Development and application of SNP marker of BnBAN gene regulating purple leaf variation in brassica napus
By developing KASP molecular markers related to rapeseed leaf color, and using the BnaA03g60670D gene fragment and primer pairs, we achieved efficient detection of rapeseed leaf color traits, solving the problem of lacking effective molecular markers in existing technologies and supporting the breeding of colorful rapeseed varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
- Filing Date
- 2023-11-15
- Publication Date
- 2026-06-09
AI Technical Summary
The lack of effective molecular markers for anthocyanin synthesis research in rapeseed makes it difficult to breed colorful rapeseed varieties, thus failing to meet the needs for ornamental and economic value.
A KASP molecular marker closely linked to the leaf color trait of rapeseed was developed. Using the BnaA03g60670D gene fragment and its primer pair, the leaf color allelic mutation of the BnBAN gene in rapeseed was efficiently detected by PCR amplification and fluorescence detection.
It enables accurate, rapid, and efficient detection of rapeseed leaf color traits, and can clearly distinguish green leaves, purple leaves, and intermediate heterozygotes in segregating populations, supporting the breeding of multicolored rapeseed varieties.
Smart Images

Figure CN117535308B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of molecular genetics and breeding technology, and in particular to the development and application of a BnBAN gene SNP marker for regulating purple leaf variation in Brassica napus. Background Technology
[0002] The color of rapeseed leaves is determined by the content of pigments such as chlorophyll, anthocyanins, and carotenoids. Anthocyanins are a class of natural pigments easily soluble in polar solvents, belonging to the flavonoid family. Anthocyanins are widely found in the roots, stems, leaves, flowers, and fruits of plants, giving them different colors from red to purple, and are the main coloring substances in plants. Anthocyanins not only give rapeseed leaves, flowers, and stems rich colors, but also have various health benefits, including antioxidant, anti-aging, immune-boosting, and cardiovascular disease prevention properties.
[0003] Rapeseed is my country's fifth largest crop after rice, wheat, corn, and soybeans. The accumulation of anthocyanins in rapeseed leaves leads to the morphological variation of purple leaves. Purple leaves not only serve as an important indicator trait for breeding but also possess ornamental and nutritional value. With the development of rural tourism in my country, the rapeseed tourism industry is also gradually developing. Large areas of monotonous yellow rapeseed fields no longer satisfy tourists' aesthetic needs. Creating colorful rapeseed varieties can be applied to landscape rapeseed pattern design, meeting the needs of rural agricultural tourism. However, research on rapeseed anthocyanin synthesis is limited, and corresponding molecular markers are lacking. Therefore, developing KASP molecular markers closely linked to rapeseed leaf color traits has significant production and economic value.
[0004] Molecular markers have become a powerful tool in crop breeding due to their accuracy, speed, and efficiency. Their advantages, including early selection, independence from environmental influences, and high accuracy and efficiency, have led to their substantial use in various crops. There are many types of molecular markers. Currently, those substantially used in crops include early markers such as RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphism DNA), and AFLP (Amplified Fragment Length Polymorphism), and more recently, the most widely used markers, such as SSR (Simple Sequence Repeat) and CAPS (Cleaved Amplified Polymorphic Sequence). However, these methods all have limitations such as low throughput or high cost. KASP (kompetitive allele-specific PCR) is a technique developed by LGC (Government Chemists' Laboratories) in the UK for the precise identification of biallelic alleles in SNPs and InDels at specific loci in the genome. KASP molecular markers offer advantages such as high stability, high accuracy, low cost, speed, and high efficiency, and their application is most significant when dealing with large sample sizes and a limited number of SNP sites. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a CDS gene fragment related to rapeseed leaf color, named gene BnaA03g60670D, located in the QTL interval ChrA03_random:5590001~5778000; wherein: the BnaA03g60670D-purple-leaf parent P1-CDS sequence is shown in SEQ ID NO:1, and the BnaA03g60670D-green-leaf parent P2-CDS sequence is shown in SEQ ID NO:2.
[0006] Furthermore, the present invention also provides proteins encoding the CDS gene fragments described above, the amino acid sequence of BnaA03g60670D-purple leaf parent P1 protein is shown in SEQ ID NO: 3, and the amino acid sequence of BnaA03g60670D-green leaf parent P2- protein is shown in SEQ ID NO: 4.
[0007] Furthermore, the present invention also provides a primer pair for amplifying the CDS gene fragment, the nucleotide sequence of which is as follows:
[0008] 60670D-F: AACAAACAAAATATAAAATTTCTGTG (as shown in SEQ ID NO: 11);
[0009] 60670D-R: TTWAGGTTTGATCAATCCTTTTG (as shown in SEQ ID NO: 12).
[0010] Furthermore, the present invention also provides a target gene for detecting leaf color allelic mutations in the BnBAN gene of rapeseed. The target gene is selected from a segment or all of the BnaA03g60670D gene, wherein the BnaA03g60670D gene is located in the QTL interval ChrA03_random:5590001~5778000, and the CDS sequence of the BnaA03g60670D gene is shown in SEQ ID NO:1 or SEQ ID NO:2; and includes at least one of the functional variations of three exon nucleotide sequences, namely, a C to G substitution at position 181, i.e., C181G; an A to G substitution at position 335, i.e., A335G; and a T to A substitution at position 557, i.e., T557A.
