Application of rice tillering regulation gene OsMAB and protein coded by the same

CN117512001BActive Publication Date: 2026-09-15CHINA NAT RICE RES INST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311661896.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-06
Publication Date
2026-09-15
Estimated Expiration
2043-12-06

AI Technical Summary

Benefits of technology

[0019](1) This invention knocks out the OsMAB gene in Japanese rice using CRISPR/Cas9 technology to obtain the osmab mutant. By interpreting the function of the OsMAB gene, the genetic mechanism and mechanism of tiller number regulation in plants, especially grasses, are further elucidated, providing a new approach for the regulation of rice tiller number and the regulation of rice yield and the improvement of ideal rice plant type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117512001B_ABST
    Figure CN117512001B_ABST
Patent Text Reader

Abstract

The application discloses a rice tillering regulation gene OsMAB and application of a protein coded by the gene, and the gene and the protein are used for regulating tiller number of rice, a nucleotide sequence of the gene is shown in Seq ID No:1, an amino acid sequence of the protein is shown in Seq ID No:2, and the gene can also be used for tiller phenotype marker breeding. The application further discloses a mutant gene of the rice tillering regulation gene OsMAB and application thereof. The application knocks out the OsMAB gene in Nipponbare rice through CRISPR / Cas9 technology, obtains an osmab mutant, further clarifies a tiller number regulation genetic mechanism and an action mechanism of plants, in particular, gramineous plants, through function interpretation of the OsMAB gene, and provides a new way for tiller number regulation of rice, yield regulation of rice based on the tiller number regulation, and modification of an ideal plant type of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to the application of a rice tillering regulatory gene OsMAB and its encoded protein. Background Technology

[0002] Rice (Oryza sativa. L.) is one of my country's important food crops. Rice yield is mainly determined by the number of effective tillers, the number of grains per panicle, and the grain weight. Tillering is a unique branching phenomenon that occurs during the growth and development of rice. The number of tillers directly determines the number of panicles and the number of grains per panicle, and is also an important indicator of rice plant architecture and adaptability. Currently, genes related to rice tillering, such as MOC1, MOC3 / TAB1, LAX1, and LAX2, have been cloned.

[0003] Cloning rice tillering-related genes allows for the study of their functions and regulatory mechanisms, providing a theoretical basis and valuable gene resources for cultivating ideal plant architecture, increasing grain yield, and ensuring food security. Therefore, discovering more new rice tillering-related genes is indeed one of the important research topics at present. Summary of the Invention

[0004] The technical problem to be solved by this invention is to discover a new gene related to the regulation of rice tillering and the protein it encodes, and to develop related applications based on this.

[0005] This invention uses CRISPR / Cas9 technology to knock out the OsMAB gene in Nipponbare rice to obtain the osmab mutant. Through functional interpretation of the OsMAB gene, it is demonstrated that the OsMAB gene and protein play a role in regulating the number of rice tillers, and related applications have been developed based on this.

[0006] On one hand, the present invention provides an application of the rice tillering regulatory gene OsMAB, which is used to regulate the number of tillers in rice, and the nucleotide sequence of the gene is shown in (a) or (b):

[0007] (a) Genomic nucleotide sequence shown in Seq ID No: 1;

[0008] (b) A mutant gene, allele, or derivative that encodes the same regulation of rice tiller number by adding and / or substituting and / or deleting one or more nucleotides in the nucleotide sequence shown in (a).

[0009] As a further improvement to the present invention, the number of tillers in rice is increased through transgenic or hybridization.

[0010] Furthermore, rice cells are transformed with the gene, a plasmid containing the gene, a plant expression vector containing the gene, or a host cell containing the gene, and then the transformed rice cells are cultivated into plants to increase the number of tillers in rice.

[0011] Furthermore, the number of tillers in rice can be reduced through gene mutations, such as gene knockout.

[0012] On the other hand, the present invention also provides an application of a protein encoded by the rice tillering regulatory gene OsMAB, said protein being used to regulate the number of tillers in rice, the amino acid sequence of said protein being shown in (A) or (B):

[0013] (A) The amino acid sequence shown in Seq ID No: 2;

[0014] (B) A protein derived from (A) with the addition and / or substitution and / or deletion of one or more amino acids in the amino acid sequence defined in (A) and having the same function of regulating the number of rice tillers.

[0015] In another aspect, the present invention also provides a mutant gene of rice tillering regulatory gene OsMAB, wherein the mutant gene is based on the genomic nucleotide sequence shown in Seq ID No:1, with a deletion of G at position 203 or a deletion of GT at positions 203-204.

[0016] In addition, the present invention also provides a mutant gene of the above-mentioned rice tillering regulatory gene OsMAB, or the protein encoded by the mutant gene, or a plasmid containing the mutant gene, or a plant expression vector containing the mutant gene.

[0017] Furthermore, the present invention also provides the application of the mutant gene of the rice tillering regulatory gene OsMAB, or the protein encoded by the mutant gene, or a plasmid containing the mutant gene, or a plant expression vector containing the mutant gene, or a host cell containing the mutant gene, in reducing the number of rice tillers. The host cell is an Escherichia coli cell, an Agrobacterium cell, or a plant cell.

