cell carcinoma target cells. The EA1 aptamer can be modified with fluorescence to realize targeted imaging, and can also be used as a target molecule of a nano drug carrier to realize targeted delivery of anti-tumor drugs. The EA1 aptamer has the advantages of no immunogenicity, small molecular weight, chemical synthesis, good stability and easy modification. The EA1 aptamer provides an efficient and simple molecular tool for the clinical precise diagnosis, individualized treatment, drug targeted delivery of esophageal squamous cell carcinoma and the related basic research on the occurrence, development and process of the esophageal cancer disease, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of molecular biomedicine technology, specifically to a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells, a screening method, and its application. Background Technology

[0002] Esophageal cancer is one of the most common digestive system tumors worldwide, ranking seventh in incidence and sixth in mortality among all malignant tumors. In my country, it ranks sixth in incidence and fourth in mortality. The histological classification of esophageal cancer mainly includes squamous cell carcinoma (ESCC) and adenocarcinoma (EAC). In my country, ESCC accounts for over 90% of all esophageal cancer cases. Early symptoms primarily manifest as retrosternal discomfort and burning sensation, sometimes accompanied by a slow or mild choking sensation during food passage, lasting for varying durations, or even being asymptomatic. Therefore, approximately 70% of patients present with invasive or distant metastases. Treatment for early-stage esophageal cancer primarily involves surgical resection of the lesion; however, most patients are diagnosed at an intermediate or advanced stage, and even with increased surgical resection rates, long-term efficacy remains unsatisfactory. Despite multidisciplinary treatment combining surgery, radiotherapy, chemotherapy, and immunotherapy, survival rates for intermediate and advanced-stage esophageal cancer remain unsatisfactory. Due to its poor prognosis, the 5-year survival rate for esophageal squamous cell carcinoma patients after diagnosis is only about 20%. Therefore, early diagnosis and targeted therapy of esophageal squamous cell carcinoma are of vital importance for controlling tumor development. From a genetic engineering perspective, researching and developing diagnostic and therapeutic targets related to esophageal squamous cell carcinoma can lay the foundation for its prevention and treatment.

[0003] A nucleic acid aptamer is a single-stranded RNA (ssRNA) or single-stranded DNA (ssDNA) sequence less than 100 nt in length. It is an oligonucleotide sequence that specifically binds to target cells, obtained by screening from large-capacity random RNA / single-stranded DNA libraries using Cell Systematic Evolution of Ligands by Exponential Enrichment (Cell-SELEX). Compared to traditional SELEX technology, Cell-SELEX uses live cells as the screening target, allowing for the selection of nucleic acid aptamers that specifically bind to specific tumor cells even when the specific target is unknown. This overcomes the limitation of nucleic acid aptamers obtained through purified target SELEX technology, which are insensitive to the recognition of natural targets. Compared to traditional antibodies, nucleic acid aptamers are characterized by low cost, ease of acquisition, high specificity, high affinity, high stability, and ease of chemical modification to form various molecular probes. Furthermore, aptamers are not directly recognized by the immune system (non-immunogenic), are non-toxic to humans, and readily penetrate tissue barriers and are easily internalized by target cells. They are also easily conjugated to various materials, thus showing broad application prospects in tumor imaging, diagnosis, and targeted therapy. Currently, there is an urgent need for more highly sensitive, specific, and high-affinity molecular probes in the chemotherapy of esophageal squamous cell carcinoma. Therefore, this invention proposes a nucleic acid aptamer that can target esophageal squamous cell carcinoma cells, a screening method, and its application in the detection and targeted therapy of esophageal squamous cell carcinoma. This provides an efficient and convenient molecular tool for the precise clinical diagnosis, personalized treatment, and targeted drug delivery of esophageal squamous cell carcinoma, and has broad application prospects. Summary of the Invention

[0004] Based on Cell-SELEX technology, this invention uses KYSE150 cells as the forward cells and HEEC cells as the reverse cells. Through repeated rounds of screening, a nucleic acid aptamer EA1 that can bind to esophageal cancer live cells with high specificity and high affinity was obtained, providing an efficient and convenient molecular tool for the clinical precision diagnosis, personalized treatment and targeted drug delivery of esophageal squamous cell carcinoma.