[0011] Furthermore, the present invention also provides the application of the target gene in the preparation of a detection reagent for detecting leaf color allelic mutations in the BnBAN gene of rapeseed.
[0012] Furthermore, the present invention also provides a primer pair for detecting the target gene.
[0013] Preferably, the primer pair includes one or both of the following: a primer pair for detecting the molecular marker BAN_A335G and a primer pair for detecting the molecular marker BAN_T557A.
[0014] (1) Primers for the molecular marker BAN_A335G include:
[0015] Two specific primers:
[0016] Primer_AlleleFAM: 5'-gacatgatcaaaccagcggtacg-3' (as shown in SEQ ID NO: 5);
[0017] Primer_AlleleHEX: 5'-gacatgatcaaaccagcggtaca-3' (as shown in SEQ ID NO: 6);
[0018] A universal primer:
[0019] Primer_Common: 5'-attgagttcgattttaagcaag-3' (as shown in SEQ ID NO: 7);
[0020] (2) Primers for the molecular marker BAN_T557A include:
[0021] Two specific primers:
[0022] Primer_AlleleFAM: 5'-gcagaaaaggaagcttataaata-3' (as shown in SEQ ID NO: 8);
[0023] Primer_AlleleHEX: 5'-gcagaaaaggaagcttataaatt-3' (as shown in SEQ ID NO: 9);
[0024] A universal primer:
[0025] Primer_Common: 5'-ggagagagtttccggctatgagt-3' (as shown in SEQ ID NO: 10).
[0026] Furthermore, the present invention also provides a kit comprising the aforementioned primer pair.
[0027] Furthermore, the present invention also provides the application of the target gene, the primer pair, or the kit in detecting leaf color allelic mutations in the BnBAN gene of rapeseed.
[0028] Furthermore, the present invention also provides a method for detecting leaf color allelic mutations in the BnBAN gene of rapeseed, the method comprising the following steps:
[0029] 1) Extract DNA from Brassica napus;
[0030] 2) PCR amplification was performed using the primer pair described above, and the target gene in the amplification product was detected to detect the leaf color allelic mutation of the rapeseed BnBAN gene.
[0031] Preferably, the reaction system configuration is as follows:
[0032] Rapeseed sample DNA template (20 ng / μl): 2.5 μl, 2×KASPMastermix 2.5 μl, KASP AssayMix (F-HEX:F-FAM:R = 2:2:5 molar ratio) 0.07 μl;
[0033] The PCR reaction conditions were as follows: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles. If the amplification effect was not ideal, more cycles could be added, 3 cycles each time, up to a maximum of three cycles. After the reaction was completed, the fluorescence data of the KASP reaction products were read using a Pherastar scanner, and the fluorescence scan results were automatically converted into images. The fluorescence signal was detected and the genotyping status was checked using a BMG Pherastar instrument. If the genotyping was insufficient, amplification was continued, and the genotyping status was checked every 3 cycles until the genotyping was complete.
[0034] Furthermore, the present invention also provides the application of the target gene, the primer pair, the kit, or the method described herein in assisted breeding of leaf color traits in Brassica napus.
[0035] This application, employing the aforementioned technical solution, discovered three exon nucleotide sequence functional variations in the BnaA03g60670D gene between green-leaf and purple-leaf parents: a C-to-G substitution at position 181 (C181G); an A-to-G substitution at position 335 (A335G); and a T-to-A substitution at position 557 (T557A). These variations lead to corresponding amino acid variations: a Q-to-E substitution at position 61; a Q-to-R substitution at position 112; and an F-to-Y substitution at position 186, ultimately altering the protein sequence. Furthermore, an SNP marker was developed for detecting leaf color allelic mutations in the rapeseed BnBAN gene. This SNP marker can be applied in leaf color trait-assisted breeding of Brassica napus. Amplification of the KASP marker in segregating populations revealed clear differentiation between green-leaf, purple-leaf, and intermediate heterozygous types. Attached Figure Description
[0036] Figure 1 Figure showing the content of anthocyanins, anthocyanins, and β-carotene in leaves of different colors.
[0037] Figure 2 The graph shows the content of xanthophyll, lycopene, total carotenoids and chlorophyll in leaves of different colors.
[0038] Figure 3 Gel electrophoresis images of the BnaA03g60670D and BnaAnng41910D genes amplified from the two parental lines, purple-leaved parent P1 and green-leaved parent P2.
[0039] Figure 4 Genotyping results of the BAN_A335G marker in the F2 generation population.
[0040] Figure 5Genotyping results of the BAN_A335G marker in the two parents. Detailed Implementation
[0041] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.
[0042] Example 1: Statistical analysis of leaf color phenotypes in associated populations and detection of leaf color-related pigment content.
[0043] 1. Rapeseed materials used in this experiment: the green-leaved rapeseed cultivar “Zhongshuang 11” was a purified inbred line of green-leaved rapeseed bred through multiple generations of strict bagging and self-pollination, and the purple-leaved rapeseed cultivar “CL620” was a purified inbred line of purple-leaved rapeseed bred through multiple generations of strict bagging and self-pollination; the green-leaved rapeseed cultivar “Zhongshuang 11” and the purple-leaved rapeseed cultivar “CL620” were both provided by the Institute of Crop and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences.
