Bacillus subtilis with DNA phosphorothioacylation modification and application thereof

Abstract

This invention discloses a Bacillus subtilis strain with DNA phosphorus-thioylation modification and its applications, belonging to the field of biochemistry. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 28472. This strain, containing DNA phosphorus-thioylation modification, was screened from traditional fermented foods in Guizhou. Specific primers for screening this Bacillus subtilis were dndB-F and dndB-R, and the method was real-time quantitative PCR. This strain can significantly increase the activities of glutathione peroxidase and superoxide dismutase, and significantly reduce the elevated levels of protein carbonyl groups and malondialdehyde caused by ethanol-induced oxidative stress, thereby effectively improving the body's ability to scavenge reactive oxygen species. This strain can also increase the reduction in serum total protein content caused by ethanol damage and can be applied to fermented foods or pharmaceuticals to improve immunity, anti-aging, and regulate intestinal flora.

Description

Technical Field

[0001] This invention relates to the field of biochemistry, and more particularly to a Bacillus subtilis strain with DNA phosphorus thioylation modification and its applications. Background Technology

[0002] During aerobic metabolism, organisms produce reactive oxygen species (ROS), such as peroxides and oxygen free radicals. Free radicals are normal metabolic byproducts, and their production and elimination are normally in dynamic equilibrium. Small amounts of free radicals do not harm the body, but when there are excessive free radicals, those with strong oxidizing properties can trigger lipid peroxidation, damaging cell membranes. Furthermore, they can bind to intracellular proteins, nucleic acids, and other biomolecules, disrupting their structure and function. This imbalance between high ROS and low antioxidant levels, leading to oxidative stress, is a significant factor contributing to aging and diseases such as cancer, diabetes, atherosclerosis, and cardiovascular disease. Intervention in oxidative stress and the restoration of redox balance have become hot research topics both domestically and internationally.

[0003] Probiotics are widely distributed in nature and exert beneficial effects on the host's health by improving the balance of gut microbiota in the host's intestines. They play an important role in the food, industrial, and agricultural sectors. my country is the world's largest producer and user of antibiotics, and also a major area of ​​antibiotic abuse and bacterial resistance. Probiotics, with their advantages of being green, highly effective, non-resistant, and residue-free, are considered the optimal alternative to antibiotics.

[0004] Bacillus is a genus of Gram-positive bacteria that are aerobic or facultative anaerobic. Their spore-forming properties allow them to withstand extreme environments such as high temperatures and extreme acids. Currently, Bacillus species widely used as probiotics in the food, industrial, agricultural, and pharmaceutical fields include Bacillus coagulans, Bacillus subtilis, Bacillus licheniformis, and Bacillus amyloliquefaciens. Bacillus subtilis, in particular, produces proteases, amylases, cellulases, and nattokinase, and possesses digestive-promoting and plant-animal-inhibiting properties, making it widely used in the food industry, aquaculture and animal husbandry, plant disease control, and medicine.

[0005] DNA phosphorus thioylation is a widespread modification of the DNA double helix backbone in bacteria, where a non-bridging oxygen atom is replaced by a sulfur atom. Studies have found that phosphorus thioylated DNA has the ability to resist reactive oxygen species (ROS), giving bacteria greater tolerance to common oxidants such as hydrogen peroxide. Young nematodes that have been fed phosphorus thioylated bacteria for a long period show a significant decrease in ROS levels, thus having a life-extending effect.

[0006] Many bacteria in the genus Bacillus, especially Bacillus subtilis, have phosphorus-sulfonylation modifications on their genomic DNA. Currently, there are no reports of Bacillus subtilis containing DNA phosphorus-sulfonylation modifications being used in fermented foods, health foods, or pharmaceuticals.

[0007] Therefore, those skilled in the art are dedicated to developing a Bacillus subtilis strain with DNA phosphorus thioylation modification and its application as an antioxidant and serum total protein enhancer, as well as as a probiotic. Summary of the Invention

[0008] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is how to develop a Bacillus subtilis with DNA phosphorus thioylation modification and use it as an antioxidant and serum total protein enhancer as well as a probiotic.

[0009] To achieve the above objectives, the present invention provides a Bacillus subtilis modified with DNA phosphorus thioylation. Bacillus subtilis was deposited on September 19, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 28472 and Latin scientific name: Bacillus subtilis ZJ4-E4-1.

[0010] Furthermore, the nucleotide sequence of the 16S rDNA gene of Bacillus subtilis is shown in SEQ ID NO: 1.

