Gossypium barbadense wilt disease resistance protein gbpp2c80 and coding gene and application thereof

Abstract

The application discloses a gossypium barbadense wilt disease resistance protein GbPP2C80 and an encoding gene and application thereof. The application relates to the field of botany, in particular to the gossypium barbadense wilt disease resistance protein GbPP2C80 and an encoding gene and application thereof. The protein of the application is any one of the following: A1) an amino acid sequence shown in SEQ ID No. 3; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues on the protein of A1), the protein having more than 80% identity with the protein shown in A1) and having plant wilt disease resistance regulation; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2). The wilt disease incidence of a wilt disease susceptible gossypium barbadense plant in which GbPP2C80 is silenced by VIGS technology is significantly reduced, the GbPP2C80 protein can negatively regulate the wilt disease resistance of gossypium barbadense, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of botany, specifically to the wilt resistance protein GbPP2C80 of sea island cotton and its encoding gene and applications. Background Technology

[0002] Fusarium wilt is a vascular disease caused by Fusarium oxysporum, severely impacting cotton production. In China, physiological race 7 of the fungus is the most widespread and has the highest virulence. In cotton-growing areas affected by Fusarium wilt, leaves and bolls fall off in large quantities, resulting in yield losses ranging from 10% to 30%-50% in severe cases, and a significant decline in cotton quality. Sea island cotton is susceptible to Fusarium wilt, but very few resistance genes have been identified and cloned. Discovering important resistance genes for Fusarium wilt in sea island cotton and elucidating the molecular mechanisms underlying its resistance has significant theoretical guidance and practical application value.

[0003] Protein phosphatase 2C (PP2C) is a class of monomeric serine / threonine residue protein phosphatases that dephosphorylate proteins. Arabidopsis protein phosphatases PLL4 and PLL5 and tobacco protein phosphatase Pic1 are negative regulators of pattern-triggered immunity. However, there are currently no reports on PP2C protein regulation of wilt resistance in sea island cotton. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate the resistance of plants to wilt disease.

[0005] To address the problems existing in the prior art, the present invention provides a protein.

[0006] The protein provided by this invention may be any of the following:

[0007] A1) A protein with the amino acid sequence shown in SEQ ID No. 3;

[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) that has more than 80% identity with the protein shown in A1) and has the function of regulating plant wilt resistance; for example, those skilled in the art can, based on the amino acid sequence shown in SEQ ID No. 3 and conventional techniques such as the conserved substitution of amino acids, obtain a protein mutant with the same function as the amino acid sequence shown in SEQ ID No. 3 by substituting, deleting and / or adding one or more amino acids without affecting its activity.

[0009] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein described in A1 above is named GbPP2C80.

[0011] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 3 in the sequence listing.

[0012] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0014] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein GbPP2C80 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein GbPP2C80 isolated in this invention, provided they encode and function as protein GbPP2C80, are derived from and equivalent to the nucleotide sequence of this invention.

[0015] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0016] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0017] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] In this document, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0019] The protein mentioned above is derived from Gossypium barbadense L.

[0020] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0021] B1) Nucleic acid molecules that encode the proteins described above;

[0022] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0023] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0024] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0025] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0026] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0027] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0028] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0029] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0030] C3) contains an expression cassette encoding the gene described in C2);

[0031] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0032] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0033] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0034] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0035] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0036] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is a gene as shown in E1) or E2) below:

[0037] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 1;

[0038] E2) The nucleotide sequence is the cDNA molecule or DNA molecule of SEQ ID No. 2.

[0039] The DNA molecule shown in SEQ ID No. 1 (the GbPP2C80 gene that regulates plant disease resistance) encodes the protein with the amino acid sequence of SEQ ID No. 3.

[0040] The nucleotide sequence shown in SEQ ID No. 1 is the nucleotide sequence of the gene encoding protein GbPP2C80 (CDS).

[0041] The nucleotide sequence shown in SEQ ID No. 2 is the nucleotide sequence of the genome of protein GbPP2C80.

[0042] The GbPP2C80 gene described in this invention can be any nucleotide sequence capable of encoding the protein GbPP2C80. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0043] B1) The nucleic acid molecule may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 1.

[0044] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 1 and originate from the same species.

[0045] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0046] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be the vectors pCLCrVA and p35S::GFP.

