Use of biological material related to EVA1A gene in preparation of medicine for regulating obesity and fatty liver

Abstract

The application discloses application of a biological material related to an EVA1A gene in preparation of medicines for regulating obesity and fatty liver, and belongs to the technical field of gene medicines. The application provides application of the biological material related to the EVA1A gene in preparation of medicines for regulating obesity, fatty liver and / or complications of obesity, and the biological material related to the EVA1A gene is prepared into a gene medicine, so that the effect of significantly reducing fat content in liver cells and restoring liver cell function can be achieved; and the complications of the animal, such as fatty liver, obesity, hypercholesterolemia and insulin resistance, can be obviously reduced. The gene medicine has high biological safety, and has a remarkable effect after one-time administration, and is suitable for development into a biological therapeutic agent for obesity and fatty liver.

Description

Technical Field

[0001] This invention belongs to the field of gene drug technology, specifically relating to the application of EVA1A gene-related biomaterials in the preparation of drugs that regulate obesity and fatty liver. Background Technology

[0002] Obesity is a serious public health problem, defined as abnormal or excessive fat accumulation that may impair health. It occurs in adults and young adults and is increasingly affecting children. Body fatness is usually measured by body mass index (BMI): BMI = 25–29 kg / m². 2 Overweight, BMI ≥ 30 kg / m² 2 Obesity is defined as obesity in children. The classification standard for childhood obesity is a body mass index (BMI) higher than the 95th percentile of children in their age group after age 2. According to the World Health Organization (WHO), approximately 650 million adults worldwide were obese in 2016, more than three times the number in 1975. The obesity rate among children aged 2-19 rose from 4% in 1975 to 19.7% in 2020. Based on current trends, it is predicted that by 2030, more than 50% of the global population will be at risk of obesity.

[0003] The development of obesity involves multiple factors, including genetics, environment, economic conditions, lifestyle, and socio-demographic factors. Over the past few decades, the proportion of high-calorie, low-nutrient foods in the diet has increased dramatically, while physical activity has gradually decreased. These acquired behaviors, such as poor dietary habits and reduced physical activity, have become major factors in the development of the disease. Simultaneously, obesity increases the risk of various diseases such as hypertension, hyperlipidemia, diabetes, gout, hyperuricemia, and fatty liver, and easily leads to insulin resistance, further promoting fat accumulation. Long-term obese individuals also face social and psychological stress. Currently, obesity is difficult to treat. Basic nutritional therapy mainly involves restricting calorie intake, but this method results in slow weight loss and is difficult to maintain long-term. Clinically, the types of drugs for treating obesity are limited, offering few choices. In my country, only orlistat is approved for the treatment of obesity, but its use is often accompanied by adverse reactions such as liver damage and gastrointestinal discomfort, thus limiting its effectiveness.

[0004] Fatty liver is generally considered a liver manifestation of metabolic syndrome, characterized by excessive fat accumulation in hepatocytes and steatosis. Normally, the liver contains only a small amount of fat, but when the fat content exceeds 5% of the liver's weight, fatty liver develops. The causes of fatty liver are diverse, including genetics, dietary factors, and insulin resistance. Clinically, fatty liver is generally divided into two main categories based on alcohol consumption: alcoholic fatty liver and non-alcoholic fatty liver disease (NAFLD), with obesity being one of the most significant risk factors for NAFLD. If left uncontrolled, early-stage simple fatty liver can gradually progress to steatohepatitis, fatty liver fibrosis, fatty liver cirrhosis, and even eventually liver cancer. However, modern medicine has not fully elucidated the pathogenesis of fatty liver, and there are no specific drugs for its treatment.

[0005] EVA1A, also known as TMEM166 or FAM176A, is an endoplasmic reticulum transmembrane protein involved in autophagy and apoptosis. Studies have shown that it plays an important role in many diseases, including various cancers. Furthermore, some research indicates that autophagy helps reduce liver inflammation in patients with NAFLD. However, whether EVA1A has anti-obesity and anti-fatty liver functions has not yet been reported domestically or internationally. Summary of the Invention

[0006] The purpose of this invention is to provide the application of EVA1A gene-related biomaterials in the preparation of drugs that regulate obesity and fatty liver. EVA1A can play an effective role in the treatment of obesity and fatty liver, and can be used as a drug target for the development of related drugs.

[0007] This invention provides the application of EVA1A gene-related biomaterials in the preparation of drugs that regulate obesity, fatty liver and / or obesity complications.

[0008] Preferably, the EVA1A gene-related biomaterials include biomolecules or chemical agents that upregulate the expression of EVA1A protein or homologous proteins in vivo.

[0009] Preferably, the EVA1A gene-related biomaterial includes at least one of the following: a vector for overexpressing the EVA1A gene, a reagent for inhibiting the expression of microRNA targeting EVA1A, and an upstream negative regulatory molecule of the EVA1A gene.

[0010] Preferably, the vector overexpressing the EVA1A gene includes an adeno-associated virus (AAV) recombinant vector, wherein the AAV recombinant vector may contain a promoter specifically expressed in the liver and / or adipose tissue. If it does not contain a specific promoter, the serotype of the AAV vector may be type 8 or other serotypes with high infectivity in the liver and / or adipose tissue.

[0011] Preferably, the fatty liver includes non-alcoholic fatty liver disease;

[0012] The obesity-related complications include hypercholesterolemia and insulin resistance syndrome.