[0011] The present invention also provides specific primers for screening Bacillus subtilis, the specific primers being dndB-F and dndB-R, the dndB-F sequence being CACGCAGTCAATACTACTTCTTC; and the dndB-R sequence being AGAGATTCTATAAAGACACCATGACC.

[0012] This invention also provides a Bacillus subtilis-based antioxidant reagent for preparing animal models of ethanol injury.

[0013] Furthermore, antioxidant properties include providing glutathione peroxidase activity, increasing superoxide dismutase activity, and reducing protein carbonyl and malondialdehyde levels in the body.

[0014] This invention also provides a reagent for using Bacillus subtilis to increase serum total protein content in the preparation of an animal model of acute ethanol injury.

[0015] Furthermore, the acute ethanol injury animal model is characterized by the large intake of ethanol, which activates oxygen molecules to produce free radicals, leading to oxidative stress in tissue cells and depletion of reduced glutathione in the body, resulting in acute alcoholic liver injury.

[0016] The present invention also provides a microbial inoculant containing Bacillus subtilis or its fermentation product.

[0017] Furthermore, probiotics can be added to pharmaceuticals, fermented foods, or health products to enhance the body's immunity.

[0018] Furthermore, enhancing the body's immunity includes maintaining normal levels of total serum protein and improving the body's ability to fight free radicals.

[0019] Furthermore, the microbial agent can be a solid agent or a liquid agent.

[0020] Furthermore, the application of Bacillus subtilis or its ferments in the preparation of fermented foods, health products or pharmaceuticals that enhance antioxidant capacity and boost immunity.

[0021] In a preferred embodiment 1 of the present invention, the isolation and identification of Bacillus subtilis containing DNA phosphorus thioylation modification are described in detail.

[0022] In another preferred embodiment 2 of the present invention, the strain identification process is described in detail;

[0023] In another preferred embodiment 3 of the present invention, the animal testing process for the safety of Bacillus subtilis ZJ4-E4-1 is described in detail.

[0024] In another preferred embodiment 4 of the present invention, the process of applying Bacillus subtilis ZJ4-E4-1 to an animal model experiment of ethanol injury is described in detail.

[0025] In another preferred embodiment 5 of the present invention, the preparation process of Bacillus subtilis ZJ4-E4-1 probiotic tablets is described in detail.

[0026] In another preferred embodiment 6 of the present invention, the process of applying Bacillus subtilis ZJ4-E4-1 to fermented foods is described in detail.

[0027] The beneficial technical effects of this invention are as follows:

[0028] A strain of Bacillus subtilis with DNA phosphorus thioylation modification was screened from the traditional food fermented black soybeans. This strain is safe and non-toxic, and showed antioxidant effects and increased serum total protein content and enhanced immunity in an acute alcohol injury model. Conserved primers were designed based on the DNA phosphorus thioylation modification gene sequence of Bacillus subtilis, and real-time fluorescence quantitative PCR was used to isolate and screen the DNA phosphorus thioylation modified Bacillus subtilis. It can be further developed into a probiotic that can be used in pharmaceuticals, fermented foods or health products to help maintain normal serum total protein content and improve the body's ability to fight free radicals, thereby enhancing the body's immunity.

[0029] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description

[0030] Figure 1 This is a diagram showing the amplification results of the DNA phosphorus thioylation modification gene of Bacillus subtilis ZJ4-E4-1, a preferred embodiment of the present invention.

[0031] Figure 2 This is a diagram showing the iodine cleavage verification results of the Bacillus subtilis ZJ4-E4-1 gDNA phosphorus thioylation modification phenotype in a preferred embodiment 1 of the present invention.

[0032] Figure 3 This is a photograph of the colony morphology of Bacillus subtilis ZJ4-E4-1, a preferred embodiment 2 of the present invention.

[0033] Figure 4 This is an electron microscope image of Bacillus subtilis ZJ4-E4-1, a preferred embodiment 2 of the present invention;

[0034] Figure 5 The effects of Bacillus subtilis ZJ4-E4-1 on four oxidative stress indicators in mouse serum, which is a preferred embodiment of the present invention (4).

[0035] Figure 6 The effect of Bacillus subtilis ZJ4-E4-1 on serum total protein content in a mouse ethanol injury model is described in a preferred embodiment 4 of the present invention. Detailed Implementation

[0036] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0037] Related culture medium formulations and buffer formulations:

[0038] Nutrient medium (NB): Weigh 10 g peptone, 3 g beef extract, and 5 g sodium chloride, and dilute to 1 L with distilled water. After dissolving, adjust the pH to 7.0, sterilize at 121℃ for 20 min, and set aside. When preparing nutrient medium agar plates (NA), add 1.5% agar.