[0047] Recombinant expression vectors containing the GbPP2C80 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0048] When constructing a recombinant plant expression vector using the GbPP2C80 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0049] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0050] By using any vector capable of guiding the expression of exogenous genes in plants, the GbPP2C80 gene or gene fragments provided in this invention can be introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants with altered resistance to Fusarium wilt. The expression vector carrying the GbPP2C80 gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0051] As a specific embodiment, the recombinant vector described above is the recombinant vector pCLCrVA-GbPP2C80. The recombinant vector pCLCrVA-GbPP2C80 is obtained by replacing the fragment between the Spe I and Pac I recognition sites of the pCLCrVA vector (starting vector) sequence with the DNA molecule shown in SEQ ID No. 4, while keeping the other nucleotides of the pCLCrVA vector (starting vector) unchanged.

[0052] As a specific embodiment, the recombinant vector described above is the recombinant vector p35S::GbPP2C80-GFP.

[0053] The recombinant vector p35S::GbPP2C80-GFP is obtained by replacing a small fragment between the restriction endonuclease Kpn I and Xba I recognition sequences of the plasmid p35S::GFP with the DNA molecule shown in Sequence 1 of the sequence listing (with the stop codon TGA removed) while keeping the other sequences of the p35S::GFP vector unchanged.

[0054] The recombinant plasmid p35S::GbPP2C80-GFP expresses the GbPP2C80 protein shown in sequence 3 of the sequence listing. The recombinant plasmid p35S::GbPP2C80-GFP contains an expression cassette of the GbPP2C80-GFP fusion protein, in which the 35S promoter initiates transcription of the GbPP2C80 gene.

[0055] The recombinant microorganism may specifically be recombinant Agrobacterium GV3101 / GbPP2C80-GFP.

[0056] The recombinant Agrobacterium GV3101 / GbPP2C80-GFP is a recombinant bacterium obtained by introducing the recombinant vector p35S::GbPP2C80-GFP into Agrobacterium tumefaciens GV3101.

[0057] The microorganisms described in this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can originate from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, *Agrobacterium tumefaciens* GV3101 may be mentioned.

[0058] The present invention also provides the use of the protein GbPP2C80 described above, or an expression substance regulating the gene, or a substance regulating the activity or content of said protein, in any of the following:

[0059] The application of the protein or gene expression substance or substance regulating the activity or content of the protein described in U1) in regulating plant resistance to Fusarium wilt.

[0060] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U2) in the preparation of products that regulate plant resistance to wilt disease.

[0061] The application of the protein or gene expression substance or substance regulating the activity or content of the protein described in U3) in cultivating plants resistant to Fusarium wilt;

[0062] The application of the protein or gene-regulating substance or substance regulating the activity or content of the protein described in U4) in the preparation of products for cultivating plants resistant to Fusarium wilt;

[0063] The application of the protein or gene expression substance or substance that regulates the activity or content of the protein described in U5) in plant breeding.

[0064] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein GbPP2C80.

[0065] In the above applications, the substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material related to the protein, and the biological material may be any one of B1) to B7) below:

[0066] B1) Nucleic acid molecules that encode the proteins described above;

[0067] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0068] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0069] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0070] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0071] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0072] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0073] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0074] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0075] C3) contains an expression cassette encoding the gene described in C2);

[0076] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0077] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0078] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0079] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0080] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0081] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0082] The present invention also provides a method for regulating plant resistance to wilt disease, comprising regulating the activity and / or content of the proteins described above in the target plant, and / or the expression level of the gene encoding the proteins, to regulate plant resistance to wilt disease.

[0083] In the above method, regulating the activity and / or content of the protein GbPP2C80 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GbPP2C80 into the recipient plant to obtain a target plant with altered resistance to Fusarium wilt; the gene encoding GbPP2C80 encodes the protein GbPP2C80.

[0084] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0085] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0086] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0087] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress. Plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants but also their progeny. For transgenic plants, the gene can be propagated within the species or transferred into other varieties of the same species using conventional breeding techniques, especially commercial varieties. The transgenic plants include seeds, callus tissue, intact plants, and cells.

[0088] The present invention also provides a method for cultivating plants with altered resistance to Fusarium wilt, comprising: 1) inhibiting, reducing, or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing, or silencing the activity and / or content of the coding gene of the protein described above, to obtain a plant with increased resistance to Fusarium wilt; 2) increasing, enhancing, and / or upregulating the expression level of the coding gene of the protein described above in the target plant, and / or increasing, enhancing, and / or upregulating the activity and / or content of the coding gene of the protein described above, to obtain a plant with reduced resistance to Fusarium wilt.

[0089] As one embodiment of the present invention, the method for cultivating wilt-resistant plants includes the following steps:

[0090] (1) Construct a recombinant expression vector for the gene encoding the protein described above (the amino acid sequence of the protein is sequence 3);

[0091] (2) Introduce the expression vector constructed in step (1) into plants;

[0092] (3) Plants resistant to Fusarium wilt were obtained through screening and identification.