[0044] 2. Using the purified inbred line “Zhongshuang 11” (referred to as “green-leaf parent P2”) as the male parent and the purified inbred line “CL620” (referred to as “purple-leaf parent P1”) as the female parent, hybridization was performed to obtain F1, and self-pollination of F1 yielded F2 segregating populations. All materials were planted at the research base of Zhejiang Academy of Agricultural Sciences. During the planting period, the experimental materials were managed using conventional field management, including direct seeding and seedling establishment, with a row spacing of 40cm, a plant spacing of 25cm, a row length of 3.5m, and 4 rows per plot. Protective rows were planted around the perimeter of the experimental material plots.
[0045] 3. Leaf color phenotypic statistics and determination of leaf color-related pigment content: After normal plant maturity, the segregation ratio of leaf color phenotype in the F2 segregating population was statistically analyzed, with purple leaves:green leaves at a ratio of 3:1. Mature leaf tissues from three plants each of the purple-leaved parent P1, the green-leaved parent P2, and the F1 population were selected to determine their total chlorophyll content, total carotenoid content, and the contents of anthocyanins, lycopene, xanthophyll, and anthocyanins.
[0046] The specific method is as follows:
[0047] 3.1. Determination of anthocyanin content (micro-method)
[0048] Measurement principle
[0049] Anthocyanin content was determined using a pH differential method. Anthocyanins exhibited a maximum absorption peak at 530 nm at pH 1.0, while at pH 4.5, they converted to a colorless chalcone form, showing no absorption peak at 530 nm. This characteristic was utilized to measure absorbance values at 530 nm and 700 nm at different pH values. The pH differential method reduced the influence of solution pH and solvent differences, and eliminated interference from other non-anthocyanin substances on the detection results.
[0050] reagents
[0051] Extraction solution: 100mL x 1 bottle, store at 4℃;
[0052] Reagent 1: 25mL liquid per bottle, store at 4℃;
[0053] Reagent 2: 25mL liquid per bottle, store at 4℃.
[0054] Experimental steps
[0055] According to the ratio of sample mass (g): extract volume (mL) of 1:5 to 10 (it is recommended to weigh about 0.1g of sample and add 1mL of extract), after thorough homogenization, transfer to EP tube, make up to 1mL of extract, seal tightly, extract by ultrasonication for 1h, centrifuge at 8000g at room temperature for 10min, and take the supernatant for testing.
[0056] 1) Preheat the spectrophotometer for at least 30 minutes; preheat reagent one and reagent two at 25℃ (room temperature) for at least 10 minutes.
[0057] 2) Take 20 μL of supernatant and 180 μL of reagent 1 (equivalent to a 10-fold dilution), incubate in a water bath at 40℃ for 20 min, and measure the absorbance at 530 nm and 700 nm respectively, and record them as A1 and A2 respectively.
[0058] 3) Take 20 μL of supernatant and 180 μL of reagent II (equivalent to a 10-fold dilution), incubate in a water bath at 40℃ for 20 min, and measure the absorbance at 530 nm and 700 nm respectively, and record them as A3 and A4 respectively.
[0059] 4) Calculate ΔA = (A1 - A2) - (A3 - A4). Note: If A1 is greater than 1, the dilution factor can be increased appropriately to ensure the total volume.
[0060] Keep the total volume constant at 200 μL, such as 10 μL of supernatant and 190 μL of reagent one (equivalent to a 20-fold dilution). If A1 is less than 0.1, the dilution factor can be appropriately reduced to keep the total volume constant, such as 100 μL of supernatant and 100 μL of reagent one (equivalent to a 2-fold dilution), so that A1 is kept in the range of 0.1 to 1, which can improve the detection sensitivity. Similarly, adjust the volume ratio of supernatant and reagent two. When calculating, substitute the actual dilution factor into the following formula.
[0061] 5) Calculation of Results
[0062] Anthocyanin content (μg / g fresh weight) = [ΔA×V÷(ε×d)×M×F×106]÷W = 27.83×ΔA×F÷W
[0063] V: Extraction liquid volume, 1×10⁻³L;
[0064] ε: molar extinction coefficient of anthocyanins, 2.69 × 10⁴ L / mol / cm;
[0065] d: Cuvette optical path length, 0.6 cm;
[0066] M: Relative molecular mass of anthocyanins: 449.2 g / mol;
[0067] F: Dilution factor: 10⁶: 1g = 10⁶ug;
[0068] W: Sample weight, g.
[0069] 3.2. Anthocyanin content determination
[0070] Measurement principle
[0071] Anthocyanins are red in acidic solutions, and the intensity of the color is directly proportional to the concentration of anthocyanins. The absorption peak wavelength of anthocyanin in acidic solutions is 530 nm, and the molar extinction coefficient is 4.62 × 10⁴, so its content can be determined spectrophotometrically. However, chlorophyll is often present in some extracts, interfering with the determination. Therefore, it is necessary to simultaneously measure the optical density values of the extract at wavelengths of 620 nm (soluble sugar) and 650 nm (chlorophyll absorbance), and accurately calculate the optical density value of anthocyanins using the Greey formula in order to calculate the anthocyanin content.