[0039] LB broth medium (LB): Weigh 10 g peptone, 10 g sodium chloride, and 10 g yeast extract, and distill water to a final volume of 1 L. After dissolving, adjust the pH to 7.0 and sterilize at 121°C for 20 min. When preparing LB agar plates (LA), add 1.5% agar.

[0040] Physiological saline: Weigh 9 g of sodium chloride, dilute to 1 L with distilled water, sterilize at 121℃ for 20 min and use.

[0041] Reference strain used in the experiment:

[0042] Standard strain: Bacillus subtilis subsp. spizizenii (ATCC6633), purchased from China Industrial Microbial Culture Collection Center (CICC).

[0043] Example 1: Bacillus subtilis containing DNA phosphorus thioylation modification was isolated and identified from fresh fermented soybeans, a traditional fermented food from Zhijin County, Guizhou Province, China.

[0044] I. Sample Source

[0045] It originates from fresh fermented soybeans, a traditional fermented food from Guizhou, China.

[0046] II. Isolation of Bacillus from Fermented Food Fresh Soybeans

[0047] Take 1g of fermented fresh black soybeans, add 9ml of physiological saline, and shake thoroughly on a shaker at 37℃ for 30 minutes. Heat in a water bath at 80℃ for 20 minutes. Dilute the suspension using a gradient method, taking 10g of each solution. -3 10 -4 10 -5 10 -6 Four dilution gradients of 500 μL were spread onto nutrient agar (NB) medium and incubated at 37 °C for 24 h under aerobic conditions. After single colonies grew on the plates, possible Bacillus strains were selected based on colony morphology and incubated overnight at 37 °C in 96-well plates. A small amount of the bacterial culture was taken for rescreening, and the remaining bacterial culture was mixed with sterile glycerol to a glycerol concentration of 20%. The bacterial culture was then frozen at -80 °C.

[0048] III. Screening of Bacillus strains containing DNA phosphorylation modification by real-time quantitative PCR (qPCR)

[0049] Based on the dndB gene sequence of Bacillus subtilis DKU_NT_03, a search was performed in the NCBI database. All retrieved dndB gene sequences from various Bacillus species were downloaded and subjected to multiple sequence alignment. Primers dndB-F and dndB-R were designed to select the most conserved region of this gene among all Bacillus species for subsequent specific amplification of the dndB gene. Bacillus species carrying the dnd gene cluster were screened. The amplification product size was 368 bp. The results are as follows: Figure 1 As shown.

[0050] The sequences of the specific primers are as follows:

[0051] dndB-F: CACGCAGTCAATACTACTTCTTC;

[0052] dndB-R: AGAGATTCTATAAAGACACCATGACC.

[0053] The bacterial culture of a single colony of Bacillus subtilis used for secondary screening was added to a qPCR system for amplification. EveGreen fluorescent dye (Shanghai Yisheng Biotechnology) was added to the qPCR system. When double-stranded PCR products are produced, EveGreen binds to DNA and emits green fluorescence, which can be detected in real time using a qPCR instrument. Using the Bacillus subtilis DKU_NT_03 dndB gene as a positive control template and water as a negative control template, samples with CT values ​​between the positive and negative controls were considered to potentially contain the DNA phosphorus-thioylation modification gene. After qPCR screening of samples capable of amplifying the dndB gene-specific product, the specificity of the amplified product bands was confirmed by agarose gel electrophoresis. Strains with CT values ​​and product band results meeting the standards were further purified by streaking multiple times on nutrient agar plates to isolate single colonies. Single colonies were cultured overnight at 37°C in NB medium, and the cells were collected and added to 20% sterile glycerol for freezing at -80°C.

[0054] IV. Phenotypic Validation of DNA Phosphorylation Modification

[0055] After isolating and screening strains, the DNA phosphorus thioylation modification gene was amplified by qPCR. The expression of the modification gene and the conferral of the genomic DNA phosphorus thioylation modification phenotype in Bacillus were then verified. The DNA phosphorus thioylation modification phenotype was verified by cutting the phosphorus thioylation modified DNA with iodine in ethanol solution; the reaction system is shown in Table 1. The results were then detected by 0.8% agarose gel electrophoresis. Figure 2 As shown. Reaction conditions: 65℃, 15 min.