[0093] In one specific embodiment, a method for cultivating plants with enhanced resistance to Fusarium wilt includes the following steps: inhibiting the expression of nucleic acid molecules encoding the GbPP2C80 protein in the target plant to obtain transgenic plants with enhanced resistance to Fusarium wilt. Specifically, inhibiting the expression of nucleic acid molecules encoding the GbPP2C80 protein in the target plant can be achieved by introducing an interference vector targeting the GbPP2C80 protein into the target plant. Alternatively, inhibiting the expression of nucleic acid molecules encoding the GbPP2C80 protein in the target plant can be achieved by introducing a gene silencing vector targeting the GbPP2C80 protein into the target plant.

[0094] The gene silencing vector may be the recombinant vector pCLCrVA-GbPP2C80. The recombinant vector pCLCrVA-GbPP2C80 is obtained by replacing the fragment between the Spe I and Pac I recognition sites of the pCLCrVA vector (starting vector) sequence with the DNA molecule shown in SEQ ID No. 4, while keeping the other nucleotides of the pCLCrVA vector (starting vector) unchanged.

[0095] The present invention also provides a method for cultivating plants with enhanced resistance to Fusarium wilt, comprising the following steps: inhibiting, reducing or silencing the expression level of the coding gene of the protein described above in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the coding gene of the protein described above, to obtain plants with enhanced resistance to Fusarium wilt.

[0096] In this invention, the purpose of plant breeding includes cultivating plants resistant to Fusarium wilt.

[0097] In the above applications or methods, the plant is any one of the following:

[0098] N1) Dicotyledons;

[0099] N2) Malvales (Malva orders)

[0100] N3) Malvaceae family plants;

[0101] N4) Plants of the genus *Gossypium*;

[0102] N5) Cotton.

[0103] The cotton mentioned above may be the disease-susceptible variety II15-3465 of Gossypium barbadense L.

[0104] This invention, based on the identification of Fusarium wilt incidence in natural populations of Island cotton and genome-wide association analysis, locates the genetic locus for Fusarium wilt resistance in Island cotton at position 1159232 on chromosome D03. This variant is located 1.9 kb upstream of the gene GbPP2C80, which contains a non-synonymous mutation T / C (Gbar_D03_1162571) significantly associated with the incidence of Fusarium wilt in Island cotton. The GbPP2C80 gene encodes a type IIC protein phosphatase, and its expression level is significantly higher in susceptible Island cotton than in resistant Island cotton. Silencing GbPP2C80 in susceptible Island cotton using virus-induced gene silencing (VIGS) technology significantly enhances its resistance to Fusarium wilt. GbPP2C80 is primarily located on the cell membrane and interacts with a Fusarium wilt resistance protein, GbWAKL14, on the cell membrane. GbPP2C80, as a novel resistance gene to Fusarium wilt in island cotton, has certain theoretical and practical value. Attached Figure Description

[0105] Figure 1 Correlation heatmaps of wilt incidence rates in sea island cotton populations surveyed in Xinjiang, China in 2015, 2016, 2018, and 2019.

[0106] Figure 2The images show the local Manhattan plot and LD heatmap of the incidence of Fusarium wilt in the Sea Island cotton population. a) is the local Manhattan plot of the incidence of Fusarium wilt in the Sea Island cotton population, with arrows indicating the located highly significant associated SNP (Gbar_D03_1159232) and the non-synonymous SNP within the associated gene (Gbar_D03_1162571), respectively; b) is the local LD ​​heatmap near the significantly non-synonymous SNP within the candidate gene.

[0107] Figure 3 This indicates the location of nonsynonymous mutations in the GbPP2C80 gene. The blue and yellow rectangles represent the untranslated region (UTR) and coding region (CDS), respectively, and the black lines represent introns. Ref TTG(L) indicates that the reference codon TTG encodes leucine (abbreviated as L), with the key mutation site being the second T in the middle position; Alt TCG(S) indicates that the variant codon TCG encodes serine (abbreviated as S), with the key mutation site being the second C in the middle position, i.e., a mutation from thymine (T) to cytosine (C), resulting in the amino acid change from leucine to serine.

[0108] Figure 4 The incidence of Fusarium wilt in island cotton varieties carrying two mutation types, GbPP2C80 and GbPP2C80.

[0109] Figure 5 This study uses qRT-PCR to detect the expression difference of GbPP2C80 in the resistant Fusarium wilt variety T10-280 and the susceptible Fusarium wilt variety II15-3464, and to plot the GbPP2C80 expression level in the susceptible Fusarium wilt variety after VIGS. R_WT represents the wild-type control of the resistant Fusarium wilt variety T10-280, and S_WT represents the wild-type control of the susceptible Fusarium wilt variety II15-3464.

