Portable RNA detection system and method based on hollow glass microspheres

Abstract

The application discloses a portable RNA detection system based on hollow glass microspheres, which comprises: hollow glass microspheres for combining with probes; probes for combining with target RNA; amplifiers for amplifying probe signals; nucleic acid dyes for developing probe signals; and a portable detection device for detecting probe fluorescent signals. The application also provides a detection method based on the detection system. The application amplifies the probe signal by one level through DSN enzyme, amplifies the probe signal by two levels through long and short chains, amplifies the probe signal by three levels by gathering the modified hollow glass microspheres in the sample hole, and judges the strength of the probe fluorescent signal by naked eyes through the portable detection device, so that the demand for early detection of tumor diseases in areas with poor medical conditions is met, and the detection of RNA can be realized outdoors or on site, thereby providing a molecular level basis for early diagnosis and analysis of RNA related diseases and tumor diseases.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and nucleic acid chemistry. More specifically, this invention relates to a portable RNA detection system and method based on hollow glass microspheres. Background Technology

[0002] Ribonucleic acid (RNA) is the carrier of genetic information found in biological cells and some viruses and viroids. Studies have found that viral RNA levels can be detected in human blood after viral infection; HIV nucleic acid testing uses the amount of HIV viral RNA in the blood to indicate the level of HIV disease. In recent years, with the deepening of RNA research, it has been discovered that some types of RNA are closely related to the occurrence of diseases. Among them, piRNA, snoRNA, lncRNAs, circRNA, and exRNAs are considered biomarkers, playing an important role in the early diagnosis and prognosis of tumor diseases. Therefore, RNA detection is crucial. Currently, the gold standard methods for RNA detection are gene sequencing and quantitative real-time PCR (qRT-PCR). However, these two methods have drawbacks such as large sample sizes, false positives, high requirements for experimental conditions, and the susceptibility to contamination during the experimental process, which is difficult to eliminate. These methods are not ideal for RNA detection in remote areas with poor medical testing conditions. Summary of the Invention

[0003] One object of the present invention is to solve at least the above-mentioned problems and to provide at least the advantages that will be described later.

[0004] One objective of this invention is to provide a portable RNA detection system based on hollow glass microspheres, which is characterized by its ease of operation, portability, and high efficiency. It can meet the needs of early detection of tumors in areas with poor medical conditions, and can also enable RNA detection outdoors or on-site.

[0005] To achieve these objectives and other advantages of the present invention, a portable RNA detection system based on hollow glass microspheres is provided, comprising:

[0006] Hollow glass microspheres for surface-modified diphenylcyclooctyne to be combined with azide-modified probes;

[0007] Probes used to bind to target RNA;

[0008] An amplifier used to amplify the probe signal;

[0009] Nucleic acid dyes used to display probe signals;

[0010] A portable detection device for visualizing the fluorescence signal of the detection probe.

[0011] Preferably, the preparation of the surface-modified diphenylcyclooctyne hollow glass microspheres includes the following steps:

[0012] 1) Mix hollow glass microspheres (GB) with polyethyleneimine or 3-aminopropyltrimethoxysilane solution, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain hollow glass microspheres with amino-modified surface.

[0013] 2) Mix the surface-modified amino hollow glass microspheres obtained in step 1) with dibenzocyclooctene-active ester, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain surface-modified diphenylcyclooctylene hollow glass microspheres.

[0014] Preferably, the hollow glass microspheres undergo etching treatment. The treatment method involves adding sodium hydroxide solution to the hollow glass microspheres, mixing them under heating conditions, centrifuging to remove the lower layer solution, washing with ultrapure water, repeating the process 1-5 times, and vacuum drying to complete the etching treatment.

[0015] Preferably, the probe has the following sequence: tctttccgcattttcccgtatgcgctttgtattattttcaacatcagtctgataagcta / 3N3 / .

[0016] Preferably, the amplifier includes a first amplifier and a second amplifier;

[0017] The first amplifier includes DSN enzyme, DSN buffer, and DSN termination solution;

[0018] The second amplifier includes a long chain that has complementary bonding capability with the probe and a short chain that has complementary bonding capability with the long chain;

[0019] The short chain has the following sequence: ttgagagtatttgagagtattt.

[0020] Preferably, the long-chain preparation method is as follows: dATP, dTTP, dCTP, MgSO4, Clean G, Hairpin, PBS, and Bst polymerase are mixed evenly and incubated at 35-40℃ for 10-20 min. Long-chain primers are added and incubated at 35-40℃ for 1-5 hours. The reaction is then terminated at 80-100℃ for 25 minutes to obtain the long-chain primers.

[0021] Clean G has the following sequence: ccccgaaagtggcctcgggccttttggcccgaggccccactttcg;

[0022] Hairpin has the following sequence: aaatactctcgggccttttggcccgagagtatttgagagtatt / 3InvdT / ;

[0023] The long primer has the following sequence: taatacaaagcgcatacgggaaaatgcggaaagagcgaggacttaatactctc.

[0024] Preferably, the nucleic acid dye is GelRed or SYBR. TM Gold or SYBR Green.