[0018] In addition, the present invention provides an application of the rice tillering regulatory gene OsMAB, characterized in that the application is for tillering phenotypic marker breeding; the nucleotide sequence of the gene is shown as Seq ID No: 1.

[0019] (1) This invention knocks out the OsMAB gene in Japanese rice using CRISPR / Cas9 technology to obtain the osmab mutant. By interpreting the function of the OsMAB gene, the genetic mechanism and mechanism of tiller number regulation in plants, especially grasses, are further elucidated, providing a new approach for the regulation of rice tiller number and the regulation of rice yield and the improvement of ideal rice plant type.

[0020] (2) The genes that can affect the number of rice tillers in this invention can also be used as tiller phenotype markers for breeding. Attached Figure Description

[0021] The above is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0022] Figure 1 Phenotypic diagrams of wild-type and osmab mutants;

[0023] Figure 2 The plot shows the phenotypic differences in tiller number between wild-type and osmab mutants; where NIP represents wild-type Nipponbare, and KO-1 and KO-2 represent mutants.

[0024] Figure 3 Association analysis of OsMAB expression level FPKM and structural variant (SV) and OsMAB gene structure diagram; where Hap.1 represents the type of promoter without 6,758bp deletion structural variant; n=90, Osi=36, Osj=54; Hap.2 represents the type of promoter with 6,758bp deletion structural variant; Osi=98, Osj=4; scale bar=1kb.

[0025] Figure 4 This is a sequencing comparison diagram of mutation sites in wild-type and osmab mutants; where NIP represents wild-type Nipponbare, and KO-1 and KO-2 represent mutants.

[0026] Figure 5 This is a haplotype analysis of OsMAB expression levels and tiller number based on DEL structural variants; where Hap.1 represents the type whose promoter does not contain the 6,758bp deletion structural variant; Hap.2 represents the type whose promoter contains the 6,758bp deletion structural variant.

[0027] Figure 6 This is a subcellular localization map of OsMAB. Detailed Implementation

[0028] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the biochemical reagents, carriers, consumables, etc. used in the embodiments are commercially available products.

[0029] Example 1: Obtaining and genetic analysis of OsMAB gene mutants:

[0030] 1. Location of the OsMAB gene:

[0031] To locate the OsMAB gene, this invention first collected 193 Asian cultivated rice varieties from a rice microcore germplasm population and obtained their expression levels using FPKM data. Through SV-based eQTL analysis, significantly associated cis signals were obtained, one of which was a 6,758 bp deletion variant (DEL) relative to Nipponbare located in the OsMAB gene promoter region on chromosome 12. (See...) Figure 3 and Figure 4 Haplotype analysis based on FPKM and tillering phenotype data revealed whether this variant affected the expression level of the OsMAB gene (FPKM) and the tillering number phenotype. (See attached data.) Figure 5 Meanwhile, subcellular localization results showed that the gene is located in the cell nucleus (…). Figure 6 ).

[0032] 2. Obtaining the osmab mutant:

[0033] To further verify the biological function of OsMAB, this invention used CRISPR / Cas9 gene knockout technology to knock out OsMAB in the japonica rice variety Nipponbare, obtaining two homozygous knockout lines: KO-1 and KO-2. These two rice mutant materials showed a significant reduction in tiller number. Figure 1 , Figure 2 Both knockout systems produced a premature stop codon due to the absence of either the G or GT base in the coding region. Figure 4 Consistent with haplotype analysis, the mutant osmab had a significantly lower number of tillers than the wild type. Figure 5 (As shown).

[0034] The wild type of the rice (Oryza sativa L.) tillering mutant osmab (matrix attachment region binding protein) is the japonica rice variety Nipponbare. The specific process for obtaining the rice (Oryza sativa L.) tillering mutant osmab is as follows:

[0035] To obtain the rice (Oryza sativa L.) tiller mutant osmab, this invention utilizes the website http: / / skl.scau.edu.cn / home / designed and developed by Liu Yaoguang's team. Two OsMAB knockout target sites (typically 19 bp) are designed on the exon near the 5' end. Following the operation method of the modified pCRISPER vector for monocotyledons, the two target sites are respectively linked to the intermediate vectors U3 and U6a, and finally linked to the final vector MH to obtain the mutant osmab through Agrobacterium EH105 transformation in wild-type Nipponbare rice.

[0036] The two target site sequences for OsMAB gene knockout are:

[0037] F-1:GGC ACTGCATCCTCGCTTACTCG

[0038] R-1:AAAC CGAGTAAGCGAGGATGCAG

[0039] F-2:GCCG CGCAATGTTCGGTATGAGTG

[0040] R-2:AAAC CACTCATACCGAACATTGCG

[0041] 3. Extraction and transformation of rice protoplasts

[0042] 1) After soaking and germinating the seeds of Indica rice 93-11, spread them on a perforated PCR plate and hydroponically culture them in nutrient solution for 10 days.