[0110] Figure 6 The disease incidence phenotype values ​​were calculated 25 days after inoculation with *Fusarium wilt* (physiological race 7) following VIGS silencing of GbPP2C80. R_WT represents the wild-type control of the resistant *Fusarium wilt* variety T10-280, and S_WT represents the wild-type control of the susceptible *Fusarium wilt* variety II15-3464.

[0111] Figure 7 This diagram illustrates the disease incidence of cotton wilt pathogen (physiological race 7) 25 days after inoculation with VIGS-silenced GbPP2C80. In the diagram, a represents the plant disease phenotype; b represents the leaf disease phenotype. R_WT represents the wild-type control of the resistant wilt variety T10-280, and S_WT represents the wild-type control of the susceptible wilt variety II15-3464.

[0112] Figure 8Subcellular localization of GbPP2C80. a) shows the cellular localization of p35S::GbPP2C80-GFP in recombinant plants carrying the GbPP2C80-GFP fusion vector; b) shows the cellular localization of p35S::GFP in recombinant plants carrying the empty GFP vector, serving as a control.

[0113] Figure 9 To verify the protein-protein interaction between GbWAKL14 and GbPP2C80 using bimolecular fluorescence complementation (BiFC). a) shows the interaction between GbWAKL14-YFPN and GbPP2C80-YFPC; b) shows the control using empty YFPN and YFPC vectors. Detailed Implementation

[0114] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0115] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0116] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0117] The p35S::GFP plasmid in the following examples is described in: Zhang W, et al. Natural variations at TIG1 encoding a TCP transcription factor contribute to plant architecture domestication in Rice. Mol Plant. 2019; 12(8):1075-1089. The biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of the present invention and shall not be used for any other purpose.

[0118] The pCLCrVA plasmid used in the following examples is described in: Zhao N, et al. Genomic and GWAS analyses demonstrate phylogenomic relationships of Gossypium barbadense in China and selection for fiber length, lint percentage and Fusarium wilt resistance. Plant Biotechnol J. 2022; 20(4):691-710. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0119] The pCambia 1300-YFPC plasmid used in the following examples is described in: Gu Z, et al. Chalconesynthase is ubiquitinated and degraded via interactions with a RING-H2 protein in petals of Paeonia 'He Xie'. J Exp Bot. 2019; 70(18):4749-4762. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0120] The pCambia 1300-YFPN plasmid used in the following examples is described in: Gu Z, et al. Chalconesynthase is ubiquitinated and degraded via interactions with a RING-H2 protein in petals of Paeonia 'He Xie'. J Exp Bot. 2019; 70(18):4749-4762. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0121] The 336 sea island cotton cultivars in the following examples are described in: Zhao N, et al. Genomic and GWAS analyses demonstrate phylogenomic relationships of Gossypium barbadense in China and selection for fiber length, lint percentage and Fusarium wilt resistance. Plant Biotechnol J. 2022; 20(4):691-710. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0122] The susceptible (S)II15-3464 and resistant (R)T10-280 varieties of sea island cotton described in the following examples are described in: Zhao N, et al. Genomic and GWAS analyses demonstrate phylogenomic relationships of Gossypium barbadense in China and selection for fiber length, lint percentage and Fusarium wilt resistance. Plant Biotechnol J. 2022; 20(4):691-710. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention; it may not be used for any other purpose.

[0123] The 7th physiological race of *Gossypium barbadense* in the following examples is described in: Zhao N, et al. Genomic and GWAS analyses demonstrate phylogenomic relationships of *Gossypium barbadense* in China and selection for fiber length, lint percentage and *Fusarium wilt resistance*. *Plant Biotechnol J*. 2022; 20(4):691-710. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0124] The *Nicotiana benthamiana* used in the following examples was a gift from the laboratory of Sun Chuanqing at China Agricultural University, and is described in: Zhang W, et al. Natural variations at TIG1 encoding a TCPtranscription factor contribute to plant architecture domestication in Rice. Mol Plant. 2019; 12(8):1075-1089. The public can obtain this biological material from the applicant. This biological material is only used to repeat the experiments of this invention and cannot be used for other purposes.

[0125] The following examples use IBM SPSS_Statistics_25 statistical software to process the data. The experimental results are expressed as mean values. T-tests are used, and P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0126] Example 1: Genome-wide association analysis to discover Fusarium wilt resistance genes in sea island cotton.