[0056] Table 1. Reaction system for iodine cleavage assay for genomic DNA

[0057] 1 0.5 μg 50 mM - 2 0.5 μg 50 mM 0.1 mM 3 0.5 μg 50 mM 1 mM

[0058] Simultaneously, the amplification products of the specific primers dndB-F / dndB-R were ligated into a T vector for sequencing, and the sequencing results were compared with BLASTn sequences. Using the above method, Bacillus subtilis containing DNA phosphorus thioylation modification was screened and named ZJ4-E4-1. The sequences of its dndB-F / dndB-R amplification products are shown in SEQ ID NO:1.

[0059] Example 2: Strain Identification

[0060] I. Colony Morphology Identification

[0061] In the early stages of culture, the colonies of Bacillus subtilis ZJ4-E4-1 are light yellow and translucent, round, with a moist and viscous surface, neat edges, and slightly raised. In the later stages of culture, the surface dries and wrinkles, the center is sunken, and the edges turn slightly white and curl up. The color of the culture medium remains consistent throughout. The bacteria are short rods, measuring (0.5~0.7) μm × (0.6~1.5) μm, mostly arranged in chains, with spores occurring centrally. A photograph of the colony morphology of Bacillus subtilis ZJ4-E4-1 is shown below. Figure 3 As shown. Simultaneously, microscopic observation of this strain was performed; electron microscope images of ZJ4-E4-1 are shown below. Figure 4 As shown.

[0062] II. Identification of 16S rRNA

[0063] Primer sequence:

[0064] 27F: AGAGTTTGATCCTGGCTCA

[0065] 1492R: GGTTACCTTGTTACGACTT

[0066] The 16S rRNA of the described DNA phosphorus-thioylation modified strain was cloned and sequenced using universal bacterial primers 27F and 1492R. Amplification conditions were: 95℃ for 5 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min, 15℃ for 5 min. The amplified product was recovered and sequenced; the nucleotide sequence of its 16S rRNA gene is shown in SEQ ID NO: 1. The obtained 16S rRNA gene sequence of the strain was searched in GenBank using BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ). The 16S rRNA sequence of the strain of this invention showed 99% similarity to the sequence of *Bacillus subtilis* from NCBI.

[0067] III. Physiological and biochemical identification of Bacillus subtilis ZJ4-E4-1

[0068] Physiological and biochemical experiments were performed according to the methods in Bergey's Manual of Bacterial Identification (9th Edition). The results of the physiological and biochemical experiments on Bacillus subtilis ZJ4-E4-1 are shown in Table 2. Based on the 16S rRNA sequence analysis and the results of the physiological and biochemical experiments, Bacillus subtilis ZJ4-E4-1 can be identified as Bacillus subtilis.

[0069] Table 2. Physiological and biochemical experimental results of Bacillus subtilis ZJ4-E4-1

[0070] catalase + glucose + Anaerobic growth - Xylose + Methyl red test + Mannitol + Nitrate reduction + sucrose + Growing at 45°C + glycerin + 7% NaCl growth + Citrate utilization + Starch hydrolysis + Break down casein +

[0071] Note: "+" in the table indicates a positive result, and "-" indicates a negative result.

[0072] Example 3: Animal safety test of Bacillus subtilis ZJ4-E4-1

[0073] I. Intraperitoneal injection test

[0074] (1) Preparation of bacterial suspension: Activated Bacillus subtilis was inoculated onto LB agar plates and cultured at 37°C for 16-24 hours. Colonies were scraped from the plates and suspended in sterile physiological saline. After thorough mixing, the concentration of the bacterial suspension was adjusted with an appropriate amount of sterile physiological saline and turbidity was measured (McFarland turbidimetric method) to achieve a final bacterial concentration of 5.0 × 10⁻⁶. 7 CFU / mL, for intraperitoneal injection in mice.

[0075] (2) Experimental grouping: Twenty Kunming rats, half male and half female, were randomly divided into two groups of 10 each. The experiment consisted of a blank control group and a Bacillus subtilis ZJ4-E4-1 group. The blank control group was treated with intraperitoneal injection of 0.2 mL of physiological saline, while the ZJ4-E4-1 group was treated with intraperitoneal injection of 0.2 mL of 5.0 × 10⁻⁶ saline solution. 7 Bacillus subtilis CFU / mL.

[0076] (3) Observation and Recording: Animals were observed once a day after intraperitoneal injection for at least 21 consecutive days. Observe and record any abnormalities in the mice's skin and fur, eyes and mucous membranes, respiration, limb movement, and behavior. Pay special attention to observe for tremors, convulsions, diarrhea, lethargy, salivation, and coma. Weigh and record the weight of all mice before the experiment and weigh and record the weight of all surviving mice after the experiment. For mice that died during the experiment, record the time of death as accurately as possible, and weigh and record the time of death.