[0013] The present invention also provides a medicament for alleviating and / or treating obesity and fatty liver, with biomaterials related to the EVA1A gene as the active ingredient.

[0014] Preferably, the EVA1A gene-related biomaterial includes at least one of the following: the EVA1A gene, a homologous gene of the EVA1A gene, a protein encoded by the EVA1A gene, an RNA fragment transcribed from the EVA1A gene, biomaterial containing the EVA1A gene or a homologous gene of the EVA1A gene, an expression product of biomaterial containing the EVA1A gene or a homologous gene of the EVA1A gene, and biomaterial containing an effective peptide of EVA1A.

[0015] Preferably, the biomaterial associated with the EVA1A gene includes a recombinant vector containing the human EVA1A gene or a homologous gene.

[0016] Preferably, the base vector of the recombinant vector includes an adeno-associated virus (AAV) vector.

[0017] Preferably, the serotype of the AAV vector includes type 8 vector.

[0018] Beneficial Effects: This invention provides the application of EVA1A gene-related biomaterials in the preparation of drugs that regulate obesity, fatty liver, and / or obesity complications. The EVA1A gene-related biomaterials are prepared into gene drugs. In the examples, they are expressed in animals, especially in liver and adipose tissue, and in human hepatocytes via suitable vectors. Alternatively, by inhibiting upstream negative regulators to upregulate the expression of endogenous or in vivo EVA1A, the expression of EVA1A can be significantly reduced, thereby restoring hepatocyte function. Furthermore, by promoting the secretion of adiponectin by adipocytes, insulin sensitivity is increased. It promotes glucose uptake by tissue cells, lowers fasting blood glucose, inhibits fat synthesis, promotes autophagy to break down fat and β-oxidation of fatty acids to accelerate fat utilization, thereby significantly alleviating complications such as fatty liver, obesity, hypercholesterolemia and insulin resistance in animals. The EVA1A gene drug is derived from the EVA1A gene of mammals themselves, rather than an exogenous chemically synthesized drug, and has high biosafety. After safety testing, the heart, liver and kidney functions of the animals were normal and no inflammation was caused, indicating that the gene drug has very low biotoxicity. Moreover, the effect is significant after a single dose, making it suitable for development as a biological therapeutic agent for obesity and fatty liver. Attached Figure Description

[0019] Figure 1 The graph shows the results of mouse body weight (A) and body fat distribution (B) in Example 1;

[0020] Figure 2 The results are shown in Figure 1, which show the percentage of body weight of each type of fat (A) and the percentage of body weight of total fat (B) in mice.

[0021] Figure 3 The image shows the H&E staining results of mouse adipose tissue in Example 1, with a scale bar of 50 μm.

[0022] Figure 4 The results of mouse liver coefficient (A), liver tissue Oil Red O staining (C), and H&E staining (B) in Example 2 are shown in the figure. The scale bar is 200 μm.

[0023] Figure 5 The graph shows the results of TG(A) levels in mouse liver and AST(B) and ALT(C) levels in blood in Example 2.

[0024] Figure 6 This is a graph showing the results of TC(A), LDL-C(B), and HDL-C(C) levels in mouse blood in Example 2;

[0025] Figure 7 The graph shows the results of ADPN content (A), fasting blood glucose (B), and insulin tolerance test (C) in mouse blood in Example 3.

[0026] Figure 8 The image shows the qPCR results of Eva1a gene mRNA in mouse liver tissue (A), adipose tissue (B), and heart tissue (C) in Example 4.

[0027] Figure 9 This is an M-mode echocardiogram of the left ventricle of a mouse in Example 5;

[0028] Figure 10 The graph shows the results of heart rate, stroke volume, cardiac output, and ejection fraction in mice in Example 5.

[0029] Figure 11 This is a graph showing the results of the levels of UA(A), CRE(B), IL-6(C), IL-1β(D), and TNF-α(E) in the blood of mice in Example 6;

[0030] Figure 12 The image shows the results of Oil Red O staining (A) and quantification in human hepatocytes in Example 7 (B), with a scale bar of 30 μm.

[0031] Figure 13 This is a graph showing the results of ALT secreted by human hepatocytes and intracellular TG content in Example 7;

[0032] Figure 14 The results and quantitative analysis of LC3 dual fluorescent plasmid labeling of autophagosomes and autolysosomes in human hepatocytes in Example 8 are shown in Figure 8 (A and B), and the Western blot results of EVA1A and CPT1A protein expression are shown in Figure 8 (C).

[0033] Figure 15 The image shows the colocalization results (A) and quantitative analysis results (B) of lipid droplets and autophagosomes in human hepatocytes in Example 8. Detailed Implementation

[0034] This invention provides the application of EVA1A gene-related biomaterials in the preparation of drugs that regulate obesity, fatty liver and / or obesity complications.

[0035] The EVA1A gene referred to in this invention is preferably a human gene with Gene ID: 84141. However, in the mouse model experiments in the examples, the expressed gene is the mouse homolog of the human gene EVA1A, Eva1a, with Gene ID: 232146.

[0036] The EVA1A gene-related biomaterials of this invention preferably include biomolecules or chemical agents that upregulate the expression of EVA1A protein or homologous proteins in vivo, and more preferably include at least one of the following: a vector for overexpressing the EVA1A gene, a reagent for inhibiting the expression of microRNA targeting EVA1A, and an upstream negative regulatory molecule of the EVA1A gene. The vector for overexpressing the EVA1A gene of this invention preferably includes an adeno-associated virus (AAV) recombinant vector, wherein the AAV recombinant vector may contain a promoter specifically expressed in the liver and / or adipose tissue. If it does not contain a specific promoter, the serotype of the AAV vector may be serotype 8 or other serotypes with high infectivity in the liver and / or adipose tissue. AAV8 is used as an example in the embodiments, but it should not be considered as the entire scope of protection of this invention.