[0072] Experimental steps
[0073] 1) Sample extraction
[0074] Weigh 0.05-1 g of the sample to be tested and place it in a centrifuge tube. Add 10 mL of 0.1 mol / L hydrochloric acid-ethanol solution, tighten the tube, and extract in a 60℃ water bath for 30 min. Pour the extract into a 25 mL volumetric flask. Add another 5 mL of 0.1 mol / L hydrochloric acid-ethanol solution and extract for 15 min. Pour the extract into a 25 mL volumetric flask, and repeat the extraction process. Continue extraction for a total of 1 h. Rinse the residue and bring the volume to 25 mL.
[0075] 2) Content determination
[0076] Using 0.1 mol / L hydrochloric acid ethanol solution as a reference solution, the optical density values of the extract at wavelengths of 530 nm, 620 nm, and 650 nm were measured by spectrophotometer.
[0077] 3.3. Determination of chlorophyll and carotenoid content
[0078] Take fresh plant samples, wash, dry, chop, and mix them thoroughly. Weigh 0.2g of each sample and place them in a mortar. A small amount of liquid nitrogen can be added to grind them into powder. Then add 2mL of 95% ethanol to the mortar and grind into a homogenate. Add another 5mL of ethanol and continue grinding until the tissue turns white. Filter the mixture into a 25mL brown volumetric flask. Rinse the mortar, grinding stick, and residue several times with a small amount of ethanol. Finally, filter the mixture, including the residue, into the volumetric flask. Use a dropper to draw ethanol and wash all the chloroplast pigments from the filter paper into the volumetric flask until no green color remains on the filter paper or residue. Finally, dilute to 25mL with 95% ethanol and mix well. Pour the chloroplast pigment extract into a cuvette with a 1cm optical path. Using 95% ethanol as a blank, measure the absorbance at wavelengths of 665nm, 649nm, and 470nm.
[0079] 3.4. Lutein content determination
[0080] Experimental Principle
[0081] Leaf pigments mainly consist of chlorophyll and carotenoids, with carotenoids primarily being carotene and xanthophyll. The former is orange-yellow, while the latter is yellow. The xanthophyll content can be calculated by ethanol-acetone extraction and colorimetric analysis at 470nm, 485nm, 642nm, and 665nm.
[0082] Experimental steps
[0083] Weigh approximately 0.1 g of the ground sample, accurate to 0.001 g, into a 50 mL centrifuge tube. Add 15 mL of ethanol-acetone extraction solution to the centrifuge tube, shake immediately, and let stand in the dark for 24 h. Zero the sample using equal volumes of ethanol-acetone extraction solution at 470 nm, 485 nm, 642 nm, and 665 nm, and measure the absorbance of the sample supernatant using a spectrophotometer.
[0084] Result Calculation
[0085] The lutein content in the sample is calculated using the following formula:
[0086] Chlorophyll a (mg / L) = 9.99A665 - 0.0872A642
[0087] Chlorophyll b (mg / L) = 17.7A642 - 3.04A665
[0088] Lutein (mg / L) = 10.2A470 - 11.5A485 - 0.0036[a] - 0.652[b]
[0089] Lutein content (mg / g) = Lutein (mg / L) * Vt / m / 1000
[0090] In the formula:
[0091] [a], [b] — Concentrations of chlorophyll a and chlorophyll b, in milligrams per liter (mg / L);
[0092] Vt — Volume of extract; unit is milliliters (mL);
[0093] m — Sample mass, in grams (g).
[0094] The calculation result is expressed to two decimal places.
[0095] 3.5. Determination of Lycopene Content
[0096] Experimental Principle
[0097] Lycopene is the main pigment in ripe tomatoes. It is an oxygen-free carotenoid with strong antioxidant properties and a powerful ability to scavenge free radicals. It can be extracted using toluene, chloroform, or petroleum ether as extraction solvents.
[0098] Experimental steps
[0099] Weigh approximately 1g (accurate to 0.001g) of the ground tomato sample into a 15mL centrifuge tube. Add a small amount of methanol to the centrifuge tube and immediately shake to dissolve the tomato's lycopene in the methanol. Transfer the mixture to a glass funnel lined with filter paper and filter. Add a small amount of methanol to the residue. Repeat the above steps until the filtrate is colorless and discard the filtrate. Extract the lycopene from the residue several times with a small amount of chloroform until the filtrate is colorless. Collect the filtrate in a 25mL volumetric flask and dilute to volume with chloroform extract. Shake well to obtain the lycopene extract. Pipette 3mL of the extract into a cuvette. Zero the spectrophotometer at 485nm using an equal volume of the extract and measure the absorbance. Calculate the concentration of lycopene in the sample extract using a linear regression equation.
[0100] Result Calculation
[0101] The concentration of lycopene in the sample is calculated using the following formula:
[0102] X = (C × Vt) / m × 1000
[0103] In the formula:
[0104] X1 — Lycopene content in the sample, in milligrams per gram (mg / g);
[0105] C — equivalent to the concentration of lycopene, expressed in milligrams per liter (mg / L);
[0106] Vt — Volume of extract, in milliliters (mL);
[0107] m — Sample mass, in grams (g).