[0077] (4) Experimental results: After intraperitoneal injection of the corresponding Bacillus subtilis ZJ4-E4-1, mice in all groups showed normal skin, fur, eyes, and mucous membranes, and normal respiratory rate during the 21-day observation period; their feeding and drinking behaviors were normal; no tremors, convulsions, diarrhea, lethargy, salivation, or coma were observed. The changes in body weight of female and male mice in each group over 21 days are shown in Tables 3 and 4. Intraperitoneal injection of Bacillus subtilis ZJ4-E4-1 had no adverse effect on mouse body weight.

[0078] Table 3. Effect of intraperitoneal injection of the strain of the present invention on body weight in mice (female).

[0079] Blank group 22.08±1.05 30.07±1.74 33.59±2.49 36.86±2.92 ZJ4-E4-1 group 24.40±0.90 30.89±1.57 34.18±1.81 35.43±2.28

[0080] Table 4. Effect of intraperitoneal injection of the strain of this invention on body weight in male mice.

[0081] Blank group 24.47±1.83 33.97±2.91 39.96±4.26 42.78±4.37 ZJ4-E4-1 group 25.24±1.33 34.95±0.78 38.86±1.91 40.89±1.32

[0082] II. Oral gavage test

[0083] (1) Preparation of bacterial suspension: Activated Bacillus subtilis was inoculated onto LB agar plates and cultured at 37°C for 16-24 hours. Colonies were scraped from the plates and suspended in sterile physiological saline. After thorough mixing, the concentration of the bacterial suspension was adjusted with an appropriate amount of sterile physiological saline and turbidity was measured (McFarland turbidimetric method) to achieve a final bacterial concentration of 2.5 × 10⁻⁶. 8 CFU / mL (1x dose) and 1.25×10 9 CFU / mL (5 times the dose) was used in an oral gavage test in mice.

[0084] (2) Experimental grouping: Thirty Kunming rats, half male and half female, were randomly divided into three groups of 10 rats each. The experiment included a blank control group and a Bacillus subtilis ZJ4-E4-1 group. The blank control group was treated by intraperitoneal injection of 0.2 mL of physiological saline; the ZJ4-E4-1 group was treated by gavage at a volume of 20 mL / kg·BW, with a bacterial concentration of 2.5 × 10⁻⁶. 8 CFU / mL; the 5-fold dose ZJ4-E4-1 group was administered to mice by gavage at a volume of 20 mL / kg·BW, with a bacterial concentration of 1.25×10⁻⁶. 9 CFU / mL. Administer by gavage for 3 consecutive days. Mice should be fasted overnight (16 h) before the first gavage, and fed 3-4 h after gavage.

[0085] (3) Observation and Recording: Animals were observed once a day after intraperitoneal injection for at least 21 consecutive days. Observe and record any abnormalities in the mice's skin and fur, eyes and mucous membranes, respiration, limb movement, and behavior. Pay special attention to observe for tremors, convulsions, diarrhea, lethargy, salivation, and coma. Weigh and record the weight of all mice before the experiment and weigh and record the weight of all surviving mice after the experiment. For mice that died during the experiment, record the time of death as accurately as possible, and weigh and record the time of death.

[0086] (4) Results: During the 21-day observation period, mice administered 1-fold and 5-fold doses of Bacillus subtilis ZJ4-E4-1 by gavage showed normal skin, hair, eyes, and mucous membranes, and normal respiratory rate; normal feeding and drinking behavior; and no tremors, convulsions, diarrhea, lethargy, salivation, or coma were observed. Statistical analysis of weight changes in each group during the gavage experiment revealed that in the 1-fold and 5-fold dose groups, there were no significant differences in weight between the female and male mice and the control group on days 9, 16, and 24. The weight changes are shown in Tables 5 and 6. Gavage administration of Bacillus subtilis ZJ4-E4-1 had no adverse effects on mouse weight.

[0087] Table 5. Effect of oral gavage on body weight in female mice (female) of the strain of this invention.

[0088] Blank group 21.16±0.71 31.91±2.58 34.46±3.37 35.61±3.56 Group ZJ4-E4-1 (1x dose) 22.74±0.42 31.41±1.25 33.77±1.62 35.68±2.55 5 times the dose of ZJ4-E4-1 group 22.19±0.73 31.62±1.25 34.11±1.77 34.62±2.13

[0089] Table 6. Effect of oral gavage on body weight in male mice (male) of the strain of this invention.

