Use of nicotinamide in the manufacture of a medicament for combating a virus that causes diarrhea in an animal

Abstract

The application provides application of nicotinamide in preparation of a medicine for resisting viruses causing animal diarrhea, and belongs to the technical field of biological medicines. Nicotinamide can significantly inhibit the propagation of porcine epidemic diarrhea virus and porcine deltacoronavirus, and mainly inhibits the virus replication stage. Meanwhile, nicotinamide inhibits the replication of the virus by activating the ERK1 / 2 / MAPK pathway to down-regulate the expression level of transcription factors. It can be seen that the application provides the application of nicotinamide in preparation of the medicine for resisting the viruses causing animal diarrhea, and provides a reference for development of an antiviral medicine target, and research and development of a new medicine and vaccine for preventing and treating porcine epidemic diarrhea virus and porcine deltacoronavirus.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology, specifically relating to the application of nicotinamide in the preparation of drugs against viruses that cause diarrhea in animals. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) is an enveloped single-stranded RNA virus that causes diarrhea in newborn piglets. To date, there are no commercially available vaccines for PDCoV. Researchers have found no virus-neutralizing cross-reaction between PEDV and PDCoV. Therefore, developing drugs that are effective against both PEDV and PDCoV is challenging.

[0003] Nicotinamide (NAM) is an amide form of vitamin B3 and has been proven to be a nutrient for mammals. It is a component of coenzymes I and II. NAM is also a component of coenzyme NAD. + precursor, NAD + It is the synthesis of nicotinamide adenine dinucleotide phosphate (NADP) + NAM is essential for energy metabolism and utilizes NAD+ in the mitochondrial respiratory electron transport chain via the tricarboxylic acid cycle. + It produces ATP. In human cells, NMN is mainly produced by NAM and PRPP via NAD. + The synthesis of nicotinamide phosphoribosyltransferase (Nampt) in the salvage pathway. However, NAD... + Its role in the virus is still unclear. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide the application of nicotinamide in the preparation of drugs against viruses that cause diarrhea in animals. Nicotinamide inhibits viral replication by blocking viral RNA synthesis, providing a reference for the development of new drugs and vaccines for the prevention and / or treatment of viruses that cause diarrhea in animals.

[0005] This invention provides the use of nicotinamide in the preparation of drugs against viruses that cause diarrhea in animals.

[0006] Preferably, the viruses that cause diarrhea in animals include epidemic diarrhea viruses and coronaviruses.

[0007] Preferably, the epidemic diarrhea virus includes porcine epidemic diarrhea virus.

[0008] Preferably, the coronavirus includes porcine deltacoronavirus.

[0009] Preferably, the nicotinamide inhibits the replication life cycle of viruses that cause diarrhea in animals.

[0010] Preferably, the structure of the nicotinamide is shown in Formula I:

[0011]

[0012] Preferably, the effective concentration of the nicotinamide is not less than 0.5 mM.

[0013] Preferably, the nicotinamide affects the activity of the transcription factor C / EBPa by regulating the ERK1 / 2 pathway, thereby inhibiting viral replication.

[0014] The present invention provides use of nicotinamide in preparation of a medicament against viruses causing animal diarrhea. The examples of the present invention prove that the nicotinamide has effects against porcine epidemic diarrhea virus and porcine deltacoronavirus, and specifically inhibits viral replication by blocking viral RNA synthesis. Through further research on the molecular mechanism of antiviral activity, it is found that the nicotinamide inhibits replication of PEDV and PDCoV by down-regulating the expression level of transcription factors through activating the ERK1 / 2 / MAPK pathway. The present invention shows for the first time that nicotinamide is not only an important antiviral factor against porcine enteric coronaviruses, but also a potential candidate for evaluation against other human and animal coronaviruses, has broad-spectrum antiviral activity, and provides a reference for the research and development of new drugs and vaccines for preventing and treating PEDV and PDCoV. Description of Drawings

[0015] Figure 1 Results for evaluating cytotoxicity of NAM, wherein A is the cytotoxicity result of NAM on Vero, PK and ST cells; B is the NAM IC 50 50 value measurement results, wherein differences are considered significant when (*) 0.01 < p < 0.05 and (**) p < 0.01;