[0108] The calculation result is expressed to two decimal places.
[0109] The results of summarizing the content of six pigments in rapeseed leaves (Table 1) show that the anthocyanin content and anthocyanin content in different colored leaves differed significantly in the associated population. Figure 1 The content of lutein, lycopene, total carotenoids, and total chlorophyll was not significantly different from that of green leaves. Figure 2 ).
[0110] Table 1 Summary of results for 6 leaf color-related pigment indices
[0111]
[0112]
[0113] Example 2: BSA pooled sequencing of associated populations
[0114] Statistical analysis was performed on the leaf color of the F2 population. Based on the leaf color distribution, 30 plants from an extreme purple-leaf population and 30 plants from an extreme green-leaf population were selected. The DNA from the two populations was mixed in equal amounts to form a purple-leaf pool and a green-leaf pool, respectively, for BSA pooling and sequencing. Furthermore, the parents "purple-leaf parent P1" and "green-leaf parent P2" were resequencing.
[0115] (1) Total DNA was extracted from leaves using the CTAB method. Total DNA was extracted from leaves of each material in the associated population. The specific method was as follows:
[0116] Young leaves were rinsed in 10% ethanol; then 0.1-0.2g of leaves were cut and placed in a mortar, and rapidly ground into powder using liquid nitrogen. The powder was then transferred to a 2mL centrifuge tube. 700μL of preheated DNA extraction buffer was added; the mixture was incubated in a 65℃ water bath for 1 hour, mixing every 10-15 minutes. 700μL of a mixture (phenol:chloroform:isoamyl alcohol = 25:24:1) was added, and the mixture was gently inverted and mixed for 10 minutes. The mixture was centrifuged at 10000×g for 15 minutes at room temperature. The supernatant was transferred to a new 2mL centrifuge tube. An equal volume of the mixture (chloroform:isoamyl alcohol = 24:1) was added, and the mixture was inverted and mixed. The mixture was allowed to stand for 5 minutes, then centrifuged at 10000×g for 15 minutes. The supernatant was transferred to a new centrifuge tube. Two volumes of anhydrous ethanol were added, and the mixture was incubated at -20℃. After 1 hour, centrifuge at 10000×g for 10 minutes and discard the supernatant. Add 500 μL of pre-cooled 75% ethanol to wash the precipitate and discard the supernatant. After two consecutive washes, air dry the precipitate. Add 100 μL of a 2% RNase A solution, incubate at 37°C for 1 hour, then at 4°C overnight. Extract the DNA solution again with an equal volume of a mixture (chloroform:isoamyl alcohol = 24:1), invert to mix, incubate for 10 minutes, centrifuge at 10000×g for 15 or 20 minutes to remove RNase A, collect the supernatant (approximately 60 μL), and centrifuge again for 1 minute. Detect DNA concentration, quality, and integrity using agarose gel electrophoresis (0.8%) and UV spectrophotometry. Ensure the absorbance ratio (260 / 280) of all DNA samples is between 1.8 and 2.0. Then, transport the DNA samples on dry ice to a sequencing company (Beijing Novogene Technology Co., Ltd.) for 30x BSA sequencing analysis.
[0117] (2) The sequencing company (Beijing Novogene Technology Co., Ltd.) performed sequencing at a depth of 30× and returned the data. The data was analyzed using the Brassica napus Darmor.v4.1 genome as the reference genome (http: / / www.genoscope.cns.fr / brassicanapus / ).
[0118] (3) Candidate gene localization:
[0119] Based on the genotyping results, SNP / InDel loci showing homozygous differences between the two parents were screened, resulting in 61,122 polymorphic markers. We selected the green-leaved parent P2 as the reference parent and calculated the SNP-index and InDel-index (i.e., the frequency of SNPs and InDels) of these 61,122 marker loci in the two offspring. For those completely identical to the reference parent, the SNP-index (InDel-index) was 0; for those completely different, the SNP-index (InDel-index) was 1. To reduce the impact of sequencing and alignment errors, the calculated SNP-index (InDel-index) polymorphic loci were filtered using the following criteria:
[0120] 1) Filter out sites in both offspring where the SNP-index (InDel-index) is less than 0.3 and the SNP (InDel) depth is less than 7;
[0121] 2) Filter out sites with missing SNP-index (InDel-index) in offspring;
[0122] After the above screening, 53,292 polymorphic marker sites were obtained.
[0123] For the polymorphic marker sites (SNP and InDel) obtained by filtering, calculate △(SNP-index) and △(InDel-index), that is, the difference between the SNP-index (InDel-index) of the two offspring: △(SNP-index) = SNP index (extreme trait B) - SNP index (extreme trait A); △(InDel-index) = InDel index (extreme trait B) - InDel index (extreme trait A).