[0005] One objective of this invention is to provide a nucleic acid aptamer that can specifically bind to esophageal squamous cell carcinoma cells; another objective is to provide a method for screening the nucleic acid aptamer EA1; and a third objective is to provide applications of the above-mentioned nucleic acid aptamer.

[0006] To achieve the above objectives, the present invention employs the following technical solution: a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells, wherein the nucleic acid aptamer is an oligonucleotide aptamer EA1, composed of one of the following sequences:

[0007] (1) The nucleotide sequence shown in SEQ ID No. 1;

[0008] (2) A sequence extending from the nucleotide sequence shown in SEQ ID No. 1 to the 3' end or 5' end;

[0009] (3) A sequence with the same function formed by inserting, replacing or deleting the nucleotide sequence shown in SEQ ID No.1.

[0010] A derivative of oligonucleotide aptamer EA1, wherein the oligonucleotide aptamer EA1 derivative is formed by chemically modifying the base sequence of oligonucleotide aptamer EA1, or by attaching at least one of the following substances to the 5' or 3' end of the aptamer EA1: fluorescent label, radioactive substance, therapeutic substance, biotin, digoxigenin, luminescent nanomaterial, small peptide, siRNA, and enzyme label.

[0011] Furthermore, oligonucleotide aptamer EA1 or oligonucleotide aptamer EA1 derivatives have high affinity and specificity for esophageal squamous cell carcinoma target cells or tissues.

[0012] A method for screening nucleic acid aptamers targeting esophageal squamous cell carcinoma cells, wherein the oligonucleotide aptamer EA1 is obtained through whole-cell index-enriched ligand system evolutionary technology, includes the following steps:

[0013] Step 1: Library construction and related primer design:

[0014] The library used for screening was a single-stranded DNA library with a total ssDNA length of 79nt, a 32nt random sequence in the middle, and a 23nt and a 24nt primer sequence at the 5' end and 3' end, respectively, which can be represented as: 5'AGCCTAAGCCTGTCCAGGAATCG-32N-ATGGCTTAGTGGCACGATTAGGTC3';

[0015] During library preparation, all single-stranded DNA forward primers were fitted with FAM fluorescent dye at their 5' ends to facilitate subsequent flow cytometry assays of binding activity. This can be represented as follows:

[0016] 5'FAM AGCCTAAGCCTGTCCAGGAATCG3'

[0017] All DNA single-stranded reverse primers have a biotinylated label at the 5' end to facilitate the separation of the sense and antisense strands via streptavidin-modified agarose beads for subsequent screening, which can be represented as:

[0018] 5'Biotin GACCTAATCGTGCCACTAAGCCAT3';

[0019] Step 2: Cell-SELEX Screening:

[0020] During the initial screening process from round 1 to round 4, the ssDNA library was dissolved in binding buffer, heated at 95°C for 5 min to denature it, and then quickly placed on ice. Afterwards, it was incubated with target cells (KYSE150) at 4°C for 60 min. After incubation, the ssDNA that had not bound to the target cells was eluted with washing buffer once, and the bound ssDNA was collected. Using the ssDNA library in the supernatant as a template, double-stranded DNA was amplified by PCR, and then asymmetric PCR was performed using this dsDNA as a template to generate ssDNA.

[0021] During the 5th to 8th rounds of rescreening, the same method was used, but the incubation time under pressure screening conditions was changed to 45 minutes.

[0022] During the 9th to 12th rounds of rescreening, the same method was used, except that the incubation time under pressure screening conditions was changed to 45 minutes and the elution was performed twice.