[0025] Preferably, the portable detection device includes:

[0026] The testing box has a rectangular structure and is composed of four detachable panels. The top panel has a positioning groove, and a filter hole that penetrates the top panel is provided in the positioning groove. A filter is provided at the filter hole.

[0027] An ultraviolet lamp is installed inside the detection box. The power cord of the ultraviolet lamp has a USB connector and a power switch is installed on the power cord.

[0028] Sample well, which is used to hold the sample to be tested;

[0029] During testing, the sample well is placed inside the testing chamber.

[0030] Preferably, the sample well preparation method is as follows: mix SYLGARD™ 184 Silicone Elastomer Base and SYLGARD™ 184 Silicone Elastomer Curing, stir evenly, place in a vacuum drying oven and evacuate until the solution becomes transparent, pour it into a mold and place it in an oven to dry and shape, and take it out to obtain the sample well.

[0031] A detection method for a portable RNA detection system based on hollow glass microspheres includes the following steps:

[0032] Step 1: Extract total RNA from the sample, mix the total RNA, probe, DSN enzyme and DSN buffer evenly, incubate, add DSN stop solution to stop the reaction, and obtain the reaction product;

[0033] Step 2: Place the surface-modified diphenylcyclooctylene hollow glass microspheres, BSA solution, and PBS solution into a centrifuge tube, add the reactants from Step 1, and obtain the test mixture; place the surface-modified diphenylcyclooctylene hollow glass microspheres, probe, BSA solution, and PBS solution into a centrifuge tube to obtain the control mixture; react the test mixture and the control mixture in a vortex mixer, centrifuge after reaction, remove the supernatant, and wash 1-3 times with PBS;

[0034] Step 3: Add PBS, long-chain and short-chain PBS to the product of Step 2, react in a vortex mixer, centrifuge after the reaction is complete, remove the supernatant, and wash 1-3 times with SSC solution.

[0035] Step 4: Add nucleic acid dye to the product of Step 3, vortex mixer in the dark, after the reaction is complete, centrifuge, remove the supernatant, wash with PBS 1-3 times, add PBS, shake well, take 10-50 μL and drop into the sample well, let stand for 60-120 s.

[0036] Step 5: Place the sample well from Step 4 into the detection chamber, place the handheld terminal into the positioning slot, connect the power cord to the power supply, and turn on the power switch to achieve visual detection of the sample. You can also use the handheld terminal to take pictures of the sample well and perform fluorescence intensity analysis.

[0037] The present invention has at least the following beneficial effects:

[0038] First, compared with real-time quantitative PCR, the detection method of the present invention does not require sophisticated PCR instruments, and has the characteristics of simple operation, high detection sensitivity, high efficiency and convenience.

[0039] Secondly, this invention amplifies the probe signal through a first-stage amplification using the DSN enzyme, a second-stage amplification using long and short chains, and a third-stage amplification by assembling modified hollow glass microspheres in the sample wells. Using this portable detection device, the intensity of the probe fluorescence signal can be visually assessed, enabling preliminary screening of the test results. This meets the needs of early detection of tumors in areas with poor medical conditions and allows for RNA detection outdoors or on-site, providing molecular-level evidence for the early diagnosis and analysis of RNA-related diseases and tumors.

[0040] Third, by etching the hollow glass microspheres, this invention can increase the specific surface area of ​​the hollow glass microspheres, increase the number of probes, reduce the weight of the hollow glass microspheres, and enable them to have a faster suspension and aggregation speed.

[0041] Fourth, the surface-modified diphenylcyclooctylene hollow glass microspheres prepared by this invention use inexpensive raw materials, have good stability, and can be stored for a long time under low temperature conditions.

[0042] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the portable detection device of the present invention;

[0044] Figure 2 This is a schematic diagram of the disassembled structure of the portable detection device of the present invention;

[0045] Figure 3 This is a flowchart illustrating the preparation process of the surface-modified diphenylcyclooctylene hollow glass microspheres of the present invention.

[0046] Figure 4 TEM characterization images of GB, GB (etched), and GB@PEI;

[0047] Figure 5 Fluorescence characterization images of GB@PEI and GB@PEI@DBCO

[0048] Figure 6 This is a photographic representation of the sample well.

[0049] Figure 7 This is a gel electrophoresis image of long chains;

[0050] Figure 8 Figure showing the effect of temperature on DSN enzyme activity;

[0051] Figure 9 This graph shows the amplification effect of long chains and short circuits on fluorescence signals. The image in the upper left corner is a photograph of the sample taken in a portable detection device; the bar chart shows the fluorescence intensity of the sample detected in a nucleic acid imaging system.

[0052] Figure 10 This is a diagram from a suspension aggregation test.

[0053] Figure 11 Experimental diagram showing background interference in the sample well;

[0054] Figure 12 This is a normalized bar chart of fluorescence for detecting miRNA-21 in liver cancer cells according to the present invention;

[0055] Figure 13 This is a normalized bar chart of fluorescence for detecting miRNA-21 in lung cancer cells according to the present invention;

[0056] Figure 14 This is a normalized bar chart of fluorescence for detecting miRNA-21 in breast cancer cells, as presented in this invention.