[0037] In this invention, mouse model experiments confirmed that Eva1a can significantly reduce the body weight of ob / ob obese mice, inhibit fat accumulation, reduce liver coefficient and liver TG content, and reduce the levels of HDL, LDL, AST, ALT, and TC in the mouse blood. Therefore, it not only exhibits excellent anti-obesity effects but also effectively alleviates fatty liver. Human cell experiments also verified the mouse experimental results. Therefore, the EVA1A described in this invention can effectively play a role in the treatment of obesity and fatty liver, preferably including non-alcoholic fatty liver disease; the obesity complications preferably include hypercholesterolemia and insulin resistance syndrome. Therefore, this invention can overexpress or directly enrich the effective peptide of this protein in mammals, and can treat or alleviate non-alcoholic fatty liver disease and obesity and related complications such as hypercholesterolemia and insulin resistance syndrome.

[0038] Specifically, in this embodiment of the invention, the constructed recombinant vector AAV-Eva1a of serotype 8 was overexpressed in obese / fatty liver model animals (ob / ob mice) via tail vein injection. After 4–7 weeks of expression, the specific therapeutic effects are as follows:

[0039] A. Effects on treating obesity: Compared with the control group injected with empty vector, the experimental group animals had reduced body weight, reduced fat accumulation in the animals' bodies (including subcutaneous fat, visceral fat, perirenal fat, epididymal fat and groin fat), and significantly smaller fat cell size.

[0040] B. Effects of treating non-alcoholic fatty liver and hypercholesterolemia: Reduces liver coefficient in animals, reduces accumulation of lipid droplets in the liver, reduces the content of triglycerides (TG) in the liver, and reduces the levels of total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) in the blood of animals.

[0041] C. Effects on improving insulin resistance: Increased expression of adiponectin (APDN) reduces fasting blood glucose in animals and increases insulin sensitivity;

[0042] D. Toxicity test: Animals showed normal activity, no significant differences in cardiac function (cardiac output, ejection fraction), no significant differences in renal function (uric acid UA, creatinine CRE levels), significant downregulation of inflammatory factors interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α), and no difference in interleukin-1β (IL-1β) levels.

[0043] In this embodiment of the invention, human hepatocyte lines (such as L02 and HepG2) were also used to verify the gene drug. The cells were transfected with a Myc-EVA1A recombinant plasmid vector containing the EVA1A gene. The vector could also be a plasmid vector without the Myc tag or other viral vectors. Preferably, this invention uses a high-fat fatty acid loading method to induce human hepatocytes into fatty liver cells, achieving results similar to those in animal experiments.

[0044] E. EVA1A can reduce the number of lipid droplets, TG content, and ALT content secreted by cells in human hepatocytes. Simultaneously, it was found that EVA1A overexpression promotes acidic breakdown of lipid droplets in hepatocytes (promoting autophagy) and β-oxidation of fatty acids (promoting the expression of CPT1A, a key enzyme for fatty acid transport into mitochondria). This indicates that this gene-based drug can treat and alleviate fatty liver and obesity by promoting the breakdown and utilization of fat.

[0045] This invention provides a medicament for alleviating and / or treating obesity and fatty liver, with biomaterials related to the EVA1A gene as the active ingredient.

[0046] The EVA1A gene-related biomaterials of this invention preferably include at least one of the following: the EVA1A gene, a homologous gene of the EVA1A gene, a protein encoded by the EVA1A gene, an RNA fragment transcribed from the EVA1A gene, biomaterials containing the EVA1A gene or a homologous gene of the EVA1A gene, an expression product of biomaterials containing the EVA1A gene or a homologous gene of the EVA1A gene, and biomaterials containing an effective peptide of EVA1A. The EVA1A gene-related biomaterials of this invention include recombinant vectors containing the human EVA1A gene or a homologous gene, wherein the base vector of the recombinant vector preferably includes an AAV vector, and the serotype of the AAV vector preferably includes type 8 vectors.

[0047] In this embodiment of the invention, the preferred method of EVA1A overexpression is gene transfection. The overexpression vector is preferably, but not limited to, plasmids / viral vectors with Myc tags, or other vectors such as plasmids / viral vectors without tags, or by inhibiting the expression of microRNAs targeting EVA1A. The preferred method of Eva1a overexpression in this invention also includes tail vein injection of AAV-Eva1a into mice, and also includes tail vein injection of inhibitors of microRNAs targeting Eva1a and other upstream negative regulatory molecules.

[0048] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, illustrates the application of the EVA1A gene-related biomaterials provided by the present invention in the preparation of drugs for regulating obesity and fatty liver, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] Effects of EVA1A overexpression on weight loss in ob / ob obese mice

[0051] (I) Experimental Materials

[0052] (1) Laboratory animals:

[0053] Strain: Ob / ob obese model mice, male, 8 weeks old; weight: 42-48g, purchased from Nanjing Jicui Yaokang Biotechnology Co., Ltd.