[0023] During the 13th to 20th rounds of rescreening, the same procedure was followed, except that the incubation time under the pressure screening conditions was changed to 30 min, and the cells were eluted twice. In rounds 14, 16, and 18, HEEC cells were used as control cells for reverse screening. Specifically, HEEC cells and the ssDNA library were incubated at 4°C for 30 min, and the ssDNA bound to the control cells was eluted with washing buffer. The unbound ssDNA was collected. After the screening products were enriched, the selected ssDNA was cloned and sequenced.

[0024] Step 3: Filter the enrichment results:

[0025] During the screening and enrichment process, the effectiveness of screening or enrichment was assessed every 5 rounds for the screened or enriched ssDNA. The enrichment products were tested to see if they reached saturation. For the enriched products that reached saturation, high-throughput sequencing was performed. After obtaining the sequencing results, multiple oligonucleotide aptamer sequences were comprehensively screened out through repeat count analysis, homology analysis, and phylogenetic tree analysis. By performing sequence alignment and homology analysis on these oligonucleotide aptamer sequences, the oligonucleotide aptamer EA1 with the highest affinity for KYSE150 esophageal squamous cell carcinoma cells was identified.

[0026] Furthermore, during the first to 20th rounds of rescreening in step 2, the screening or enrichment results are monitored and controlled by electrophoresis in real time.

[0027] Furthermore, in step 3, the specific steps for testing whether the enriched products have reached saturation are as follows: 250 nM ssDNA is incubated with target cells KYSE150 and control cells HEEC at 4°C for 45 min, respectively, and then eluted in binding buffer. The fluorescence value of the initial library is used as a control, and then the FAM fluorescence value of the library bound to the cells is detected by flow cytometry to determine whether the enrichment is saturated.

[0028] Furthermore, the secondary structure of the determined EA1 obtained in step 3 is simulated and analyzed using mFold software.

[0029] A method for preparing the above-mentioned nucleic acid aptamer targeting esophageal squamous cell carcinoma cells, characterized in that: the oligonucleotide aptamer EA1 is obtained by in vitro chemical synthesis or by PCR amplification or other molecular biological methods.

[0030] Application of an oligonucleotide aptamer EA1 or an oligonucleotide aptamer derivative of EA1 in any of the following aspects:

[0031] (1) Prepare targeted drugs that specifically target esophageal squamous cell carcinoma cells or tissues;

[0032] (2) Preparation of diagnostic reagents specifically for esophageal squamous cell carcinoma;

[0033] (3) Prepare reagents for the detection of biomarkers for esophageal squamous cell carcinoma.

[0034] Further research on biomarker detection for esophageal squamous cell carcinoma includes basic research related to the occurrence, development, and progression of esophageal cancer.

[0035] Beneficial effects

[0036] 1. Based on Cell-SELEX technology, this invention provides a nucleic acid aptamer that targets esophageal squamous cell carcinoma cells or tissues, exhibiting extremely high affinity and specificity.

[0037] 2. The nucleic acid aptamers provided by this invention have the advantages of being able to be synthesized in vitro, being non-immunogenic, having small molecular weight, good stability, and being easy to modify.

[0038] 3. The nucleic acid aptamer provided by this invention can provide an efficient and convenient molecular tool for the precise clinical diagnosis, personalized treatment and targeted drug delivery of esophageal squamous cell carcinoma, and has broad application prospects. Attached Figure Description

[0039] Figure 1 This is an electrophoresis monitoring graph showing the enrichment of the library in the embodiment.

[0040] Figure 2The diagram shows the Cell-SELEX screening process (a) and the sequence statistics of the DNA strands obtained from the screening (b).

[0041] Figure 3 This is a flow cytometry diagram showing the binding of aptamers to KYSE150 esophageal cancer cells and HEEC normal esophageal epithelial cells (ab: binding of aptamers to KYSE150 esophageal cancer cells; cd: binding of aptamers to HEEC normal esophageal epithelial cells).

[0042] Figure 4 This is a schematic diagram of the secondary structure of EA1 and EA2 in the embodiment.

[0043] Figure 5 This is a schematic diagram showing the changes in the dissociation constant Kd of EA1 and EA2 with the target cell KYSE150 in the embodiment.