[0127] Using 336 Sea Island cotton accessions whose genomes were sequenced jointly by the Joint Laboratory of International Cooperation in Crop Molecular Breeding of the Ministry of Education and the Institute of Economic Crops of Xinjiang Academy of Agricultural Sciences as the mapping population, SNP variants were filtered based on a minimum allele frequency of less than 0.05 and a deletion rate of less than 20%. The filtered SNPs were then used for genome-wide association analysis (GWAS). Using the high-performance mixed genome-wide association model software GEMMA 0.94.1 (http: / / www.xzlab.org / software.html), association analysis was conducted using the incidence of Fusarium wilt in each material from the Korla disease nursery in Xinjiang in 2015, 2016, 2018, and 2019 as the phenotype. The correlations among the four years of data were extremely high, indicating reliable phenotypes. Figure 1 Trait association analysis was conducted using a mixed linear model, with population genetic structure treated as a fixed effect and individual kinship as a random effect, to correct for the influence of population structure and individual kinship.

[0128] y = Xα + Sβ + Kμ + e

[0129] y represents the phenotypic trait, X is the indicator matrix for fixed effects, α is the estimated parameter for fixed effects; S is the indicator matrix for SNPs, β is the effect of SNPs; K is the indicator matrix for random effects, μ is the predicted random individual, and e is the random residual, following e-(0, δe²). Furthermore, the S matrix was constructed using the first three PCs for population structure correction, and the K matrix was constructed using the simple matching coefficient matrix. The GEMMA software parameters were set to "gemma-bfile file-kkinship-lmm 1-o outfile-miss 0.2-maf0.05-c covariates(GCTA:PCA)". Manhattan plots were generated using the R package qqman. The effect values ​​of gene markers were detected using the F-test, and Bonferroni correction was used to correct multiple tests. SNPs significantly associated with wilt resistance were screened based on the association significance (P-value). A threshold (-log) was detected on chromosome D03 in all environments. 10 The highly significant SNP site Gbar_D03_1159232, with a p-value greater than 6, reached a threshold of 8.52 in the Korla environment in 2019. This SNP site is located 1.9 kb upstream of the gene Gbar_D03G001670 (named GbPP2C80). GbPP2C80 contains a T-to-C nonsynonymous mutation site Gbar_D03_1162571, which changes the amino acid from leucine to serine. Figure 2 a and b and Figure 3 The GbPP2C80 gene originates from the wilt-resistant sea island cotton variety T10-280. The coding sequence (CDS) of the GbPP2C80 gene is SEQ ID No. 1, and the genome sequence is SEQ ID No. 2. The encoded protein is named GbPP2C80 protein or protein GbPP2C80, and its amino acid sequence is shown in SEQ ID No. 3. Notably, the wilt incidence rate in sea island cotton varieties with genotype C at position 209 of the GbPP2C80 gene coding sequence is significantly lower than that in varieties with genotype T at position 209. Figure 4 The incidence of Fusarium wilt in sea island cotton varieties with serine at position 70 of the GbPP2C80 protein sequence was significantly lower than that in varieties with leucine at position 70. This suggests that GbPP2C80 is a major gene regulating Fusarium wilt resistance in sea island cotton.

[0130] Example 2: VIGS verification of the effect of GbPP2C80 on resistance to Fusarium wilt in sea island cotton.

[0131] 1. Differential expression analysis of GbPP2C80 and identification of VIGS transformation receptor

[0132] In pots containing a 1:1 mixture of potting soil and vermiculite, two varieties of island cotton, one susceptible to Fusarium wilt (S)II15-3464 and the other highly resistant (R)T10-280, were planted. After the cotyledons had fully expanded, approximately two weeks later, the plants were inoculated with Fusarium wilt pathogen race 7 using the root-damage method, achieving a bacterial concentration of 1×10⁻⁶. 7 pcs / cm 2 Twenty-five days after inoculation, leaves of sea island cotton were collected, RNA was extracted, and cDNA was synthesized by reverse transcription using reverse transcriptase. Using this cDNA as a template, specific primers were designed (forward primer 5'-TCAGTTGACCCGGCCAGAGTAT-3'; reverse primer 5'-TGTTGCTGCACTGGGGAATGAA-3'). Real-time PCR was used to detect the expression differences of GbPP2C80 in resistant and susceptible sea island cotton materials.

[0133] The results showed that the expression level of GbPP2C80 in susceptible sea island cotton materials was significantly higher than that in resistant sea island cotton materials. Figure 5 Therefore, VIGS transformation is performed on infected materials.