[0090] Blank group 25.05±2.22 40.79±1.69 43.73±1.90 44.02±1.73 Group ZJ4-E4-1 (1x dose) 24.08±1.72 40.04±2.49 42.90±2.71 43.37±2.68 5 times the dose ZJ4-E4-1 group 23.91±1.30 37.81±2.44 40.43±1.46 41.25±1.80

[0091] Based on the combined results of intraperitoneal injection and gavage tests, the strain of this invention was administered at a dose of 5.0 × 10⁻⁶. 7 Intraperitoneal injection of CFU / mL was non-pathogenic in mice, while 1x dose (2.5×10⁻⁶) was effective. 8 CFU / mL) and 5 times the dose (1.25×10) 9 Gavage administration of CFU / mL had no effect on the health of mice, and Bacillus subtilis ZJ4-E4-1 was non-pathogenic to mice.

[0092] Example 4 Animal model experiment of ethanol injury caused by Bacillus subtilis ZJ4-E4-1

[0093] I. Materials and Methods

[0094] (1) Materials: Total protein (TP) assay kit, superoxide dismutase (SOD) assay kit, malondialdehyde (MDA) assay kit, glutathione peroxidase (GSH-Px) assay kit, and protein carbonyl content assay kit were purchased from Nanjing Jiancheng Bioengineering Institute.

[0095] (2) Preparation of bacterial suspension: Activated Bacillus subtilis ZJ4-E4-1 was inoculated onto LB agar plates and cultured at 37°C for 16-24 hours. Colonies were scraped from the plates and suspended in sterile physiological saline. After thorough mixing, the concentration of the bacterial suspension was adjusted with an appropriate amount of sterile physiological saline and turbidity was measured (McFarland turbidimetric method) to achieve a final bacterial concentration of 5.0 × 10⁻⁶. 7 CFU / mL was administered to mice via gavage.

[0096] (3) Experimental grouping: Thirty healthy adult male mice weighing 25-30 g were randomly divided into a model group, a blank control group, and a Bacillus subtilis ZJ4-E4-1 group. Each group was continuously administered 1.5 × 10⁸ CFU / mL by gavage at a dose of 20 mL / kg·BW (the recommended human dose is 1.5 × 10⁸ CFU / mL). 7 The corresponding species of Bacillus subtilis (10 times the CFU / mL) were administered via gavage to the model group and the control group (0.2 mL of physiological saline). After 30 days of gavage, an ethanol oxidative injury model was established, and blood was collected to detect the levels of total protein, glutathione peroxidase, malondialdehyde, protein carbonyl groups, superoxide dismutase, etc. in the serum.

[0097] II. Ethanol Damage Model

[0098] (1) Principle: Excessive intake of ethanol activates oxygen molecules to produce free radicals, leading to oxidative stress in tissue cells and depletion of reduced glutathione in the body, and causing acute alcoholic liver injury.

[0099] (2) Modeling method: After the last gavage in each group, each group was fasted for 16 hours, and then 12 ml / kg BW of 50% ethanol was administered by gavage once. 6 hours later, the serum of each group of mice was collected (the blank control group was not treated and was not fed) for the detection of oxidative stress and serum total protein index.

[0100] III. Experimental Results: After oral administration of the corresponding Bacillus subtilis, mice in each group showed normal skin, fur, eyes, and mucous membranes, and normal respiratory rate during the 30-day observation period. Feeding and drinking behavior was normal; no tremors, convulsions, diarrhea, lethargy, salivation, or coma were observed. At the end of the experiment, blood was collected from the mice, serum was separated, and the content or activity of the corresponding factors in the serum was detected.

[0101] (1) Measurement of four oxidative stress indicators

[0102] a. Assay of glutathione peroxidase (GSH-Px) activity in mouse serum

[0103] Glutathione peroxidase (GSH-Px) is an important peroxide-degrading enzyme widely present in the body. The active site of GSH-Px is selenocysteine, and its activity reflects the body's selenium (Se) level. Selenium is a component of the GSH-Px enzyme system; it catalyzes the conversion of GSH to GSSG, reducing toxic peroxides to non-toxic hydroxyl compounds, and simultaneously promotes the decomposition of H₂O₂, thereby protecting the structure and function of cell membranes from interference and damage by peroxides.

[0104] b. Assay of superoxide dismutase (SOD) activity in mouse serum

[0105] Superoxide dismutase (SOD) is a metalloenzyme found in living organisms. It catalyzes the dismutation of superoxide anion free radicals into oxygen and hydrogen peroxide, playing a crucial role in the body's oxidation-antioxidant balance and being closely related to the occurrence and development of many diseases. The mechanism of action of superoxide dismutase is primarily the scavenging of harmful superoxide anion free radicals (O₂O₃). 2- This helps to combat aging.