[0054] (2) Experimental feed: ordinary feed, purchased from Jiangsu Xietong Biotechnology Co., Ltd., product number SFS9112, with a total calorie of 3530 kcal / kg. The product meets the requirements of GB14924.1 "General Quality Standard for Compound Feed for Laboratory Animals", GB14924.2 "Hygienic Standard for Compound Feed for Laboratory Animals", GB14924.3 "Nutritional Components of Compound Feed for Laboratory Animals" and GB13078 "Hygienic Standard for Feed".

[0055] (II) Test substances: AAV-Eva1a and AAV-null empty vector, vector name: adeno-associated virus vector AVV8, number GV411, inserted gene Eva1a (gene number 232146), constructed and packaged by Shanghai Jikai Gene Technology Co., Ltd.

[0056] (III) Experimental Methods

[0057] (1) Measurement of mouse body weight, fat distribution, fat weight and fat cell size

[0058] Mice were randomly divided into two groups of eight each. They were housed in a clean animal room at room temperature (25±2℃) with a relative humidity of 50%–70%, under 12-hour light and 12-hour darkness. After one week of environmental acclimatization, the experimental group mice were injected intravenously with AAV-Eva1a at a dose of 1*10-. 11 Av-null was administered at a dose of vg / mL, diluted to 200 μL with physiological saline, and injected into the control group via tail vein injection. Mice received free access to standard food and water during the experiment. Weight was recorded weekly, and the mental state and activity level of mice in each group were observed. After 4 weeks of feeding, mice were anesthetized with isoflurane gas, and body fat was analyzed using a small animal in vivo imaging system. After 7 weeks of feeding, all mice were fasted overnight. Blood was collected from the orbital cavity after anesthesia, centrifuged at 3500 rpm for 15 min, and the supernatant serum was collected and stored at -80℃ for further analysis. Mice were euthanized by cervical dislocation, and the liver, heart, visceral fat, perirenal fat, epididymal fat, and inguinal fat were removed. After weighing, some tissues were fixed in 4% paraformaldehyde, and the remaining tissues were stored at -80℃ for further analysis.

[0059] (2) H&E staining of mouse adipose tissue

[0060] ① The paraffin-embedded adipose tissue of mice was prepared by Wuhan Boster Biological Co., Ltd.

[0061] ② Paraffin sections: Sections were prepared using a Leica HistoCore BIOCUT R mechanical manual rotary microtome (5μm thickness).

[0062] ③ Dewaxing: Place the paraffin sections in a baking oven at 60℃ for 2 hours, then dewax with xylene I (20 min) → xylene II (10 min).

[0063] ④ Hydration: Anhydrous ethanol I (3 min) → Anhydrous ethanol II (3 min) → 95% ethanol (3 min) → 85% ethanol (3 min) → 75% ethanol (3 min) → Distilled water 10 min.

[0064] ⑤ Staining: Hematoxylin 6s → wash in water → differentiate with 1% hydrochloric acid alcohol for 2s, quickly remove and wash in water → 1% ammonia water for 2s (under the microscope, the cell nucleus appears blue-purple, and the cytoplasm is colorless), rinse with distilled water → 75% ethanol for 1min → 85% ethanol for 1min → eosin for 3min, rinse with running water (under the microscope, the cytoplasm appears purplish-red), 95% ethanol for 30s → anhydrous ethanol for 30s → xylene I for 1min → xylene II for 3min.

[0065] ⑥ Mounting: Add a drop of neutral resin to the undried tissue, cover with a coverslip, observe under a microscope after one day, and take a picture.

[0066] (IV) Experimental Results

[0067] The results are as follows Figures 1-3 As shown: Before the experiment, the body weight distribution of mice in each group was balanced. Within 7 weeks, the control group mice gained significant weight and moved slowly, while the experimental group mice were below their initial body weight after three weeks and gradually lost weight, showing agility. Figure 1 (A); The experimental group mice had significantly less subcutaneous fat, visceral fat, and brown fat distribution than the control group (A). Figure 1 (Middle B); The proportions of visceral fat, perirenal fat, epididymal fat, groin fat, and total fat in the body weight of mice in the experimental group were significantly lower than those in the control group. Figure 2 Compared with the control group mice, the experimental group mice had significantly smaller adipocytes. Figure 3 The above results indicate that Eva1a overexpression significantly improves fat accumulation.

[0068] Example 2

[0069] The therapeutic effects of Eva1a overexpression on non-alcoholic fatty liver disease and hypercholesterolemia in ob / ob obese mice (I) Experimental materials

[0070] Mouse liver tissue and serum were obtained from Example 1; Oil Red O staining solution and eosin staining solution were purchased from Beijing Solarbio Science & Technology Co., Ltd.; hematoxylin staining solution was purchased from Zhuhai Beso Biotechnology Co., Ltd.; TG, TC, AST, ALT, LDL-C and HDL-C detection kits were purchased from Nanjing Jiancheng Biotechnology Co., Ltd.; paraffin embedding of mouse liver tissue was prepared by Wuhan Boster Biological Co., Ltd.

[0071] (II) Experimental Methods

[0072] (1) Determination of liver coefficient in mice

[0073] ① Weigh each mouse in both groups separately, and then euthanize them by dislocation of the neck. Fix the mice in a supine position, and then moisten the fur on the chest and abdomen of the mice with distilled water.

[0074] ② Use tweezers to clamp the skin in the middle of the mouse's abdomen, cut the skin along the middle of the abdomen towards the head all the way to below the xiphoid process, and then cut the skin towards the tail end to expose the subcutaneous fascia, muscles, etc. layer by layer, open the abdominal cavity, and fully expose all organs.