[0134] 2. Construction of VIGS vector and identification of resistance to Fusarium wilt

[0135] Based on the coding sequence of the candidate gene GbPP2C80, primers were designed for the construction of the VIGS vector. A Spe I restriction site (ACTAGT) and a protective base GG were added to the 5' end of the forward primer. The specific nucleotide sequence of the forward primer is: 5'-GGACTAGTTGTCATTTGATGGCAGTTCT-3'. A Pac I restriction site (TTAATTAA) and a protective base CC were added to the 5' end of the reverse primer. The specific nucleotide sequence of the reverse primer is: 5'-CCTTAATTAATCACCATTGTTACCGCTCT-3'.

[0136] The structure of the recombinant plasmid pCLCrVA-GbPP2C80 is described as follows: It is a recombinant vector obtained by replacing the fragment between the Spe I and PacI recognition sites of the pCLCrVA vector sequence with the DNA molecule shown in SEQ ID No. 4, while keeping the other nucleotides of the pCLCrVA vector unchanged.

[0137] After the recombinant vector pCLCrVA-GbPP2C80 was constructed, it was heat-shocked and transformed into Agrobacterium GV3101 strain (Sangon Biotech Co., Ltd., B528430), resulting in Agrobacterium tumefaciens bacterial suspension containing the pCLCrVA-GbPP2C80 plasmid and Agrobacterium GV3101 containing the pCLCrVA-GbPP2C80 plasmid, named Agrobacterium tumefaciens GV3101 / pCLCrVA-GbPP2C80. The empty vector pCLCrVA was heat-shocked and transformed into Agrobacterium GV3101 strain to obtain GV3101 / pCLCrVA as an empty vector control. The vector pCLCrVB was heat-shocked and transformed into Agrobacterium GV3101 strain to obtain GV3101 / pCLCrVB, which was mixed with an equal volume of Agrobacterium suspension containing GV3101 / pCLCrVA-GbOFP7 and GV3101 / pCLCrVA before transformation.

[0138] 3. Obtaining the transgenic island cotton plant S_pCLCrVA-GbPP2C80 with the GbPP2C80 gene silenced.

[0139] The susceptible sea island cotton material II15-3464 was grown in soil using the soil culture method as the transgenic recipient, and the resistant variety T10-280 was grown as the resistant control. Two weeks later, when the cotyledons were fully expanded, transformation was performed. Strains GV3101 / pCLCrVA-GbPP2C80, GV3101 / pCLCrVA, and GV3101 / pCLCrVB were cultured at 28℃ to the logarithmic growth phase; the cells were collected by centrifugation at 8000 rpm for 5 min, and then resuspended in VIGS infection solution (10 mM MES, 200 μM AS, 10 mM MgCl2), with the bacterial concentration adjusted to OD. 600 =Approximately 1.0; GV3101 / pCLCrVA-GbPP2C80 and GV3101 / pCLCrVA were mixed with GV3101 / pCLCrVB bacterial suspensions at a volume ratio of 1:1, and allowed to stand at room temperature for 3 hours before being used to transform cotton leaves. Mixed bacterial suspensions of GV3101 / pCLCrVA and GV3101 / pCLCrVB were used as empty vector controls. Using a 1 mL sterile syringe, the bacterial suspension was drawn up and injected into the underside of the cotyledons. The injected cotton plants were placed in a 28℃ greenhouse and cultured under a 16h / 8h light / dark cycle.

[0140] Two weeks later, Fusarium oxysporum f.sp. Vasinfectum race 7 was inoculated using the root injury method. Twenty-five days after inoculation, the disease phenotype was observed, and samples were taken for Real-time PCR to detect the silencing efficiency of candidate genes (forward primer 5'-TCAGTTGACCCGGCCAGAGTAT-3'; reverse primer 5'-TGTTGCTGCACTGGGGAATGAA-3').

[0141] The results showed that VIGS treatment significantly inhibited the transcription of GbPP2C80. Figure 5 The incidence of Fusarium wilt was significantly reduced in the GbPP2C80-silenced susceptible sea island cotton plants S_pCLCrVA-GbPP2C80. Figure 6 and Figure 7 In the results of a and b), the resistance to Fusarium wilt was significantly enhanced. This indicates that GbPP2C80 is a major gene regulating the resistance to Fusarium wilt in sea island cotton, and GbPP2C80 negatively regulates the resistance to Fusarium wilt in sea island cotton.

[0142] Example 3: Subcellular localization of GbPP2C80

[0143] Based on the gene ID of GbPP2C80, the CDS sequence was obtained, and primers were designed. A Kpn I restriction site (GGTACC) was added to the 5' end of the forward primer, and the nucleotide sequence of the forward primer was: 5'-GGTACCATGGCTGTGTCTGGTTCCA-3'; an Xba I restriction site (TCTAGA) was added to the 5' end of the reverse primer, and the nucleotide sequence of the reverse primer was: 5'-TCTAGACACATCGGCGGAGCTAGT-3'. Using leaf cDNA from the sea island cotton variety II15-3464 as a template, the target sequence was amplified, and positions 1 to 1125 of the coding sequence of the GbPP2C80 gene (SEQ ID No. 1) were obtained (i.e., excluding the final stop codon TGA).