[0106] c. Determination of the content of protein oxidation products—protein carbonyl groups—in mouse serum

[0107] Protein carbonyl groups are formed when amino or imine groups in the side chains of amino acid residues are attacked by free radicals. In vivo, they are primarily formed through metal ion-catalyzed oxidation systems and serve as an early marker of various amino acids in protein oxidative modification. Carbonylated proteins readily cross-link and aggregate into large molecules, thereby reducing or eliminating their original protein function. Their concentration indicates the degree of protein oxidative damage and is a key indicator for measuring this damage.

[0108] d. Determination of malondialdehyde (MDA), a lipid oxidation product, in mouse serum

[0109] In vivo, free radicals act on lipids to cause peroxidation, with malondialdehyde (MDA) as the final oxidation product. MDA can cause cross-linking and polymerization of biomolecules such as proteins and nucleic acids, and it also has cytotoxic effects. In vitro, MDA affects the mitochondrial respiratory chain complex and the activity of key enzymes in mitochondria. Its production can also exacerbate membrane damage. Therefore, measuring the amount of MDA can reflect the degree of lipid peroxidation in the body, and indirectly reflect the degree of cell damage.

[0110] The content or activity of the four corresponding factors in serum were measured according to the instructions of the Nanjing Jiancheng reagent kit. The measured data were analyzed using SPSS 23.0. The experimental results are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was performed, and "#" indicates a significant difference compared with the model group (P < 0.05). The results are shown in Table 7.

[0111] Table 7. Effects of the strains of this invention on factors related to ethanol-induced oxidative stress.

[0112] Blank group <![CDATA[670.67±33.02 # ]]> <![CDATA[93.89±1.24 # ]]> <![CDATA[777.15±37.43 # ]]> 43.48±3.22 Model group 321.87±10.11 91.20±0.61 882.58±25.38 44.47±2.56 ZJ4-E4-1 group <![CDATA[571.81±24.70 # ]]> <![CDATA[94.79±1.14 # ]]> <![CDATA[792.79±38.56 # ]]> 41.63±4.98

[0113] # P < 0.05

[0114] Effects of Bacillus subtilis ZJ4-E4-1 on four serum oxidative stress markers in mice, such as Figure 5 As shown.

[0115] (2) Determination of total protein (TP) content in mouse serum

[0116] TP (proton pump inhibitors) can be divided into albumin and globulin. They have multiple functions, including maintaining normal colloid osmotic pressure and pH in blood vessels, transporting various metabolites, regulating the physiological functions of transported substances, and are closely related to the body's immune function. Serum proteins also have multiple functions, including maintaining normal colloid osmotic pressure and pH in blood, transporting various metabolites, regulating the physiological functions of transported substances and detoxifying them, providing immune responses, and offering nutritional benefits.

[0117] The serum total protein content was determined according to the instructions of the Nanjing Jiancheng reagent kit. The measured data were analyzed using SPSS 23.0. The experimental results are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was performed, and "#" indicates a significant difference compared with the model group (P < 0.05). The results are shown in Table 8.

[0118] Table 8. Effects of the strains of this invention on the decrease in serum total protein induced by ethanol damage.

[0119] TP (g / L) <![CDATA[78.17±3.59 # ]]> 65.10±1.72 <![CDATA[75.09±2.93 # ]]>

[0120] Effects of Bacillus subtilis ZJ4-E4-1 on serum total protein levels in a mouse ethanol injury model, as follows: Figure 6 As shown.

[0121] Experiments showed that the invented strain ZJ4-E4-1 significantly reduced the GSH-Px activity caused by ethanol-induced oxidative stress. The glutathione peroxidase activity in the ZJ4-E4-1 group reached 571.81, which was 77.65% higher than that in the model group. ZJ4-E4-1 also significantly increased superoxide dismutase (SOD) activity and total protein (TP) content, bringing them close to the blank control group. It significantly reduced the increase in protein carbonyl content caused by ethanol-induced oxidative stress and reduced malondialdehyde (MDA) content to a certain extent. This indicates that Bacillus subtilis ZJ4-E4-1 of the present invention can effectively reduce free radical damage to cells in mice, protect normal cells in mice, and play a certain protective role against ethanol-induced acute liver injury in mice.

[0122] Example 5: Preparation of Bacillus subtilis ZJ4-E4-1 probiotic tablets

[0123] This embodiment provides a bacterial agent, which is a fermentation product of Bacillus subtilis strain ZJ4-E4-1. The preparation method of the fermentation product is as follows: Bacillus subtilis strain ZJ4-E4-1 obtained in Example 1 is inoculated into NA slant medium and cultured overnight at 37°C for activation. The activated bacterial growth is then picked and inoculated into NB medium and cultured overnight at 37°C with shaking.