[0075] ③ Locate and remove the liver of the mouse, place it on sterile gauze, wipe off any residual blood on the surface of the liver, place the liver in a sterile culture dish, weigh it, and calculate the ratio of liver weight to body weight for each mouse.

[0076] (2) H&E staining of mouse liver tissue

[0077] The method and steps are the same as those for H&E staining of adipose tissue in Example 1.

[0078] (3) Oil Red O staining of mouse liver tissue

[0079] ① Frozen slices

[0080] Mouse livers were fixed with 4% paraformaldehyde and incubated overnight at 4°C. They were then dehydrated with 30% sucrose and incubated overnight at 4°C. The tissues were embedded in OCT and sectioned using a Leica CM1520 cryostat (15–20 μm thickness).

[0081] ② Staining

[0082] Frozen sections were thawed for 20 min, rinsed with PBS for 3 min, then stained with 60% isopropanol for 1 min, followed by staining with Oil Red O working solution in the dark for 10 min, then stained with 60% isopropanol for 3 s, washed with PBS, then stained with hematoxylin for 6 s, then rinsed in water, then differentiated with 1% hydrochloric acid alcohol for 2 s, quickly removed, rinsed in water, and then blued with 1% ammonia for 2 s. The sections were then mounted with glycerol gelatin preheated to 55℃, observed under a microscope, and photographed.

[0083] (4) Measurement of TG and serum markers in mouse liver

[0084] ①Liver TG determination: Accurately weigh liver tissue, add 9 times the volume of anhydrous ethanol at a ratio of weight (g): volume (mL) = 1:9, mechanically homogenize under ice-water bath conditions, centrifuge at 2500g at 4℃ for 10min, collect the supernatant, and detect the TG level in liver tissue using a fully automated biochemical analyzer.

[0085] ② Serological index determination: Changes in relevant indicators in mouse blood were measured using a fully automated biochemical analyzer.

[0086] (III) Experimental Results

[0087] The results are as follows Figures 4-6 As shown in the figure. Compared with the control group, the experimental group mice had significantly smaller livers and a significantly lower liver coefficient. Figure 4 (A); The liver structure of the control group mice was unclear, with numerous vacuoles appearing in the cells, and many of these vacuoles were very large. Figure 4 (B) The oil red coloring is very obvious. Figure 4 The presence of lipid droplets (C) indicates significant lipid deposition and inflammatory infiltration, typical of fatty liver. In contrast, the experimental group mice showed clear liver structure, with a significantly reduced number and volume of intracellular vacuoles. Figure 4 Medium B), Oil Red staining is lighter ( Figure 4 The presence of C indicates a significant reduction in lipid droplet deposition and milder inflammatory infiltration; compared to the control group, the experimental group mice showed a significant decrease in TG content in the liver and a significant decrease in ALT and AST levels in the blood. Figure 5This indicates that non-alcoholic fatty liver disease was significantly reduced in ob / ob obese mice, and liver cell function was further improved; the levels of TC, HDL-C, and LDL-C in the blood of the experimental group mice were all significantly lower than those in the control group. Figure 6 This indicates that the hypercholesterolemia caused by obesity has been significantly improved.

[0088] Example 3

[0089] Effect of Eva1a overexpression on insulin resistance in ob / ob obese mice

[0090] (I) Experimental Materials

[0091] Mouse serum was obtained from Example 1; mouse adiponectin (ADPN) ELISA kit was purchased from Shanghai Jining Industrial Co., Ltd.; blood glucose meter was purchased from Beijing Yicheng Bioelectronics Technology Co., Ltd.; insulin, NovoMix, was purchased from Guantianmingjun Pharmacy.

[0092] (II) Experimental Methods

[0093] (1) Measurement of ADPN levels in mice

[0094] The level of ADPN in mouse blood was measured using an enzyme-linked immunosorbent assay (ELISA) reader according to the instructions of the adiponectin (ADPN) ELISA kit.

[0095] (2) Measurement of fasting blood glucose in mice

[0096] During the experiment, fasting blood glucose levels were measured weekly by cutting off the rats' tails, using the following method:

[0097] Before measurement, the mice were fasted for 12 hours but allowed to drink water. Then, the mice were removed from their cages and held in place. The tip of the tail was cut off by about 1-2 mm with scissors. Then, blood was squeezed from the base of the tail to the tip and collected into a droplet. The first drop of blood was discarded. The second drop of blood was used to measure the blood glucose level. Excess blood was wiped clean with a dry cotton ball and pressure was applied to stop the bleeding.

[0098] (3) Insulin tolerance test (ITT)

[0099] Six weeks after the start of the experiment, the mice were fasted but allowed to drink water for 4 hours. Then the mice were weighed and injected intraperitoneally with insulin at a dose of 0.75 U / Kg. Blood glucose was measured at five time points: 0, 15, 30, 60 and 90 min by cutting off the tail.

[0100] (III) Experimental Results

[0101] The results are as follows Figure 7 As shown. Compared with the control group, the ADPN level in the experimental group mice was significantly increased ( Figure 7 (A); The fasting blood glucose level of the experimental group mice was consistently lower than that of the control group (A). Figure 7(B); and the experimental group mice showed increased insulin sensitivity compared to the control group (B); Figure 7 (C)

[0102] Example 4

[0103] Validation of Eva1a overexpression in the liver, adipose tissue, and heart tissue of ob / ob obese mice

[0104] (I) Experimental Materials

[0105] The liver, adipose, and heart tissues of mice were obtained from Example 1; TRIzol was purchased from TaKaRa. IIQ RTSuperMix and SYBR Color qPCR Master Mix were purchased from Novizan Biotechnology Co., Ltd.; primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0106] (II) Experimental Methods

[0107] (1) RNA extraction: RNA was extracted from the tissue according to the instructions of the TRIzol kit.