[0044] Figure 6 This is a graph showing the results of flow cytometry analysis of the binding specificity of EA1 and EA2 with different cells in this invention.

[0045] Figure 7 This is a flow cytometry analysis of the non-specific binding of EA1 and EA2 to peripheral blood cells in this invention, as shown in the figure.

[0046] Figure 8 These are fluorescence images showing the binding of EA1 and EA2 to target cells KYSE150 in this invention at different incubation temperatures.

[0047] Figure 9 This is a fluorescence image showing the binding of EA1 and EA2 with esophageal cancer tissue from a patient in this invention.

[0048] Figure 10 This is a diagram showing the tumor targeting analysis in EA1 mice in the example. Detailed Implementation

[0049] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present application, and not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application.

[0050] Example 1: Screening of oligonucleotide aptamers EA1 based on Cell-SELEX technology

[0051] Step 1: Library construction and related primer design

[0052] The screening library used was a single-stranded DNA (ssDNA) library with a total length of 79 nt, including a 32 nt random sequence in the middle, and primer sequences at the 5' and 3' ends of 23 nt and 24 nt respectively, which can be represented as: 5'AGCCTAAGCCTGTCCAGGAATCG-32N-ATGGCTTAGTGGCACGATTAGGTC 3'; N represents the four bases ATCG. The upstream primer is 5'AGCCTAAGCCTGTCCAGGAATCG 3', and the downstream primer is 5'GACCTAATCGTGCCACTAAGCCAT 3'.

[0053] During library preparation, all single-stranded DNA forward primers were fitted with FAM fluorescent dye at their 5' ends to facilitate subsequent flow cytometry assays of binding activity. This can be represented as follows:

[0054]

[0055] All DNA single-stranded reverse primers have a biotinylated label at the 5' end to facilitate the separation of the sense and antisense strands via streptavidin-modified agarose microbeads for subsequent screening, which can be represented as follows:

[0056] 5'Biotin GACCTAATCGTGCCACTAAGCCAT 3';

[0057] Library construction and primer synthesis were both completed by Shanghai Sangon Biotech Co., Ltd.

[0058] Step 2: Cell-SELEX Screening

[0059] Forward selection: Dissolve the ssDNA library (2.5 μM) in 1 mL binding buffer (1 L PBS with 4.5 g glucose, 100 mg tRNA, 1 g BSA, and 5 mL 1 M MgCl2), heat at 95 °C for 5 min to denature, and immediately place on ice. Take target cells (KYSE150, 100 × 20 mm culture dish) and wash twice with washing buffer (1 L PBS with 4.5 g glucose and 5 mL 1 M MgCl2). Add the ssDNA library to the dish and incubate at 4 °C for 60 min. Wash three times with washing buffer, add 500 μL of DNase-free water, scrape off cells and transfer to 1.5 mL EP tubes. Heat at 95 °C for 10 min, centrifuge at 13000 g for 5 min, collect the supernatant, and use the ssDNA library in the supernatant as a template for PCR amplification to generate dsDNA. Then, use this dsDNA as a template for asymmetric PCR amplification to generate ssDNA.

[0060] Reverse selection: The ssDNA library obtained from the previous forward selection was incubated with HEEC control cells at 4°C for 30 min. The ssDNA bound to the control cells was eluted with washing buffer, and the unbound ssDNA was collected. This unbound ssDNA was then incubated with KYSE150 target cells for 1 h. Finally, the ssDNA library bound to KYSE150 was collected using the same method. This ssDNA library was then used as a template for PCR amplification before proceeding to the next round of selection.

[0061] During the first to fourth rounds of preliminary screening, positive screening and stress screening were conducted under incubation conditions of 60 minutes, followed by one elution.

[0062] The same procedure was followed during the fifth to eighth rounds of rescreening. To obtain nucleic acid aptamers with high affinity and specificity, the screening pressure was gradually increased during the experiment, and the incubation time under the pressure screening conditions was changed to 45 min.