[0124] We selected windows larger than the threshold at a 95% confidence level as candidate intervals, obtaining one QTL interval: ChrA03_random:5590001–5778000. To screen candidate genes for this QTL interval, we obtained 136 pigment-related genes from the Arabidopsis Genome Information Database (https: / / www.arabidopsis.org / index.jsp) using 'pigment' as the keyword. These were then mapped to the rapeseed genome, yielding 480 genes related to pigment regulation in rapeseed. Among these, the pigment-related gene BnaA03g60670D was located within the QTL interval ChrA03_random:5590001–5778000.
[0125] To avoid neglecting the impact of minor QTLs, SNP sites with significant differences in SNP-index among progeny were selected across the entire genome. Specifically, sites where the SNP-index of progeny 2 (extreme trait B) was close to 1 and the SNP-index of progeny 1 (extreme trait A) was close to 0 were selected. For the 444 candidate polymorphic marker sites, ANNOVAR annotation results were used, and genes containing sites causing stop loss, stop gain, or nonsynonymous mutations were preferentially selected as potential candidate genes. A total of 75 potential candidate genes causing stop loss, stop gain, or nonsynonymous mutations were obtained. According to gene annotation, these 75 potential candidate genes did not show any correlation with pigment regulation.
[0126] (4) Gene cloning
[0127] Primer pair 60670D (primer pair sequences are shown in Table 2) was used to amplify BnaA03g60670D located on chromosome A03 of the two parents, purple-leaved parent P1 and green-leaved parent P2. Figure 3 ).
[0128] PCR system:
[0129] Genomic DNA 1 μL 10 x Buffer 5 μL dNTP Mixture (10 mM) 1 μL Primer F (10 μM) 1 μL Primer R (10 μM) 1 μL KOD (1 U / μL) 1 μL ddH2O Up to 50 μL
[0130] PCR procedure:
[0131]
[0132] Table 2
[0133] Primer Name Sequence (5'-3') 60670D-F AACAAACAAAATATAAAATTTCTGTG 60670D-R TTWAGGTTTGATCAATCCTTTTG
[0134] The amplified products were detected by 1.0% agarose gel electrophoresis on a horizontal electrophoresis tank using 1×TAE buffer (0.04M Tris-acetate, 0.001M EDTA, pH 8.0), at a voltage of 8V / cm, for 35 min. After electrophoresis, images were taken and stored using a gel imaging system (UVP).
[0135] The DNA fragment amplified from primer pair 60670D obtained in the above steps was recovered from the parental Brassica napus. The procedure was performed according to the instructions provided with the Gen Clean Column DNA Gel Recovery Kit (purchased from Beijing Qingke Biotechnology Co., Ltd.):
[0136] Use a blade to cut out the amplified DNA fragment from the 1.0% agarose gel, put it into a 1.5ml centrifuge tube, add 300μl Binding Solution B for every 100mg of agarose gel, heat in a 55℃ water bath for 10min, and mix every 2min.
[0137] Transfer the melted gel solution to the Gen Clean Column fitted inside the collection tube, incubate at room temperature for 2 min, and centrifuge at 3,000 rpm for 30 sec; discard the waste liquid in the collection tube, add 500 μl Wash Solution, and centrifuge at 8,000 rpm at room temperature for 30 sec. Repeat this step once.
[0138] Discard the waste liquid in the collection tube, place the Gen Clean Column into the same collection tube, and centrifuge at 10,000 rpm for 1 min. Transfer the Gen Clean Column to a new 1.5 ml centrifuge tube, add 30 μl of Elution Buffer to the center of the column membrane, and incubate at room temperature for 2 min.
[0139] Centrifuge at 10,000 rpm for 1 minute. The liquid in the centrifuge tube is the recovered DNA fragment, which can be used immediately or stored at -20°C for later use.
[0140] The recovered target DNA fragment was ligated into the cloning vector. The procedure was followed according to the instructions for this kit:
[0141] Before use, briefly centrifuge the reagents to collect them at the bottom of the tube; perform the ligation reaction in a 0.5 ml centrifuge tube. The ligation reaction mixture consists of 2.0 μl DNA, 0.5 μl pMDT-18 vector, and 2.5 μl Solution I. Mix thoroughly by pipetting back and forth several times, and incubate overnight at 4°C.
[0142] Prepare LB liquid medium and LB solid medium (containing 100 mg / ml ampicillin, 24 mg / ml isopropyl-thio-BD-galactoside and 20 mg / ml 5-bromo-4-chloro-3-indole-α-D-galactoside);
[0143] Remove competent cells from the -70℃ freezer and place them on ice to thaw slowly (about 5 minutes); centrifuge to collect the ligation reaction solution, and add 2 μl of the reaction solution to a sterile 1.5 ml centrifuge tube (pre-cooled on ice); gently tap the bottom of the tube containing competent cells with your finger to mix, add 50 μl of competent cells to the 1.5 ml centrifuge tube containing 2 μl of ligation reaction solution, gently tap to mix, and place on ice for 20 minutes;
[0144] Heat shock in a 42°C water bath for 90 seconds (do not shake), then place on ice for 5 minutes; add 500 μl of LB liquid medium and incubate at 37°C with shaking for 1 hour (150 rpm / min); take 200 μl of the transformation solution after shaking and spread it on sterile LB solid medium and incubate at 37°C for 16-20 hours.