[0057] Figure 15 This is a normalized bar chart of fluorescence for detecting miRNA-21 in blood samples from lung cancer patients, as presented in this invention. Detailed Implementation

[0058] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0059] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0060] It should be noted that, unless otherwise specified, the experimental methods described in the following embodiments are conventional methods, and the reagents and materials mentioned are commercially available. In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "setting" should be interpreted broadly. For example, they can refer to fixed connection or setting, detachable connection or setting, or integral connection or setting. Those skilled in the art can understand the specific meaning of the above terms in this invention based on the specific circumstances. The terms "lateral," "longitudinal," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings, and are only for the convenience of describing this invention and simplifying the description. They do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of this invention.

[0061] A portable RNA detection system based on hollow glass microspheres, characterized in that it comprises:

[0062] Hollow glass microspheres for surface-modified diphenylcyclooctyne to be combined with azide-modified probes;

[0063] Probes used to bind to target RNA;

[0064] An amplifier used to amplify the probe signal;

[0065] Nucleic acid dyes used to display probe signals;

[0066] A portable detection device for visualizing the fluorescence signal of the detection probe.

[0067] In another technical solution, the preparation of the surface-modified diphenylcyclooctylene hollow glass microspheres includes the following steps:

[0068] 1) Mix hollow glass microspheres with polyethyleneimine or 3-aminopropyltrimethoxysilane solution, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain hollow glass microspheres with amino-modified surface.

[0069] 2) Mix the surface-modified amino hollow glass microspheres obtained in step 1) with dibenzocyclooctene-active ester, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain surface-modified diphenylcyclooctylene hollow glass microspheres.

[0070] In another technical solution, the hollow glass microspheres are processed by the following method: sodium hydroxide solution is added to the hollow glass microspheres, they are mixed under heating conditions, the lower layer solution is removed by centrifugation, they are washed with ultrapure water, and the process is repeated 1-5 times, followed by vacuum drying.

[0071] In another technical solution, the probe (SEQ ID NO.1) has the following sequence: tctttccgcattttcccgtatgcgctttgtattattttcaacatcagtctgataagcta / 3N3 / . The 3' end of the probe is modified with azide.

[0072] In another technical solution, the amplifier includes a first amplifier and a second amplifier;

[0073] The first amplifier includes DSN enzyme, DSN buffer, and DSN termination solution;

[0074] The second amplifier includes a long chain that has complementary bonding capability with the probe and a short chain that has complementary bonding capability with the long chain;

[0075] The short chain (SEQ ID NO.2) has the following sequence: ttgagagtatttgagagtattt.

[0076] In another technical solution, the long chain is prepared as follows: dATP, dTTP, dCTP, MgSO4, Clean G, Hairpin, PBS, and Bst polymerase are mixed evenly and incubated at 35-40℃ for 10-20 min. Long chain primers are added and incubated at 35-40℃ for 1-5 hours. The reaction is then terminated at 80-100℃ for 25 min to obtain the long chain.

[0077] Clean G (SEQ ID NO.3) has the following sequence: ccccgaaagtggcctcgggccttttggcccgaggccactttcg;

[0078] Hairpin (SEQ ID NO.4) has the following sequence: aaatactctcgggccttttggcccgagagtatttgagagtatt / 3InvdT / ;

[0079] The long primer (SEQ ID NO.5) has the following sequence: taatacaaagcgcatacgggaaaatgcggaaagagcgaggacttaatactctc. The 3' end of the hairpin is modified with deoxythymidine nucleotide.

[0080] In another technical solution, the nucleic acid dyes are GelRed and SYBR. TM Gold or SYBR Green.

[0081] In another technical solution, such as Figure 1-2 As shown, the portable detection device includes:

[0082] The testing box has a rectangular structure and is composed of four detachable panels. The top panel has a positioning groove, and a filter hole that penetrates the top panel is provided in the positioning groove. A filter is provided at the filter hole.

[0083] An ultraviolet lamp is installed inside the detection box. The power cord of the ultraviolet lamp has a USB connector and a power switch is installed on the power cord.

[0084] The sample well is used to hold the sample to be tested. During testing, the sample well is placed in the testing chamber.

[0085] In another technical solution, the portable detection device also includes a handheld terminal device, which has the functions of taking pictures and processing information. The handheld terminal device has a pre-stored curve of the image R value and fluorescence intensity fitting. The handheld terminal device is used to take pictures of the sample wells in the detection box and analyze the R value of the obtained image. Based on the R value of the image and the fitted curve, the fluorescence values ​​of the experimental sample wells and the control sample wells are obtained. The fluorescence values ​​of the experimental sample wells and the control sample wells are normalized and the normalized fluorescence value of the experimental sample wells is output.

[0086] Normalized fluorescence value of the test sample well = (F - F0) / ΔF;

[0087] F represents the measured fluorescence value of the test sample well;

[0088] F0 is 2000a.u.;

[0089] ΔF is Fmax - F0;

[0090] Fmax is the measured fluorescence value of the control sample well.