[0043] 2) Collect seedlings, remove roots and leaves, cut the remaining parts into small sections of about 0.5 mm with a blade, immerse them in a 250 mL conical flask containing 0.6 M mannitol, let stand in the dark for 15 mins, and adjust the osmotic pressure.

[0044] 3) Filter the mannitol through a 200-mesh sieve, add 100 mL of freshly prepared enzymatic hydrolysate, and shake at 80 rpm for 4 hours in the dark at 28°C.

[0045] 4) Filter out the moldy liquid through a 200-mesh sieve, add 80 mL of W5 and shake vigorously for about 3 minutes. Then use a 200-mesh sieve to collect the protoplasts into a new 250 mL centrifuge tube. Repeat this step 3 times. Centrifuge at 1200 rpm for 3 minutes. At this time, a green precipitate can be seen at the bottom of the centrifuge tube, which is the protoplast. Remove the supernatant.

[0046] 5) Add 20 mL of W5 solution to the centrifuge tube above to resuspend the protoplasts. Gently invert the tube to suspend the protoplasts. Centrifuge (1200 rpm, 3 mins), discard the supernatant, and repeat this step twice.

[0047] 6) Add 2 mL of W5 solution, resuspend the protoplasts, and observe under a microscope whether the protoplasts have been successfully extracted.

[0048] 7) Aliquot the above protoplasts into 2mL round-bottom centrifuge tubes, 100μL of protoplasts per tube, then add plasmid (about 10μg), mix gently, add about 110μL of freshly prepared PEG 4000 solution, mix gently, and incubate at 28°C in the dark for 20mins.

[0049] 8) Add 440 μL of W5 solution to the above protoplasts, mix gently to terminate the transformation, centrifuge to collect the protoplasts (1500 rpm, 3 mins), and remove the supernatant.

[0050] 9) Resuspend the protoplasts in 1 mL of W5 solution in the above precipitate and incubate overnight at 28°C in the dark. Centrifuge (1500 rpm, 1 min) and discard the supernatant.

[0051] 4. OsMAB subcellular localization

[0052] To further investigate the function of the OsMAB gene, an OsMAB overexpression vector was constructed. Using Nipponbare cDNA as a template, the full-length coding sequence of OsMAB was amplified and ligated into the pUbi::GFP vector. The constructed OsMAB overexpression vector was transformed into NIP plants using Agrobacterium to obtain OsMAB-overexpressing transgenic lines. The constructed pUbi-OsMAB::GFP vector was transformed into Escherichia coli DH5α for amplification culture. Plasmids were extracted using a QIAGEN Plasmid Maxi Kit and transformed into rice protoplasts. After incubation in the dark at 28℃ for 14-16 h, images were taken using a confocal microscope (Zeiss, LSM700). The images showed complete fusion of the OsMAB-GFP fusion protein with the nuclear localization marker protein, indicating that OsMAB is localized in the cell nucleus.

[0053] 5. Gene sequencing and comparative analysis

[0054] The knockout transgenic material was amplified using the following identification primers and then sent to the company for sequencing. The sequencing results were compared with the OsMAB gDNA sequence (Seq ID No: 1). The results showed that two knockout transgenic lines, KO-1 and KO-2, were obtained. Due to the deletion of G and GT bases (G deletion at position 203 and GT deletion at positions 203-204 based on the sequence shown in Seq ID No: 1), a premature stop codon was generated, ultimately producing the tillering mutant osmab phenotype.

[0055] Identification primer: F: TAGGCGCAACGAGGAGTCGA

[0056] R:TTCAAACTGGCAACCAACAA

[0057] Example 2: Plant Transformation

[0058] To further investigate the function of OsMAB, genetic transformation experiments were conducted. The constructed OsMAB knockout vector was transformed into Nipponbare callus using Agrobacterium EHA105-mediated transformation. Positive knockout transgenic lines were obtained through hygromycin selection and induced differentiation. Finally, positive single plants were planted in the field until T1 generation homozygous lines were obtained. Agronomic traits such as tillering were investigated, and a significant reduction in tillering was observed.

[0059] The above examples are merely some specific embodiments of the present invention. It should be noted that the present invention is not limited to the above embodiments, and all modifications that can be directly derived or conceived by those skilled in the art from the content disclosed in the present invention should be considered within the scope of protection of the present invention.

[0060] The above examples are merely some specific embodiments of the present invention. It should be noted that the present invention is not limited to the above embodiments, and all modifications that can be directly derived or conceived by those skilled in the art from the content disclosed in the present invention should be considered within the scope of protection of the present invention.

Claims

1. The application of a rice tillering regulatory gene OsMAB, characterized in that, The number of tillers in rice is reduced by knocking out the gene, the nucleotide sequence of which is shown in Seq ID No: 1.

Citation Information

Patent Citations

  • Rice plant type regulation related gene, protein and applications

    CN109721649A

  • Application of protein OsNLP4 in regulation and control of plant tillering

    CN116425846A