[0144] The purified coding sequence of the GbPP2C80 gene and the p35S::GFP plasmid were double-digested with enzymes, and the digestion products were then ligated to construct the p35S::GbPP2C80-GFP recombinant plasmid. This plasmid was then transformed into Agrobacterium GV3101 to obtain recombinant Agrobacterium GV3101 / GbPP2C80-GFP.

[0145] The structure of the recombinant plasmid p35S::GbPP2C80-GFP is described as follows: A small fragment between the restriction endonuclease Kpn I and Xba I recognition sequences of plasmid p35S::GFP is replaced with the DNA molecule shown in SEQ ID No. 1 (excluding the final stop codon TGA). The recombinant plasmid p35S::GbPP2C80-GFP expresses the GbPP2C80 protein shown in SEQ ID No. 3. The recombinant plasmid p35S::GbPP2C80-GFP contains an expression cassette of the GbPP2C80-GFP fusion protein, in which the 35S promoter initiates transcription of the GbPP2C80 gene.

[0146] The p35S::GFP plasmid was directly transformed into Agrobacterium GV3101 using the same transformation method to obtain recombinant Agrobacterium GV3101 / GFP. Recombinant Agrobacterium GV3101 / GFP served as a control for subsequent experiments.

[0147] Recombinant Agrobacterium GV3101 / GbPP2C80-GFP positive bacterial suspension was added to YEP liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif, and the strain was activated in a shaker (28℃, 160 rpm). 1 mL of the activated bacterial suspension was added to 20 mL of YEP liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif, and cultured at 28℃, 160 rpm until OD was reached. 600 =1.0, centrifuge at 5000 rpm for 5 min to collect the bacterial culture, add suspension (containing 10 mM MES, 10 mM MgCl2, pH = 5.2, 100 μM AS) to resuspend the bacterial cells to OD. 600 =1.0, let stand at room temperature for 2-5 hours.

[0148] Selected healthy Nicotiana benthamiana plants and gently injected a suspension of recombinant Agrobacterium GV3101 / GbPP2C80-GFP containing GbPP2C80-GFP onto the underside of tobacco leaves using a syringe. A suspension of Agrobacterium GV3101 / GFP containing an empty GFP vector was used as a control and simultaneously injected into the lower epidermis of Nicotiana benthamiana leaves. After 24 hours of darkness, the plants were cultured under light for 48 hours. The subcellular localization of the GbPP2C80 protein was observed using a Zeiss LSM 880 inverted confocal fluorescence microscope with excitation light at 488 nm and emission light at 510 nm.

[0149] The results are as follows Figure 8 As shown in Figures a and b, the GFP signal of the GbPP2C80-GFP fusion protein is localized on the cell membrane, indicating that GbPP2C80 mainly functions on the cell membrane.

[0150] Example 4: Interacting proteins of GbPP2C80

[0151] The Joint Laboratory of International Cooperation in Crop Molecular Breeding of China Agricultural University and the Institute of Economic Crops of Xinjiang Academy of Agricultural Sciences previously identified a gene, GbWAKL14 (Gbar_D03G001910), which is significantly associated with resistance to Fusarium wilt in sea island cotton. VIGS analysis confirmed that GbWAKL14 negatively regulates Fusarium wilt resistance in sea island cotton. The coding sequence (CDS) of the GbWAKL14 gene is SEQ ID No. 5, the genome sequence of GbWAKL14 is SEQ ID No. 6, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 7.

[0152] To investigate whether GbPP2C80 interacts with GbWAKL14 to jointly regulate the wilt resistance of sea island cotton, specific primers were designed using cDNA from sea island cotton leaves as a template. The 5' ends of the forward and reverse primers carried the restriction enzyme sites Kpn I (GGTACC) and Spe I (ACTAGT), respectively. The specific primer nucleotide sequences are shown in Table 1.

[0153] Table 1 Primer information for bimolecular fluorescent complementary vectors of GbPP2C80 and GbWAKL14

[0154] GbPP2C80 GGTACCATGGCTGTGTCTGGTTCCA ACTAGTCACATCGGCGGAGCTAGT GbWAKL14 GGTACCATGATAAGGATAAAGCTATGCTTC ACTAGTTTCTCGTTGAGATGCATTATTAC

[0155] The full-length CDS sequences of GbPP2C80 and GbWAKL14, with the stop codons removed, were cloned and ligated into the pCambia 1300-YFPC and pCambia 1300-YFPN vectors, respectively, to obtain the recombinant plasmids GbPP2C80-YFPC and GbWAKL14-YFPN.