[0145] Blue and white screening was performed, 30 positive clones were selected and numbered, and then cultured in sterile liquid LB medium (containing 50 ug / ml ampicillin) with shaking for 16-20 h;
[0146] Use 2 μl of the shaken bacterial culture as a PCR template for amplification. The PCR reaction is performed as described above. Amplification results are detected on a 1.0% agarose gel. Select 100 μl of each successfully transformed bacterial culture and send it to Qingke Biotechnology Co., Ltd. for sequencing. Add 400 μl of 50% sterile glycerol to the remaining 400 μl of turbid bacterial culture and store in a 2 ml sterile centrifuge tube at -70℃.
[0147] In this application, the DNA fragments amplified by primer pair 60670D in both parents of Brassica napus were sequenced 15 times each. The coding sequence of the BnaA03g60670D gene amplified by primer pair 60670D was 1029 bp in length. The CDS and protein sequences of the BnaA03g60670D gene in both parents are as follows:
[0148] BnaA03g60670D-Purple Leaf Parent P1-CDS Sequence
[0149]
[0150]
[0151] BnaA03g60670D-Green Leaf Parent P2-CDS Sequence
[0152] BnaA03g60670D-Purple Leaf Parent P1-Protein Sequence
[0153]
[0154] BnaA03g60670D-Green Leaf Parent P2-Protein Sequence
[0155]
[0156] Comparison revealed that the BnaA03g60670D gene exhibits three exon nucleotide sequence functional variations between the green-leaf and purple-leaf parents: a C-to-G substitution at position 181 (C181G); an A-to-G substitution at position 335 (A335G); and a T-to-A substitution at position 557 (T557A). These variations lead to corresponding amino acid variations: a Q-to-E substitution at position 61; a Q-to-R substitution at position 112; and an F-to-Y substitution at position 186, ultimately altering the protein sequence.
[0157] The DNA fragments amplified by primer pair 41910D in both parents of Brassica napus were sequenced 15 times each. The coding sequence length of the gene amplified by primer pair 41910D was 393. Sequence alignment revealed no sequence difference between the two parents for BnaA03g60670D.
[0158] Example 3: An SNP marker was developed that can be used to detect leaf color allelic mutations in the BnBAN gene of rapeseed.
[0159] We selected the A335G and T557A sites in the coding region of the BnaA03g60670D gene as the center and extracted 100bp flanking sequences from both sides. We then designed primers based on the sequence differences of the cloned BnaA03g60670D gene to specifically amplify the gene sequence fragment, thus eliminating interference from homologous gene sequences. Two primer sets were designed, each consisting of three primers: two specific primers designed for base differences at key sites and one universal primer. The KASP marker primers provided in this application are the following specific primer combinations, as shown in the table below. Each pair of KASP markers contains three primers.
[0160] Primers for the molecular marker BAN_A335G include:
[0161] Two specific primers:
[0162] Primer_AlleleFAM:5'-gacatgatcaaaccagcggtacg-3';
[0163] Primer_AlleleHEX:5'-gacatgatcaaaccagcggtaca-3';
[0164] A universal primer
[0165] Primer_Common: 5'-attgagttcgattttaagcaag-3';
[0166] Primers for the molecular marker BAN_T557A include:
[0167] Two specific primers:
[0168] Primer_AlleleFAM:5'-gcagaaaaggaagcttataaata-3';
[0169] Primer_AlleleHEX:5'-gcagaaaaggaagcttataaatt-3';
[0170] A universal primer
[0171] Primer_Common: 5'-ggagagagtttccggctatgagt-3'.
[0172] Example 4: Establishment of the above-mentioned SNP marker system for detecting allelic mutations in rapeseed leaf color and its application in assisted breeding of rapeseed leaf color trait.
[0173] An F2 population containing 92 segregating lines (♀ green-leaved parent P2 × ♂ purple-leaved parent P1) was selected. Using the KASP primers designed above, the population was initially screened and validated on the LGCSNP line genotyping platform. The specific steps are as follows:
[0174] (1) Genomic DNA was extracted from the leaves of the material to be tested using the conventional method (CTAB method). The quality of the extracted DNA was detected by agarose electrophoresis and Nanodrop 2100. The agarose electrophoresis showed that the DNA band was single, the A260 / 280 was between 1.8 and 2.0, and the A260 / 230 was between 2.0 and 2.2. Such DNA samples met the quality requirements. The DNA concentration was diluted to 20 ng / μL for later use.
[0175] (2) Using the DNA extracted in step 1 as a template, the SNP markers BAN_A335G and BAN_T557A developed in Example 3 for detecting allelic mutations in the BnaA03g60670D gene were used for amplification PCR to obtain the amplification products.
[0176] Configuration of the KASP-labeled primer reaction system:
[0177] 2.5 μl of rapeseed sample DNA template (20 ng / μl), 2.5 μl of 2×KASPMastermix, and 0.07 μl of KASP AssayMix (molar concentration ratio of F-HEX:F-FAM:R = 2:2:5).