[0091] In this technical solution, the handheld terminal device can be a mobile phone. When staining with GelRed nucleic acid dye, the product emits red fluorescence under ultraviolet light. This invention utilizes the characteristic that images with different fluorescence intensities have different RGB values, and fits them to obtain an R-value-fluorescence intensity relationship curve. When processing the samples, the experimental group and control group samples are placed in the sample wells and placed in the detection chamber. The ultraviolet light is turned on, and the handheld terminal device is used to image the samples. The handheld terminal device processes the images to obtain the R values ​​in the RGB values ​​of the experimental group and control group positions in the images. Based on the obtained R values ​​of the experimental group sample wells and the control group sample wells, the handheld terminal device calculates the fluorescence intensity of the experimental group sample wells and the control group sample wells using the fitted curve, performs normalization processing, and outputs the fluorescence intensity value of the experimental group sample wells.

[0092] In another technical solution, the sample well is prepared by: mixing SYLGARD™ 184 Silicone Elastomer Base and SYLGARD™ 184 Silicone Elastomer Curing evenly, placing them in a vacuum drying oven and evacuating the vacuum until the solution becomes transparent, pouring it into a mold and placing it in an oven to dry and shape it, and then taking it out to obtain the sample well.

[0093] A detection method for a portable RNA detection system based on hollow glass microspheres includes the following steps:

[0094] Step 1: Extract total RNA from the sample, mix the total RNA, probe, DSN enzyme and DSN buffer evenly, incubate, add DSN stop solution to stop the reaction, and obtain the reaction product;

[0095] Step 2: Place the surface-modified diphenylcyclooctylene hollow glass microspheres, BSA solution, and PBS solution into a centrifuge tube, add the reactants from Step 1, and obtain the test mixture; place the surface-modified diphenylcyclooctylene hollow glass microspheres, probe, BSA solution, and PBS solution into a centrifuge tube to obtain the control mixture; react the test mixture and the control mixture in a vortex mixer, centrifuge after reaction, remove the supernatant, and wash 1-3 times with PBS;

[0096] Step 3: Add PBS, long-chain and short-chain PBS to the product of Step 2, react in a vortex mixer, centrifuge after the reaction is complete, remove the supernatant, and wash 1-3 times with SSC solution.

[0097] Step 4: Add nucleic acid dye to the product of Step 3, vortex mixer in the dark, after the reaction is complete, centrifuge, remove the supernatant, wash with PBS 1-3 times, add PBS, shake well, take 10-50 μL and drop into the sample well, let stand for 60-120 s.

[0098] Step 5: Place the sample well from Step 4 into the detection chamber, place the handheld terminal into the positioning slot, connect the power cord to the power supply, and turn on the power switch to achieve visual detection of the sample. You can also use the handheld terminal to take pictures of the sample well and perform fluorescence intensity analysis.

[0099] <Experiment 1>

[0100] like Figure 3 As shown, a method for preparing hollow glass microspheres with surface-modified diphenylcyclooctyne (DBCO) includes the following steps:

[0101] 1) Weigh 1g of hollow glass microspheres and add them to a 50mL centrifuge tube. Add 20mL of 0.5M sodium hydroxide solution and a stir bar, and mix at 80℃ for 2h in a magnetic stirring heater.

[0102] 2) Centrifuge the mixture from step 1) at 1000 rpm for 1 min to remove the lower layer solution; wash with ultrapure water, repeat centrifugation 3 times, and vacuum dry at 37℃ to obtain surface-etched hollow glass microspheres, which are then stored at -20℃.

[0103] 3) Weigh 100 mg of etched hollow glass microspheres, add 2 mg / mL of polyethyleneimine (PEI) aqueous solution and mix in a rotary mixer for 15 min. After the reaction is complete, centrifuge at 4000 rpm for 10 s, remove the lower layer solution, wash with ultrapure water, repeat centrifugation 3 times and vacuum dry to obtain surface-modified amino hollow glass microspheres (GB@PEI).

[0104] 4) Weigh 20 mg GB@PEI into 400 μL of PBS solution with 1 mM DBCO-NHS, react at room temperature for 1 h, centrifuge at 4000 rpm for 10 s, remove the lower layer solution, wash with ultrapure water, repeat centrifugation 3 times, and then vacuum dry to obtain hollow glass microspheres (GB@PEI@DBCO) with surface modified diphenylcyclooctylene.

[0105] <Experiment 2>

[0106] A method for preparing hollow glass microspheres with surface-modified diphenylcyclooctyne (DBCO) includes the following steps:

[0107] 1) Weigh 1g of hollow glass microspheres and add them to a 50mL centrifuge tube. Add 20mL of 0.5M sodium hydroxide solution and a stir bar, and mix at 80℃ for 2h in a magnetic stirring heater.

[0108] 2) Centrifuge the mixture from step 1) at 1000 rpm for 1 min to remove the lower layer solution; wash with ultrapure water, repeat centrifugation 3 times, and vacuum dry at 37℃ to obtain surface-etched hollow glass microspheres, which are then stored at -20℃.

[0109] 3) Weigh 500 mg of etched hollow glass microspheres, add 500 μL of 3-aminopropyltrimethoxysilane (APTMS) and mix in a rotary mixer for 1 h. After the reaction is complete, centrifuge at 4000 rpm for 10 s, remove the lower layer solution, wash with ultrapure water, repeat centrifugation 3 times, and then vacuum dry to obtain surface-modified amino hollow glass microspheres (GB@NH2).