[0016] Figure 2 Results showing the antiviral activity of NAM against PEDV infection in Vero cells, wherein A is the evaluation on the inhibitory effect of NAM on viral replication in Vero cells after 24 h of NAM treatment by the TCID50 method; B and C are the effect measurement results obtained by western blotting, qRT-PCR and IFA after adding different concentrations of NAM and incubating for 24 h; D is the result of inhibiting viral replication in Vero cells treated with NAM at different infection doses and time; E is the viral growth curve detected by qRT-PCR with or without NAM treatment;

[0017] Figure 3The results show the antiviral activity of NAM against PDCoV infection in LLC-PK1 and ST cells. In this study, A represents the effect of different concentrations of NAM on PDCoV replication in LLC-PK2 and ST cells incubated for 24 hours, detected by Western blotting and qRT-PCR; B represents the effect of Western blotting on NAM treatment at different infection times and doses on PDCoV replication in LLC-PK1 and ST cells.

[0018] Figure 4 To use qRT-PCR and TCID 50 The method measures the antiviral effect of NAM on the viral replication life cycle, where A represents PEDV-infected Vero cells with MOI=1; and B represents PDCoV-infected PK cells with MOI=1.

[0019] Figure 5 To assess the therapeutic effect of NAM by qRT-PCR, note: PEDV infected Vero cells at MOI=1, while PDCoV infected LLC-PK1 cells at MOI=1;

[0020] Figure 6 The effects of NAM on the ERK1 / 2 / MAPK pathway are shown in Figure A, where Western blotting results show the activation of PEDV and PDCoV replication by ERK1 / 2 and CREB incubated with NAM; and qRT-PCR results show the expression levels of C / EBPa. Detailed Implementation

[0021] This invention provides the use of nicotinamide in the preparation of drugs against viruses that cause diarrhea in animals.

[0022] In this invention, the structure of the nicotinamide is preferably as shown in Formula I:

[0023]

[0024] In this embodiment of the invention, the nicotinamide was purchased from Macklin Pharmaceuticals. Experiments showed that the nicotinamide exhibited good safety in mammalian cells. In this embodiment of the invention, the nicotinamide at concentrations of 0.1–0.5 mM in Vero cells and 0.01–0.25 mM in LLC-PK1 and ST cells did not show significant cytotoxicity, demonstrating good cellular safety.

[0025] In this invention, the virus causing diarrhea in animals preferably includes porcine epidemic diarrhea virus (PEDV) and coronavirus. The PEDV preferably includes porcine epidemic diarrhea virus (PEDV). The coronavirus preferably includes porcine deltacoronavirus (PDCoV). Because there is no direct correlation between porcine epidemic diarrhea virus and porcine deltacoronavirus...

[0026] Since there is no cross-reactivity with the virus, to develop two antiviral drugs, it is generally necessary to develop their respective corresponding vaccines to prevent viral infection. However, the nicotinamide provided by this invention has the effect of simultaneously inhibiting the replication of porcine epidemic diarrhea virus and porcine deltacoronavirus, achieving a broad-spectrum antiviral effect and having high market promotion value.

[0027] In this invention, experiments have shown that nicotinamide possesses antiviral activity, effectively inhibiting the production of viruses that cause diarrhea in animals, regardless of cell type, infection dose, or time. Further confirmation of the specific lifecycle effect of nicotinamide on the viral infection process was achieved by treating the virus with NAM at different stages: attachment, internalization, replication, and release. Results showed that the nicotinamide-treated group did not exhibit significant differences compared to the untreated group during viral attachment, internalization, and release, but showed a significant inhibitory effect only on the viral replication stage. Furthermore, the nicotinamide treatment significantly inhibited RNA synthesis. Therefore, nicotinamide preferably inhibits PEDV and PDCoV infection during the viral replication stage.

[0028] In this invention, the effective concentration of nicotinamide is preferably not less than 0.5 mM. In an embodiment of this invention, PEDV infected Vero cells at MOI=1, while PDCoV infected LLC-PK1 cells at MOI=1. The results showed that a nicotinamide concentration of 0.5 mM effectively inhibited viral load compared to the control group.