[0178] The PCR reaction conditions were: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles. If the amplification effect was unsatisfactory, more cycles could be added, 3 cycles each time, up to a maximum of three cycles. After the reaction, the fluorescence data of the KASP reaction products were read using a Pherastar scanner, and the fluorescence scan results were automatically converted into images. The fluorescence signal was detected and the genotyping status was checked using a BMG Pherastar instrument. If the genotyping was insufficient, amplification continued, checking the genotyping status every 3 cycles until complete genotyping. If the +335 base in the BAN_A335G test result is G, then the BnaA03g60670D of the rapeseed sample is determined to be the purple leaf allele, with a genotype of AA. If the base is A, then the locus is determined to be the green leaf allele, with a genotype of aa. If both G and A are detected at the same locus, then the sample is determined to be heterozygous, with a genotype of Aa. Similarly, if the +557 base in the BAN_T557A test result is A, then the BnaA03g60670D of the rapeseed sample is determined to be the purple leaf allele, with a genotype of AA. If the base is T, then the locus is determined to be the green leaf allele, with a genotype of aa. If both A and T are detected at the same locus, then the sample is determined to be heterozygous, with a genotype of Aa.
[0179] Amplification of the above KASP markers in segregating populations revealed that the BAN_A335G marker showed the best amplification effect, clearly distinguishing green-leaved, purple-leaved, and intermediate heterozygous types. Figure 4-5 Combined analysis of genotype and leaf color phenotype revealed that the genotyping results of the BAN_A335G marker had the highest correlation with the leaf color phenotype (98% concordance).
[0180] Table 3: Leaf colors and corresponding genotypes of 92 individuals in the F2 population constructed using the BAN_A335G marker from purple-leaf parent P1 and green-leaf parent P2.
[0181]
[0182]
[0183]
[0184] Table 4: Genotype and leaf color of BAN_A335G in the F2 population
[0185]
[0186] The data above shows that the marker BAN_A335G can be used to accurately detect this new type of purple leaf allelic variation. The genotyping effect of the offspring is good, and the allele with the G base in the BAN_A335G site belongs to the purple leaf allele.
[0187] The foregoing description of embodiments of this application, through which those skilled in the art are able to implement or use this application, is provided. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of this application. Therefore, this application is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.
Claims
1. The application of a molecular marker BAN_A335G in the detection of rapeseed leaf color, characterized in that, The target gene is the BnaA03g60670D gene. The P1-CDS sequence of the BnaA03g60670D-purple-leaf parent is shown in SEQ ID NO:1, and the P2-CDS sequence of the BnaA03g60670D-green-leaf parent is shown in SEQ ID NO:
2. An A-to-G substitution occurred at position 335 of this sequence, i.e., A335G. If the base at position 335 is G, then the BnaA03g60670D of the rapeseed sample is determined to be the purple-leaf allele, and the genotype is defined as AA. If the base is A, then the site is determined to be the green-leaf allele, and the genotype is defined as aa. If both G and A are detected at the detection site, then it is determined to be a heterozygote, and the genotype is defined as Aa.
2. The application of a primer pair for detecting the molecular marker BAN_A335G described in claim 1 in the detection of rapeseed leaf color. Primers for the molecular marker BAN_A335G include: Two specific primers: Primer_AlleleFAM: 5'-gacatgatcaaaccagcggtacg-3'; Primer_AlleleHEX: 5'-gacatgatcaaaccagcggtaca-3'; A universal primer: Primer_Common: 5'-attgagttcgattttaagcaag-3'.
3. The application of a kit comprising the primer pair of claim 2 in the detection of rapeseed leaf color.
4. A method for detecting the color of rapeseed leaves, characterized in that, The method includes the following steps: DNA was extracted from Brassica napus; Using the primer pair described in claim 3, PCR amplification is performed, and the alleles in the amplification product as described in claim 1 are detected to determine the rapeseed leaf color. If the base at position 335 is G, then BnaA03g60670D of the rapeseed sample is determined to be the purple leaf allele, and the genotype is defined as AA. If the base is A, then the site is determined to be the green leaf allele, and the genotype is defined as aa. If both G and A are detected at the detection site, then it is determined to be a heterozygote, and the genotype is defined as Aa.
5. The method according to claim 4, characterized in that, Configuration of the reaction system: Rapeseed sample DNA template 20 ng / μl: 2.5 μl, 2×KASPMastermix 2.5 μl, KASP AssayMix 0.07 μl, F-HEX:F-FAM:R = 2:2:5 molar concentration ratio; The PCR reaction conditions were as follows: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ for each cycle, for a total of 10 cycles; 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles. If the amplification effect was not ideal, more cycles could be added, 3 cycles each time, up to a maximum of three cycles. After the reaction was completed, the fluorescence data of the KASP reaction products were read using a Pherastar scanner, and the fluorescence scan results were automatically converted into images. The fluorescence signal was detected and the genotyping status was checked using a BMG Pherastar instrument. If the genotyping was insufficient, amplification was continued, and the genotyping status was checked every 3 cycles until the genotyping was complete.
6. The application of the molecular marker BAN_A335G as described in claim 1 in the assisted breeding of leaf color trait in Brassica napus.
7. The application of the primer pair according to claim 2 in the assisted breeding of leaf color trait in Brassica napus.
8. The application of the kit according to claim 3 in the assisted breeding of leaf color trait in Brassica napus.
9. The application of the method according to claim 4 or 5 in the assisted breeding of leaf color trait in Brassica napus.