[0156] The structure of the recombinant plasmid GbPP2C80-YFPC is described as follows: The recombinant vector was obtained by replacing the fragment between the Kpn I and Spe I recognition sites of the pCambia 1300-YFPC vector sequence with the DNA molecule shown in SEQ ID No. 1 (removing the stop codon TGA), while keeping the other nucleotides of the pCambia 1300-YFPC vector unchanged.

[0157] The structure of the recombinant plasmid GbWAKL14-YFPN is described as follows: It is a recombinant vector obtained by replacing the fragment between the KpnI and Spe I recognition sites of the pCambia 1300-YFPN vector sequence with the DNA molecule shown in SEQ ID No. 5 (removing the stop codon TGA), while keeping the other nucleotides of the pCambia 1300-YFPN vector unchanged.

[0158] The recombinant plasmids GbPP2C80-YFPC and GbWAKL14-YFPN were transformed into Agrobacterium GV3101 by heat shock method to obtain recombinant Agrobacterium GV3101 / GbPP2C80-YFPC and GV3101 / GbWAKL14-YFPN.

[0159] The empty vectors YFPC and YFPN plasmids were directly transformed into Agrobacterium GV3101 using the same transformation method to obtain recombinant Agrobacterium GV3101 / YFPC and recombinant Agrobacterium GV3101 / YFPN, which served as experimental controls.

[0160] The positive bacterial suspensions of the recombinant Agrobacterium GV3101 / GbPP2C80-YFPC and GV3101 / GbWAKL14-YFPN were added to YEP liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif. The strains were activated in a shaker (28℃, 160 rpm). 1 mL of the activated bacterial suspension was added to 20 mL of YEP liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif. The culture was expanded to OD at 28℃, 160 rpm. 600 =1.0, centrifuge at 5000 rpm for 5 min to collect the bacterial culture, add suspension (containing 10 mM MES, 10 mM MgCl2, pH = 5.2, 100 μM AS) to resuspend the bacterial cells to OD. 600 =1.0, let stand at room temperature for 2-5 hours.

[0161] An equal volume of Agrobacterium suspension containing GbPP2C80-YFPC and GbWAKL14-YFPN was mixed. On well-grown Nicotiana benthamiana leaves, the suspension was gently injected into the underside of the leaves using a syringe. An equal volume of Agrobacterium GV3101 / YFPC and Agrobacterium GV3101 / YFPN suspensions was injected into the underside of the leaves as a control. After 24 hours of darkness, the leaves were cultured under light for 48 hours. The interaction between GbPP2C80 and GbWAK14 proteins was observed using a Zeiss LSM 880 inverted confocal fluorescence microscope, with excitation light at 514 nm and emission light at 527 nm.

[0162] The results are as follows Figure 9 As shown in Figures a and b, the YFP signal of transgenic plants containing the GbPP2C80-YFPC and GbWAKL14-YFPN fusion proteins is localized on the cell membrane, indicating that GbPP2C80 and GbWAKL14 interact on the cell membrane.

[0163] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The use of the protein shown in SEQ ID No. 3 in any of the following: Application of U1 in enhancing resistance to cotton wilt; Application of U2 in the preparation of products that enhance resistance to cotton wilt; Application of U3 in the breeding of cotton varieties resistant to Fusarium wilt; U4) Application in the preparation of products for breeding cotton varieties resistant to Fusarium wilt; The application is to inhibit, reduce, or silence the activity or content of the gene encoding the protein.

2. A method for regulating plant resistance to Fusarium wilt, characterized in that: This includes reducing the content of the protein described in claim 1 in the recipient plant, and / or reducing the expression level of the gene encoding the protein described in claim 1 in the recipient plant, to improve plant resistance to wilt disease; the plant is cotton.

3. The method according to claim 2, characterized in that: The method includes introducing a nucleic acid molecule into a recipient plant that inhibits, reduces, or silences the expression of the gene encoding the protein, thereby obtaining a plant with higher resistance to Fusarium wilt than the recipient plant; the gene encoding the protein encodes the protein as described in claim 1.

4. Methods for cultivating plants with altered resistance to Fusarium wilt include: By inhibiting or reducing the expression level of the gene encoding the protein described in claim 1 in the recipient plant, and / or inhibiting or reducing the content of the gene encoding the protein described in claim 1 in the recipient plant, a plant with enhanced resistance to wilt disease is obtained; the plant is cotton.

Images