[0108] (2) Reverse transcription

[0109] Prepare a 20 μL reaction mixture: 4 μL of 4×g DNAwiper Mix, 1 μg of template RNA and the remainder of RNase-free ddH2O, mix gently and incubate at 42°C for 2 min.

[0110] Add 4 μL of 5×HiScriptⅢqPCR SuperMix to the above reaction tube, mix gently, and perform reverse transcription at 37℃ for 15 min and 85℃ for 5 s.

[0111] (3) qRT-PCR (SYBR method)

[0112] Prepare 20 μL of a mixture in a 0.2 μL eight-tube qPCR array: 10 μL 2×ChamQ SYBR qPCRMaster Mix, 0.5 μL Primer 1 (10 μM), 0.5 μL Primer 2 (10 μM), and Template cDNA.

[0113] Add 1-2 μL, then add ddH2O to bring the total to 20 μL.

[0114] Reaction conditions: 95℃ for 30s pre-denaturation → 95℃ for 10s, 60℃ for 30s, 40 cycles.

[0115] Target gene: Eva1a

[0116] Upstream primer sequence (SEQ ID No. 1): CCTTGGCCGCCTTGGTGATGAG

[0117] Downstream primer sequence (SEQ ID No. 2): TACCATCCTCGCTGTCGCTGCT

[0118] Internal reference gene: Gapdh

[0119] Upstream primer sequence (SEQ ID No. 3): AACGGATTTGGTCGTATTGGG

[0120] Downstream primer sequence (SEQ ID No. 4): TGCTCCTGGAAGATGGTGAT

[0121] (5) On-machine testing

[0122] The detection and analysis were performed using the QuantStudio 3 real-time quantitative PCR system.

[0123] (III) Experimental Results

[0124] The results are as follows Figure 8 As shown in the figure, compared with the control group, the mRNA levels of the Eva1a gene in the liver, adipose tissue, and heart tissue of the experimental group mice were significantly increased, indicating that the tail vein annotation of AAV-Eva1a overexpression of Eva1a was successful.

[0125] Example 5

[0126] Effects of Eva1a overexpression on cardiac function in ob / ob obese mice

[0127] (I) Experimental Materials

[0128] The air anesthesia system and small animal ultrasound imaging system were purchased from Beijing Yiren Hengye Technology Co., Ltd.; the medical ultrasound coupling agent was purchased from Qingdao Hainuo Biotechnology Co., Ltd.; and the hair removal cream was purchased from NBSN Medical Device Specialty Store. Five mice were randomly selected from each of the experimental group and the control group.

[0129] (II) Experimental Methods

[0130] Mice were anesthetized with isoflurane gas, their limbs were fixed with tape and their abdomens facing upwards, and hair was removed from the chest of the mice with hair removal cream. Left ventricular M-mode echocardiography was performed using a small animal ultrasound imaging system to monitor the mice's heart rate, stroke volume, cardiac output and ejection fraction, and statistical analysis was performed.

[0131] (III) Experimental Results

[0132] Left ventricular M-mode echocardiography as shown Figure 9As shown, except that the heart rate of the experimental group mice was slightly lower than that of the control group, there were no significant differences in stroke volume, cardiac output, and ejection fraction between the two groups. Figure 10 This indicates that Eva1a overexpression does not impair cardiac function or have cardiotoxic effects in ob / ob obese mice.

[0133] Example 6

[0134] Effects of Eva1a overexpression on renal function and inflammatory factor secretion in ob / ob obese mice

[0135] (I) Experimental Materials

[0136] Mouse serum was obtained from Example 1; uric acid (UA) and creatinine (CRE) detection kits were purchased from Nanjing Jiancheng Biotechnology Co., Ltd.; IL-6, IL-1β, and TNF-α ELISA detection kits were purchased from Shanghai Jining Industrial Co., Ltd.

[0137] (II) Experimental Methods

[0138] According to the kit instructions, the levels of UA, CRE, IL-6, IL-1β, and TNF-α in mouse blood were measured using an ELISA reader.

[0139] (III) Experimental Results

[0140] The results are as follows Figure 11 As shown, there were no significant differences in UA and CRE levels between the two groups of mice. Figure 11 The results (A and B) indicate that Eva1a overexpression has no effect on renal function in ob / ob obese mice; there was no significant difference in IL-1β levels, while IL-6 and TNF-α levels were significantly decreased, indicating that Eva1a overexpression reduced the secretion of these two inflammatory factors in ob / ob obese mice.

[0141] Based on the results of Examples 4-6, Eva1a overexpression showed no cardiotoxicity or nephrotoxicity in ob / ob obese mice, and even reduced the level of inflammation in vivo.