[0110] 4) Weigh 20 mg GB@NH2 into 400 μL of 1 mM DBCO-NHS PBS solution, react at room temperature for 1 h, centrifuge at 4000 rpm for 10 s, remove the lower layer solution, wash with ultrapure water, repeat centrifugation 3 times, and then vacuum dry to obtain hollow glass microspheres (GB@NH2@DBCO) modified with diphenylcyclooctyne (DBCO).

[0111] This invention, by etching hollow glass microspheres, can increase the specific surface area of ​​the hollow glass microspheres to increase the number of probes connected, and can also reduce the density of the hollow glass microspheres, making them easier to suspend on the liquid surface and more likely to aggregate together.

[0112] <Experiment 3>

[0113] The hollow glass microspheres (GB), etched hollow glass microspheres, surface-modified amino hollow glass microspheres (GB@PEI), and surface-modified diphenylcyclooctylene hollow glass microspheres (GB@PEI@DBCO) from Experiment 1 were characterized.

[0114] Electrolytic characterization was performed on GB, GB (etched), and GB@PEI, and observation was conducted using TEM. Figure 4 As shown, the surface of ordinary GB is relatively flat and smooth. However, the surface of the hollow glass microspheres etched with NaOH has obvious depressions, indicating that GB was successfully etched. Furthermore, after applying a PEI coating, a nanofilm can be observed to form on the surface, proving that PEI was successfully coated on the GB surface.

[0115] Fluorescence characterization was performed on GB@PEI and GB@PEI@DBCO. Since diphenylcyclooctyne (DBCO) reacts with azide (N3), the coating on the surface of the hollow glass microspheres can be characterized using a Cy3 azide fluorescent dye (Cy3-N3). 1 mg of GB@PEI and GB@PEI@DBCO were weighed and reacted in PBS solution containing 1 mM Cy3-N3 at 37°C for 5 minutes. The mixture was washed five times with ultrapure water and observed using an inverted fluorescence microscope.

[0116] Fluorescence characterization results as follows Figure 5 As shown, after staining with Cy3-N3, the surface of GB@PEI@DBCO modified with DBCO showed a significant fluorescence signal (right), while the surface of GB@PEI without DBCO modification showed no signal (left). This demonstrates that DBCO successfully modified the surface of the hollow glass microspheres.

[0117] The characterization results of GB@NH2@DBCO prepared in Experiment 2 were similar to those of Experiment 1.

[0118] <Experiment 4>

[0119] A method for preparing a sample well, specifically, weighing SYLGARD... TM 184 Silicone Elastomer Base25g, SYLGARD TM 184 Silicone Elastomer Curing: 2.5g was placed in a disposable plastic cup and stirred for 5 minutes until homogeneous. The mixture was then placed in a vacuum drying oven and vacuum-dried until the solution became transparent. This solution was poured into a mold and dried in an 80℃ oven for 40 minutes. The result was as follows: Figure 6 The sample well is shown.

[0120] <Experiment 5>

[0121] A method for preparing long-chain primers for amplifiers, specifically, involves taking 10 μL of dATP, dTTP, dCTP (6 mM), 10 μL of MgSO4 (100 mM), 10 μL of Clean G (1 μM), 10 μL of Hairpin (5 μM), 10 μL of 10×PBS, Bst polymerase, and 30 μL of sterile water and incubating in a PCR tube at 37°C for 15 minutes. Then, 10 μL of long-chain primers (10 μM) are added, and the mixture is incubated at 37°C for 3 hours. The reaction is then terminated at 80°C for 25 minutes.

[0122] To observe the effect of long-chain synthesis, 2% agarose gel electrophoresis was performed, and the results are as follows. Figure 7 As shown, the synthesized long chains are between 100bp and 500bp, indicating that the long chain synthesis was successful.

[0123] <Experiment Six>

[0124] Investigating the effect of temperature on the activity of DSN enzyme in the amplifier

[0125] Take 1 μL of probe N3-Bridge (10 μM), 1 μL of miRNA-21 (1 μM), 0.5 μL of 0.5 U / μL DSN enzyme, and 7.5 μL of DSN buffer (containing 0.5 μL of 40 U / μL RNase inhibitor, 1 μL of DSN Master, and 6 μL of LDPPC-treated water) into a 200 μL centrifuge tube. Incubate each tube at 25℃, 40℃, 60℃, and 80℃ for 1 hour, respectively. After the reaction, add 2 μL of bromophenol blue buffer. Also, set up control tubes. Take 6 μL from each tube and electrophores it onto a polyacrylamide gel at 80V for 80 minutes. After electrophoresis, remove the gel, mix it with 3×GelRed nucleic acid dye, and stain for 30 minutes. The results are as follows: Figure 8 As shown. Compared to other temperature conditions, the DSN enzyme activity was best at 60℃ (lane 6), achieving near-complete cleavage. Therefore, 60℃ was chosen as the incubation temperature for the DSN enzyme.