[0063] During the 9th to 12th rounds of rescreening, the same procedure was followed, except that the incubation time under pressure screening conditions was changed to 45 minutes, and the elution was performed twice.

[0064] In rounds 13 to 20 of the rescreening process, the same procedure was followed, except that the incubation time under pressure screening conditions was changed to 30 minutes, with two elutions. Rounds 14, 16, and 18 used HEEC cells as control cells for reverse screening. To further reduce the non-specific binding of ssDNA aptamers to normal blood cells, in the final round of screening, ssDNA non-specifically bound to normal human peripheral blood cells was removed. After enrichment of the screening products, the selected ssDNA was cloned and sequenced.

[0065] Step 3: Monitoring during the enrichment process

[0066] Real-time electrophoresis monitoring and quality control were performed on the screening or enrichment results, and the results were as follows: Figure 1 As shown.

[0067] Step 4: Filter the enrichment results

[0068] As positive and negative selection progressed, and the number of enrichment rounds increased, the enriched products were subjected to high-throughput sequencing. After obtaining the sequencing results, multiple oligonucleotide aptamer sequences were comprehensively screened using repeat count analysis, homology analysis, and phylogenetic analysis. Sequence alignment and homology analysis of these oligonucleotide aptamer sequences identified the five most abundant oligonucleotide aptamers EA1-EA5, as shown in SEQ ID No. 1-SEQ ID No. 6. The statistical results of the sequencing of the screened DNA strands are as follows: Figure 2 As shown. The five aptamers and their affinity verification with target and control cells are as follows. Figure 3As shown in the figure. EA1 and EA2 showed the best affinity, and the sequencing results are as follows:

[0069] EA1: 5'ATGGCTTAGTGGCACGATTAGGTCAGGAATCG 3'

[0070] EA2: 5'TGCAGCCATAGCCTAAGCCTGTCCAGGAATCG 3'

[0071] The secondary structure of the determined EA1 was simulated and analyzed using mFold software, and the results are as follows: Figure 4 As shown.

[0072] Example 2: Determination of the dissociation constant Kd (i.e., affinity) of EA1, EA2, and KYSE150 cells.

[0073] KYSE150 cells were incubated with seven different concentrations (concentration gradients: 0 nM, 50 nM, 100 nM, 150 nM, 200 nM, 250 nM, and 300 nM) of EA1 and EA2 aptamers at 4°C for 45 min. After incubation, fluorescence values ​​were detected by flow cytometry. The Mean FI value measured by flow cytometry was plotted on the ordinate, and the concentration on the abscissa. The dissociation curve was simulated using the single-point adsorption equation Y = BmaxX / (Kd+X), and the equilibrium dissociation constants of EA1 and EA2 binding to target cells were determined. The results are as follows: Figure 5 As shown, the dissociation constant of EA1 is 23.9 ± 3.3 nM, and the dissociation constant of EA2 is 12.8 ± 3.1 nM.

[0074] Example 3: Specificity analysis of EA1 and EA2 binding to target cells

[0075] 500 nM FITC-labeled EA1 and EA2, which have the highest affinity for target cells, were used to incubate 500 nM of binding buffer at 37°C for 1 h with tumor cells including esophageal squamous cell carcinoma KYSE30, EC9706, KYSE410, colorectal cancer SW620, glioma U87MG and U251, non-small cell lung cancer A-549, skin squamous cell carcinoma A431, and lymphocytic leukemia Nalm-6, as well as peripheral blood from healthy individuals. After washing three times with washing buffer, flow cytometry was performed, and the mean fluorescence intensity was analyzed using FlowJo 7.6.1. The results are as follows: Figure 6 and Figure 7As shown in the figure, the results indicate that EA1 and EA2 aptamers also exhibit good affinity for esophageal squamous cell carcinoma cells KYSE30, KYSE410, and Eca9706; conversely, they show very low affinity for tumor cells such as colorectal cancer, glioma, non-small cell lung cancer, squamous cell carcinoma of the skin, and lymphocytic leukemia. Furthermore, EA1 and EA2 show extremely weak affinity for peripheral blood lymphocytes, monocytes, and neutrophils. These results suggest that EA1 and EA2 possess good specificity for esophageal cancer cells.