[0142] Example 7

[0143] Effects of EVA1A overexpression on lipid droplet accumulation in human hepatocytes

[0144] (I) Experimental Materials

[0145] HepG2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences, and L02 cells were purchased from Shanghai Chuanqiu Biotechnology Co., Ltd. (introduced by ATCC); plasmid Myc-EVA1A (published in the article: Qian Xu#, Zhaozhong Liao#, Zunshuang Gong#, Xiaokun Liu, Yuling Yang, Zhe Wang, Weiyan Yang, Lin Hou, Jiejie Yang, Junying Song, Wenjing Liu, Bin Wang, Junnan Hua, Mingyi Pu, Ning Li*. Down-regulation of EVA1A by miR-103a-3p promotes hepatocellular carcinoma cells proliferation and migration. Cell Mol Biol Lett. 2022; 27(1):93; containing the EVA1A coding region cDNA gene number: 84141), control plasmid Myc-vector (published in the article: Yang J, Wang B, Xu Q, Yang Y, Hou L, Yin K, Guo Q, Hua Y, Zhang L, Li Y, Zhang J,Li N*.TMEM166 inhibits cell proliferation, migration and invasion in hepatocellular carcinoma via upregulating TP53.MolCell Biochem.2021Feb;476(2):1151-1163);Lipofectamin2000 transfection reagent, purchased from Invitrogen.

[0146] (II) Experimental Methods

[0147] (1) Constructing stable HepG2 and L02 cell lines overexpressing EVA1A

[0148] HepG2 and L02 cells were transfected with the Myc-EVA1A plasmid, and stable EVA1A overexpressing cell lines were established as the experimental group through G418 selection. The control group was the Myc-vector stable transfected cell line.

[0149] (2) High fatty acid-loaded HepG2 and L02 cells

[0150] HepG2 and L02 cells were cultured in DMEM medium containing 10% fetal bovine serum and RPMI-1640 medium, respectively, with 400 nM oleic acid added for 12 h, which induced fatty degeneration of their hepatocytes.

[0151] (3) Oil Red O staining of human hepatocytes

[0152] ① Discard the culture medium, wash 3 times with PBS, add 1 mL of 4% paraformaldehyde and fix at room temperature for 15 min, discard the fixative, and rinse with PBS for 3 min × 3 times.

[0153] ② Add 60% isopropanol and treat for 1 min, remove the isopropanol, and immediately add freshly prepared filtered Oil Red O staining solution. Stain at room temperature in the dark for 15 min.

[0154] ③ After staining, remove the staining solution, rinse with 60% isopropanol for 1-2 seconds, wash 3 times with PBS, and observe under a microscope. The background should be colorless.

[0155] ④ Stain the nucleus with hematoxylin for 3 minutes, rinse with running water, differentiate, and reverse blue;

[0156] ⑤ Observe under a microscope, take pictures, and perform statistical analysis;

[0157] ⑥ Isopropanol extraction of oil red and detection of OD 490 The absorbance value at that point is used for semi-quantitative analysis.

[0158] (4) Determination of ALT and TG content in human hepatocytes

[0159] ① Collect the supernatant of cell culture medium from each group and test the ALT content of each group according to the instructions of Nanjing Jiancheng reagent kit.

[0160] ② Add anhydrous ethanol to the cells to be tested to cover the cell surface. When the cells turn white, scrape them off with a cell scraper and immerse them in ethanol.

[0161] ③ Transfer the cells and ethanol to a glass homogenizer and grind them into a suspension;

[0162] ④ Collect the suspension, centrifuge at 4,000 rpm for 10 min, and take the supernatant to detect the intracellular TG content according to the Nanjing Jiancheng kit.

[0163] (III) Experimental Results

[0164] Oil Red O staining results as follows Figure 12 As shown, compared with the control group, lipid droplet accumulation in the experimental group was significantly reduced; the levels of ALT and TG in the experimental group were significantly lower than those in the control group. Figure 13 This indicates that EVA1A overexpression can significantly reduce lipid droplet accumulation in human hepatocytes.

[0165] Example 8

[0166] Effects of EVA1A overexpression on lipid droplet lysis in human hepatocytes

[0167] (I) Experimental Materials

[0168] The mCherry-LC3 plasmid was donated by Professor Liu Wei's laboratory at the School of Medicine, Zhejiang University, and has been published in the article: You Z, Xu Y, Wan W, Zhou L, Li J, Zhou T, Shi Y, Liu W. TP53INP2 contributes to autophagosome formation by promoting LC3-ATG7 interaction. Autophagy. 2019 Aug; 15(8):1309-1321. The GFP-mCherry-LC3 plasmid was constructed by inserting the mCherry-LC3 fusion gene from the mCherry-LC3 plasmid into the pEGFP-C1 vector, with insertion sites of Xho I and BamHI. DAPI was purchased from Beijing Solarbio Science & Technology Co., Ltd.; Bodipy 493 / 503 was purchased from GLPBIO; SDS-PAGE gel preparation kit was purchased from Beijing Kangwei Century Biotechnology Co., Ltd.; EVA1A antibody was purchased from Abcam; β-actin and CPT1a antibodies were purchased from Wuhan Sanying Co., Ltd.; and a STELLARIS laser confocal microscope was used. 8. Purchased from Leica.

[0169] (II) Experimental Methods

[0170] (1) Cell transfection

[0171] ① Select a stable cell line HepG2 with good growth status (see Example 7), resuspend it in 1 mL of complete culture medium to form a single cell suspension, and seed 200 μL / well in a 6-well plate.

[0172] ② When the cell adhesion density is 80% to 90%, follow the Lip2000 instructions to transfect the dual fluorescent plasmid GFP-mCherry-LC3 or the single fluorescent plasmid mCherry-LC3 in the dark.