[0126] <Experiment Seven>

[0127] The experiment on the effects of long and short chains on fluorescence signals specifically includes the following steps:

[0128] 1) Take 5 mg of GB@PEI@DBCO and add 1.25 mL of PBS to a 2 mL centrifuge tube to prepare a 200 μg / 50 μL GB@PEI@DBCO solution. Take 100 μL of the solution and add 20 μL of bovine serum albumin (BSA), 2 μL of probe N3-Bridge, and 78 μL of PBS to a centrifuge tube. Vortex the solution at 1000 rpm for 30 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with PBS.

[0129] 2) Add 160 μL of PBS to the product from step 1), take half of it and add 10 μL of long chain and 10 μL of short chain to a new centrifuge tube, add the other half of the product to 20 μL of PBS, vortex at 1000 rpm for 20 min, after the reaction is complete, centrifuge at 4000 rpm for 10 s, remove the supernatant, and wash twice with SSC solution.

[0130] 3) In step 2), add 100 μL of 1×GelRed nucleic acid dye to each tube and vortex at 1000 rpm for 5 minutes in the dark. After the reaction, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, wash twice with PBS, add 200 μL of PBS, shake well, and drop 25 μL into the sample well. Observe using a portable detection device. It can be seen that the test tubes with introduced long and short chains have significantly stronger fluorescence signals compared to those without introduced long and short chains. This can also be observed visually. The fluorescence images of the sample wells are analyzed using a handheld terminal device, and the obtained fluorescence intensity is as follows: Figure 9 As shown.

[0131] <Experiment 8>

[0132] The effect of suspension aggregation characteristics on the test

[0133] Test materials

[0134] Sample A: GB@PEI@DBCO prepared in Example 1.

[0135] Sample B: The preparation method is the same as that in Example 1, except that the hollow glass microspheres were not etched, that is, the hollow glass microspheres were not processed in steps 1) and 2).

[0136] Take 10 mg of sample A and sample B into centrifuge tubes respectively, add 1.8 mL of PBS, shake both tubes well and let stand, then observe the suspension and aggregation state at different time points. Figure 10 As shown, after etching, hollow glass microspheres were almost entirely suspended and aggregated within 60 seconds. Unetched hollow glass microspheres, however, required 240 seconds to achieve the same suspension and aggregation.

[0137] <Experiment Nine>

[0138] Sample well background interference test

[0139] Take 25 μL of the product prepared in step 3) of <Experiment Seven> and place it into the sample wells prepared in this invention and the 96-well plate made of polystyrene material. Place it in the detection chamber and take an image using a handheld terminal device, as shown in the image. Figure 11 As shown. Figure 11 In Figure A, a 96-well plate made of purchased polystyrene material is shown, and in Figure B, a sample well prepared according to this invention is shown. It can be seen that the sample wells prepared according to this invention show fluorescence only at the sample well locations, with no fluorescence observed elsewhere, resulting in a relatively clean background. This makes it possible to use a portable detection device in conjunction with a mobile phone to identify and analyze the fluorescence intensity of the sample wells.

[0140] <Example 1>

[0141] The detection of miRNA-21 in liver cancer cells using a portable RNA detection system based on hollow glass microbeads includes the following steps:

[0142] 1) 10 cells were extracted using a commercially available cell RNA extraction kit. 5 15 μL of total RNA solution was obtained from each HepG2 (human liver cancer) cell. 1 μL of total RNA solution, 1 μL of probe N3-Bridge (10 μM), 0.5 μL of 0.5 U / μL DSN enzyme, and 7.5 μL of DSN buffer (containing 0.5 μL of 40 U / μL RNase inhibitor, 1 μL of DSN Master, and 6 μL of LDPPC-treated water) were added to a 200 μL centrifuge tube and incubated at 60 °C for 60 minutes. After the reaction was complete, 10 μL of DSN stop solution was added and the mixture was shaken well.

[0143] 2) For the experimental group, 50 μL of 4 μg / μL GB@PEI@DBCO solution, 10 μL of BSA, and 10 μL of PBS were placed in a centrifuge tube, and the product from step 1) was added. For the negative control group, 50 μL of 4 μg / μL GB@PEI@DBCO solution, 1 μL of probe N3-Bridge (10 μM), 10 μL of BSA, and 39 μL of PBS were added. After the addition was complete, the mixture was vortexed at 1000 rpm for 30 minutes. After the reaction was completed, the mixture was centrifuged at 4000 rpm for 10 seconds, the supernatant was removed, and the mixture was washed twice with PBS.

[0144] 3) Add 80 μL PBS, 10 μL long chain and 10 μL short chain to the product from step 2), and vortex mix at 1000 rpm for 20 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with SSC solution.

[0145] 4) In step 3), add 100 μL of 1×GelRed nucleic acid dye to each tube of product and vortex at 1000 rpm for 5 minutes in the dark. After the reaction, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, wash twice with PBS, add 200 μL of PBS, shake well, and drop 25 μL into the sample well. Let stand for 60 seconds and observe in a portable detection device. It can be seen with the naked eye that the fluorescence signal of the negative control group is significantly stronger than that of the experimental group. The fluorescence intensity results obtained by analyzing the fluorescence images of the sample wells using a handheld terminal device are as follows. Figure 12 As shown, compared with the negative control group, the fluorescence intensity of the HepG2 experimental group decreased significantly, indicating that the portable RNA detection system of the present invention can be used to detect miRNA-21 in human liver cancer cells.