[0124] The bacterial culture was inoculated into NB medium and cultured at 37°C with shaking for 24 h. The bacterial sludge was then collected by centrifugation. The sludge was washed twice with sterile water and mixed with 200 g / L skim milk powder and 300 g / L mannitol in a 1:3 ratio. The mixture was then dried at 60-70°C for 12 h to promote spore formation. After drying, it was mixed with fructooligosaccharides in the following proportions: 40 parts bacterial powder, 30 parts fructooligosaccharides, 10 parts maltodextrin, and 5 parts freeze-dried fruit powder. The viable count was then determined by dilution and plate counting to ensure the probiotic powder contained at least 100,000 live bacteria. 9 CFU / g. Mix 0.5-1.5 parts of magnesium stearate with probiotic powder and compress into tablets to obtain probiotic lozenges.

[0125] Example 6: Application of Bacillus subtilis ZJ4-E4-1 in fermented foods

[0126] This embodiment provides a method for using Bacillus subtilis ZJ4-E4-1 for the fermentation production of natto. The Bacillus subtilis ZJ4-E4-1 obtained in Example 1 was inoculated onto NA slant agar and incubated overnight at 37°C for activation. The activated bacterial growth was then picked and inoculated onto NB agar and incubated overnight at 37°C with shaking. A 1% inoculum was then added to NB agar and incubated at 37°C with shaking for 24 hours. The bacterial sludge was collected by centrifugation. The sludge was washed twice with sterile water and mixed with 200 g / L skim milk powder and 300 g / L mannitol in a 1:3 ratio. The mixture was then dried at 60-70°C for 12 hours to obtain bacterial powder for natto fermentation.

[0127] Weigh a fixed amount of soybeans, select high-quality soybeans, wash them, and soak them in water with three times their weight for 18 hours. Place the soaked soybeans in a pot and steam for 30 minutes after the water boils. Separate the soybeans from the soy milk. Place the soybeans in a pressure cooker and continue steaming. Let the soy milk cool. Activate Bacillus natto in the cooled soy milk using aerobic culture. Inoculate the activated Bacillus natto into the homemade soy milk at an inoculation rate of 4%. Then, ferment the natto. Spread the steamed soybeans evenly in a stainless steel pan, pour the inoculation solution over the soybeans, cover with plastic wrap, and poke several small holes with a toothpick to begin fermentation. Observe the soybeans until they become stringy; once they become stringy, fermentation is complete.

[0128] In summary, the Bacillus subtilis ZJ4-E4-1 provided by this invention can significantly increase the activity of glutathione peroxidase in the serum of mice with ethanol injury, increase the activity of superoxide dismutase, and reduce the levels of protein carbonyl groups and malondialdehyde in the body, thereby enhancing the free radical scavenging ability of mouse cells. Simultaneously, it can restore the decrease in serum total protein levels caused by acute liver injury induced by ethanol, thus effectively improving the immunity of mice.

[0129] The DNA phosphorus thioylation modified Bacillus subtilis ZJ4-E4-1 of the present invention has no toxic side effects and can be used in pharmaceuticals, fermented foods or health products to help maintain normal levels of serum total protein content and improve the body's ability to fight free radicals, thereby enhancing the body's immunity.

[0130] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A Bacillus subtilis ZJ4-E4-1 with DNA phosphorothioacylation modification, characterized in that, The Bacillus subtilis is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 28472.

2. The Bacillus subtilis of claim 1 in the preparation of an antioxidant reagent for an acute alcoholic liver injury animal model.

3. Use according to claim 2, wherein the compound is ###0002### The antioxidant includes increasing glutathione peroxidase activity, increasing superoxide dismutase activity, and reducing protein carbonyl and malondialdehyde levels in the body.

4. The Bacillus subtilis of claim 1 in the preparation of a reagent for increasing serum total protein content in an acute alcoholic liver injury animal model.

5. The use according to claim 4, wherein the compound is ###0002### The acute alcoholic liver injury animal model is a large intake of ethanol, which activates oxygen molecules to produce free radicals, leading to oxidative stress of tissue cells and depletion of reduced glutathione in the body, and causing acute alcoholic liver injury.

6. A microbial agent comprising the Bacillus subtilis of claim 1.

7. The microbial inoculant of claim 6, wherein, The microbial agent is a solid or liquid microbial agent.

8. The Bacillus subtilis of claim 1 in the preparation of a drug for relieving acute alcoholic liver injury.

Images