[0076] Example 4: Temperature Investigation of EA1 and EA2

[0077] During the experiment, the incubation temperature directly affects the binding of cells to nucleic acid aptamer A2. Therefore, the inventors investigated the incubation temperatures at which EA1 and EA2 bound to KYSE150 and HEEC cells. In existing technologies (as shown in the previous screening and enrichment process), cells are typically incubated at 4°C to avoid endocytosis. In this experiment, after collecting cells into centrifuge tubes, we added FITC-labeled nucleic acid aptamers EA1 and EA, respectively, and incubated them at 4°C and 37°C. The results were observed using a fluorescence microscope. Figure 8 As shown, EA1 and EA2 did not bind to normal esophageal epithelial cells with increasing temperature, while the fluorescence intensity of EA1 and EA2 binding to KYSE150 cells decreased. However, at 37℃, EA1 and EA2 still showed good binding ability to KYSE150 cells, indicating that this nucleic acid aptamer has the potential for in vivo application.

[0078] Example 5: Investigation of the binding of EA1 and EA2 with esophageal cancer tissue from patients

[0079] Using esophageal cancer tissue and adjacent tissue from patients as the detection subjects, and FITC-labeled EA1 and EA2 as detection probes, the detection ability of EA1 and EA2 in esophageal cancer tissue from patients was investigated. Paraffin-embedded tissue sections from patients were pretreated to repair antigens, and then incubated with EA1 and EA2 in binding buffer at 4°C for 45 min. Unbound A2 was removed by washing twice with PBS, and imaging was performed using confocal microscopy. Results are as follows: Figure 9 As shown, EA1 and EA2 can bind significantly to esophageal cancer tissue, but hardly bind to adjacent tissue, indicating that EA1 and EA2 nucleic acid aptamers have good detection capabilities for esophageal cancer tissue and have great potential in the clinical diagnosis of esophageal cancer.

[0080] Example 6: Targeting of EA1 and EA2 in tumor-bearing mice

[0081] An esophageal squamous cell carcinoma subcutaneous tumor-bearing model (KYSE150) was constructed. Cy5.5-labeled aptamers were injected via the tail vein. The aggregation and distribution of the aptamers at the tumor site were analyzed using a small animal in vivo imaging system to assess their tumor targeting. Results are as follows: Figure 10 As shown, the tumors, liver, and kidneys of subcutaneously tumor-bearing mice showed significant fluorescence signals, while the lungs, heart, and spleen showed almost no signal, indicating that aptamer EA1 can target tumor sites and is mainly metabolized by the liver and kidneys.

Claims

1. A nucleic acid aptamer targeting esophageal squamous cell carcinoma cells, characterized in that: The nucleic acid aptamer is the oligonucleotide aptamer EA1, and its nucleotide sequence is: 5'-AGCCTAAGCCTGTCCAGGAATCG-ATGGCTTAGTGGCACGATTAGGTCAGGAATCG-ATGGCTTAGTGGCACGATTAGGTC-3'.

2. A derivative of a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 1, characterized in that: The derivative is a derivative of oligonucleotide aptamer EA1, wherein at least one of the following substances is attached to the 5' or 3' end of oligonucleotide aptamer EA1: fluorescent label, radioactive substance, biotin, digoxigenin, enzyme label.

3. The nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 1, or a derivative of the nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 2, characterized in that: The oligonucleotide aptamer EA1 or its derivatives have high affinity and specificity for esophageal squamous cell carcinoma cells or tissues.

4. A method for preparing a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 1, characterized in that: The oligonucleotide aptamer EA1 was obtained by in vitro chemical synthesis or by PCR amplification.

5. The use of a nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 1 or a derivative of the nucleic acid aptamer targeting esophageal squamous cell carcinoma cells according to claim 2 in the preparation of a diagnostic reagent for the specific diagnosis of esophageal squamous cell carcinoma.

Images