[0146] <Example 2>

[0147] To investigate the detection of miR-21 in lung cancer cells using a portable RNA detection system based on hollow glass microbeads.

[0148] 1) 10 cells were extracted using a commercially available cell RNA extraction kit. 5 15 μL of total RNA solution was obtained from each A549 (human lung cancer) cell. 1 μL of total RNA solution, 1 μL of probe N3-Bridge (10 μM), 0.5 μL of 0.5 U / μL DSN enzyme, and 7.5 μL of DSN buffer (containing 0.5 μL of 40 U / μL RNase inhibitor, 1 μL of DSN Master, and 6 μL of DEPC-treated water) were added to a 200 μL centrifuge tube and incubated at 60°C for 60 minutes. After the reaction was complete, 10 μL of DSN stop solution was added and the mixture was shaken well.

[0149] 2) Take 50 μL of 4 μg / μL GB@PEI@DBCO solution, 10 μL of BSA, and 10 μL of PBS into a centrifuge tube, and add the product from step 1); the negative control group consists of 50 μL of 4 μg / μL GB@PEI@DBCO solution, 1 μL of probe N3-Bridge (10 μM), 10 μL of BSA, and 39 μL of PBS; after the addition is complete, vortex at 1000 rpm for 30 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with PBS;

[0150] 3) Add 80 μL PBS, 10 μL long chain and 10 μL short chain to the product from step 2), and vortex mix at 1000 rpm for 20 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with SSC solution.

[0151] 4) In step 3), add 100 μL of 1×GelRed nucleic acid dye to each tube of product and vortex at 1000 rpm for 5 minutes in the dark. After the reaction, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, wash twice with PBS, add 200 μL of PBS, shake well, and drop 25 μL into the sample well. Let stand for 60 seconds and observe in a portable detection device. It can be seen with the naked eye that the fluorescence signal of the negative control group is significantly stronger than that of the experimental group. The fluorescence intensity of the sample wells was analyzed using a handheld terminal device, and the results are as follows: Figure 13 As shown, compared with the negative control group, the fluorescence intensity of the A549 experimental group decreased significantly, indicating that the portable RNA detection system of the present invention can be used to detect miRNA-21 in human liver cancer cells.

[0152] <Example 3>

[0153] To investigate the detection of miR-21 in breast cancer cells using a portable RNA detection system based on hollow glass microspheres.

[0154] 1) 10 cells were extracted using a commercially available cell RNA extraction kit. 5 15 μL of total RNA solution was obtained from MCF-7 (human breast cancer) cells. 1 μL of total RNA solution, 1 μL of probe N3-Bridge (10 μM), 0.5 μL of 0.5 U / μL DSN enzyme, and 7.5 μL of DSN buffer (containing 0.5 μL of 40 U / μL L RNase inhibitor, 1 μL of DSN Master, and 6 μL of LDPPC-treated water) were added to a 200 μL centrifuge tube and incubated at 60 °C for 60 minutes. After the reaction was complete, 10 μL of DSN stop solution was added and the mixture was shaken well.

[0155] 2) Take 50 μL of 4 μg / μL GB@PEI@DBCO solution, 10 μL of BSA, and 10 μL of PBS into a centrifuge tube, and add the product from step 1); the negative control group consists of 50 μL of 4 μg / μL GB@PEI@DBCO solution, 1 μL of N3-Bridge (10 μM), 10 μL of BSA, and 39 μL of PBS; after the addition is complete, vortex at 1000 rpm for 30 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with PBS;

[0156] 3) Add 80 μL PBS, 10 μL long chain and 10 μL short chain to the product from step 2), and vortex at 1000 rpm for 20 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with SSC solution.

[0157] 4) In step 3), add 100 μL of 1×GelRed nucleic acid dye to each tube of product and vortex at 1000 rpm for 5 minutes in the dark. After the reaction, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, wash twice with PBS, add 200 μL of PBS, shake well, and drop 25 μL into the sample well. Let stand for 60 seconds and observe in a portable detection device. It can be seen with the naked eye that the fluorescence signal of the negative control group is significantly stronger than that of the experimental group. The fluorescence intensity results obtained by analyzing the fluorescence images of the sample wells using a handheld terminal device are as follows. Figure 14 As shown, compared with the negative control group, the fluorescence intensity of the MCF-7 experimental group decreased significantly, indicating that the portable RNA detection system of the present invention can be used to detect miRNA-21 in human liver cancer cells.

[0158] <Example 4>

[0159] To investigate the detection of miR-21 in clinical blood samples from lung cancer patients using a portable RNA detection system based on hollow glass microspheres.

[0160] 1) 30 μL of total RNA solution was obtained from the plasma of lung cancer patients using a commercially available plasma RNA extraction kit. 4 μL of total RNA solution, 1 μL of probe N3-Bridge (10 μM), 0.5 μL of 0.5 U / μL DSN enzyme, and 3.5 μL of DSN buffer (containing 0.5 μL of 40 U / μL RNase inhibitor, 1 μL of DSN Master, and 2 μL of DEPC-treated water) were added to a 200 μL centrifuge tube and incubated at 60 °C for 60 minutes. After the reaction was complete, 10 μL of DSN stop solution was added and the mixture was shaken well.