[0173] (2) Bodipy 493 / 503 staining

[0174] ① Weigh out Bodipy 493 / 503 powder, dilute with PBS, and prepare a 5mM Bodipy stock solution;

[0175] ② Discard the culture medium, add 1 mL of 4% paraformaldehyde to fix for 15 min, discard the fixative, and wash with PBS for 3 min × 3 times;

[0176] ③ Add 1 mL of 0.2% Triton X100 and permeate the membrane for 10 min. Discard the permeate solution and rinse with PBS for 3 min × 3 times.

[0177] ④ Dilute the stock solution with PBS to prepare a 10 μM staining working solution and stain in the dark for 25 min;

[0178] ⑤ After staining, remove the staining solution, rinse with PBS for 3 min × 3 times in the dark, stain with ready-to-use DAPI for 10–15 min, and repeat the rinsing steps.

[0179] ⑥ Mount the slide, observe under a fluorescence microscope, and take photographs.

[0180] (3) DAPI staining

[0181] ① Seed cells into 12-well plates containing coverslip, 1 mL of culture medium per well.

[0182] ② Cells seeded on coverslips were fixed in 4% paraformaldehyde for 15 min and washed with PBS for 3 min × 3 times.

[0183] ③ Permeabilize with 0.2% Triton X100 for 10 min, then rinse with PBS for 3 min × 3 times.

[0184] ④ Stain with ready-to-use DAPI for 10-15 min, then rinse with PBS for 5 min × 3 times.

[0185] ⑤ Mount the slide, observe it under a laser scanning confocal microscope, and take a picture.

[0186] (4) Protein sample preparation

[0187] ① Discard the culture medium, wash twice with PBS, add 100 μL of lysis buffer (containing 1% volume PMSF and Cocktail), scrape off the cells and collect them into a 1.5 mL EP tube; place on ice for 30 min, vortex for 15 s every 10 min, centrifuge at 12000 rpm for 20 min at 4℃, and transfer the supernatant into a new 1.5 mL EP tube.

[0188] ② Prepare the BCA working solution according to the instructions, add the appropriately diluted sample to be tested and the working solution, mix well, let stand at 37℃ for 30 min, and detect the absorbance value at a wavelength of 562nm. Calculate the sample concentration according to the standard curve.

[0189] ③ Add an appropriate amount of 5×LoadingBuffer according to the volume of each protein group, and boil in a water bath at 100℃ for 10 minutes.

[0190] (5) Western Blot detection

[0191] ① Gel preparation: Prepare acrylamide gel of appropriate concentration according to the molecular weight of the protein to be tested.

[0192] ② Sample loading: 40-100 μg of protein sample per group, add an appropriate volume according to the sample concentration.

[0193] ③ Electrophoresis: 80V constant voltage electrophoresis.

[0194] ④ Transfer membrane: Cut an appropriate size PVDF membrane and soak it in methanol to activate it. After 5 minutes, soak it in the electro-transfer solution. Assemble the "sandwich" clamps in the order of sponge at the bottom, filter paper at the top, black glue and white membrane. Insert the assembled clamps into the electro-transfer tank, add the electro-transfer solution, and electro-transfer at a constant current of 300mA for 110 minutes.

[0195] ⑤ Sealing: Prepare 5% skim milk with TBST and seal on a shaker at room temperature for 3 hours.

[0196] ⑥ Primary antibody: Wash the membrane thoroughly 3 times with TBST, add the corresponding diluted primary antibody, and incubate overnight at 4°C.

[0197] ⑦ Secondary antibody: Wash the membrane thoroughly 3 times with TBST, 5 min each time, add the corresponding diluted secondary antibody, incubate on a shaker at room temperature for 45 min, and repeat the washing steps.

[0198] ⑧ Development: Prepare ECL working solution according to the instructions at a 1:1 ratio, immerse the PVDF membrane in the ECL working solution, incubate in the dark for 1 minute, and then develop and photograph.

[0199] (III) Experimental Results

[0200] The results are as follows Figure 14 and Figure 15 As shown, HepG2 cells stably overexpressing Myc-EVA1A exhibited a significantly higher number of red dots on autophagosome LC3 (indicating autophagosome-lysosome fusion and quenching of green GFP fluorescence) compared to the control group. Figure 14 (A and B) indicates that Myc-EVA1A overexpression promotes autophagy in HepG2 cells; overexpression of EVA1A significantly increases the expression of CPT1A, a key enzyme in fatty acid β-oxidation. Figure 14 The presence of C indicates that it promotes the oxidation and utilization of fatty acids; overexpression of EVA1A significantly increases the number of co-localizations of autophagosome LC3 markers (red) and lipid droplet markers (green Bodipy). Figure 15 (A and B) indicates that overexpression of EVA1A promotes the autophagic breakdown of lipid droplets.

[0201] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An overexpression EVA1A The use of adeno-associated virus recombinant vectors for genes in the preparation of drugs to alleviate and / or treat obesity, fatty liver, and / or obesity complications, characterized in that, The fatty liver is non-alcoholic fatty liver disease; the obesity complications are hypercholesterolemia and insulin resistance syndrome.

2. A medicament for relieving and / or treating obesity and non-alcoholic fatty liver disease, characterized in that, Overexpression EVA1A The adeno-associated virus recombinant vector of the gene is the active ingredient.

3. The drug according to claim 2, characterized in that, The base vector of the adeno-associated virus recombinant vector includes an adeno-associated virus AAV vector.

4. The drug according to claim 3, characterized in that, The AAV vector serotypes include 8 types.

Images