[0161] 2) Take 50 μL of 4 μg / μL GB@PEI@DBCO solution, 10 μL of BSA, and 10 μL of PBS into a centrifuge tube, and add the product from step 1); the negative control group consists of 50 μL of 4 μg / μL GB@PEI@DBCO solution, 1 μL of probe N3-Bridge (10 μM), 10 μL of BSA, and 39 μL of PBS; after the addition is complete, vortex at 1000 rpm for 30 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with PBS;

[0162] 3) Add 80 μL PBS, 10 μL long chain and 10 μL short chain to the product from step 2), and vortex mix at 1000 rpm for 20 minutes. After the reaction is complete, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, and wash twice with SSC solution.

[0163] 4) In step 3), add 100 μL of 1×GelRed nucleic acid dye to each tube of product and vortex at 1000 rpm for 5 minutes in the dark. After the reaction, centrifuge at 4000 rpm for 10 seconds, remove the supernatant, wash twice with PBS, add 200 μL of PBS, shake well, and drop 25 μL into the sample well. Let stand for 60 seconds and observe in a portable detection device. It can be seen with the naked eye that the fluorescence signal of the negative control group is significantly stronger than that of the experimental group. The fluorescence intensity results obtained by analyzing the fluorescence images of the sample wells using a handheld terminal device are as follows. Figure 15 As shown, compared with the negative control group, the fluorescence intensity of the lung cancer experimental group decreased significantly, indicating that the portable RNA detection system of the present invention can be used to detect miRNA-21 in human liver cancer cells.

[0164] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A portable RNA detection system based on hollow glass microspheres, characterized in that, include: Hollow glass microspheres for surface-modified diphenylcyclooctylene to be combined with azide-modified probes; A probe for binding to target RNA, wherein the probe is azide-modified and the sequence of the probe is shown in SEQ ID NO.1; An amplifier for amplifying probe signals, the amplifier comprising a first amplifier and a second amplifier; the first amplifier comprising DSN enzyme, DSN buffer, and DSN termination solution; the second amplifier comprising a long chain having complementary binding ability to the probe and a short chain having complementary binding ability to the long chain; wherein the sequence of the short chain is shown in SEQ ID NO.2; The long-chain preparation method is as follows: dATP, dTTP, dCTP, MgSO4, Clean G, Hairpin, PBS, and Bst polymerase are mixed evenly and incubated at 35-40 ℃ for 10-20 min. Long-chain primers are added and incubated at 35-40 ℃ for 1-5 hours. The reaction is then terminated at 80-100 ℃ for 25 minutes to obtain the long-chain. The sequence of Clean G is shown in SEQ ID NO.3; The sequence of the hairpin is shown in SEQ ID NO.4; The sequence of the long primer is shown in SEQ ID NO.5; Nucleic acid dyes used to display probe signals; A portable detection device for visualizing the fluorescence signal of the detection probe.

2. The portable RNA detection system based on hollow glass microspheres according to claim 1, characterized in that, The preparation of the surface-modified diphenylcyclooctylene hollow glass microspheres includes the following steps: 1) Mix hollow glass microspheres with polyethyleneimine or 3-aminopropyltrimethoxysilane solution, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain hollow glass microspheres with amino-modified surface. 2) Mix the surface-modified amino hollow glass microspheres obtained in step 1) with dibenzocyclooctene-active ester, centrifuge, remove the lower layer solution, wash with ultrapure water, repeat 1-5 times, and vacuum dry to obtain surface-modified diphenylcyclooctylene hollow glass microspheres.

3. The portable RNA detection system based on hollow glass microspheres according to claim 2, characterized in that, The hollow glass microspheres undergo etching treatment. The specific method is to add sodium hydroxide solution to the hollow glass microspheres, mix them under heating conditions, remove the lower layer solution by centrifugation, wash them with ultrapure water, repeat 1-5 times, and then vacuum dry them to complete the etching treatment.

4. The portable RNA detection system based on hollow glass microspheres according to claim 1, characterized in that, The nucleic acid dyes are GelRed, SYBR™ Gold, or SYBR Green.

5. The portable RNA detection system based on hollow glass microspheres according to claim 1, characterized in that, The portable detection device includes: The testing box has a rectangular structure and is composed of four detachable panels. The top panel has a positioning groove, and a filter hole that penetrates the top panel is provided in the positioning groove. A filter is provided at the filter hole. An ultraviolet lamp is installed inside the detection box. The power cord of the ultraviolet lamp has a USB connector and a power switch is installed on the power cord. Sample well, which is used to hold the sample to be tested; During testing, the sample well is placed in the testing chamber.

6. The portable RNA detection system based on hollow glass microspheres according to claim 5, characterized in that, The sample well preparation method is as follows: SYLGARD™ 184 Silicone Elastomer Base and SYLGARD™ 184 Silicone Elastomer Curing are stirred and mixed evenly, placed in a vacuum drying oven and evacuated until the solution becomes transparent, poured into a mold and placed in an oven to dry and shape, and then taken out to obtain the sample well.

Images