[0029] In this invention, to further clarify the molecular mechanism of action of nicotinamide, the effects of nicotinamide treatment on the expression levels of transcription factors downstream of ERK1 / 2 were examined. The results showed that NAM treatment inhibited the activation of ERK1 / 2 and CREB, and also inhibited the transcription of C / EBPa. Preferably, nicotinamide inhibits viral replication by regulating the activity of transcription factor C / EBPa through the ERK1 / 2 pathway.

[0030] The following examples illustrate the application of nicotinamide provided by the present invention in the preparation of drugs against viruses that cause diarrhea in animals. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0031] 1. Description of cell line, virus, and drug sources:

[0032] Porcine kidney (LLC-PK1) cells, porcine testis (ST) cells, and African green monkey kidney (Vero) cells were purchased from ATCC. LLC-PK1 and ST cells were cultured in MEM, and Vero cells were cultured in DMEM. Both media were supplemented with 10% fetal bovine serum, and cells were cultured at 37°C and 5% CO2. PEDV CH / HBXT / 2018 (GenBank ID: MH816969) and PDCoV CH / XJYN / 2016 (GenBank ID: MN064712) were isolated and maintained in our laboratory. NAM was purchased from MACKLIN, dissolved in PBS, and stored at -80°C.

[0033] 2. Data Statistical Analysis

[0034] Results are expressed as mean ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using the Student's t test. Differences were considered significant at p < 0.05. The statistical significance is shown in the figure below:

[0035] *0.01 <p<0.05,**p<0.01。

[0036] Example 1

[0037] Assay for cell viability (cytotoxicity)

[0038] 1. Cell viability was measured using LLC-PK1, ST, and Vero cells in 96-well plates, using the following specific methods:

[0039] Cells were seeded at a rate of 5000 cells per well in 96-well plates. To assess the effect of NAM on cell viability, different concentrations of NAM (0, 5, 10, 50, 100, 200, 300, 400, 500, 1000 μM, 1500 μM, 2000 μM, and 2500 μM) were added to eight wells containing a monolayer of cells. Cells treated with culture medium served as a negative control. After 48 h, cells were washed twice with PBS, and then 100 μl of MTT (5 mg / mL) was added to each well and incubated for 4 h. The reaction was stopped by adding 150 μl of DMSO, and the results were measured by OD... 590nm The absorbance was measured using a plate reader. The 50% inhibition concentration (IC50) was calculated using Kaber software. 50 )value.

[0040] Minimal cytotoxicity results of NAM

[0041] In the three independent experiments described above, the cytotoxicity of NAM at concentrations ranging from 0.1 to 2.5 mM or 0.01 to 1 mM was assessed using the MTT assay. The results showed that NAM at concentrations of 0.1–0.5 mM in Vero cells, or at concentrations of 0.01–0.25 mM in LLC-PK1 and ST cells, did not exhibit significant cytotoxicity. Figure 1 (A)

[0042] Based on cytotoxicity and antiviral activity assays, 0.5 mM NAM was selected for the following experiments in Vero cells. The IC50 of NAM in Vero cells was... 50 The value is approximately 2.21 mM ( Figure 1 (B) A 0.25 mM NAM concentration was selected for the following experiments in LLC-PK1 and ST cells. The IC50 values ​​of NAM in LLC-PK1 and ST cells... 50 The values ​​were 0.95 and 0.89 mM, respectively.

[0043] Example 2

[0044] 1. NAM possesses antiviral activity against PEDV infection.

[0045] Vero cells grown to the logarithmic growth phase were washed three times with PBS, incubated for 2 hours in fresh serum-free medium containing 0.5 mM NAM, and then the viral stock solution was added directly to assess its impact on PEDV replication. TCID45 was used. 50 Methods: The effect of NAM treatment for 24 h on PEDV-infected Vero cells was evaluated.

[0046] TCID 50 The results showed that NAM inhibited the production of PEDV. Figure 2 (A)

[0047] 2. Vero cells were treated with different concentrations of NAM (0.1 mM to 0.5 mM), with a blank control group included. The effects of NAM treatment were evaluated using Western blotting, qRT-PCR, and IFA, respectively.

[0048] (1) Real-time quantitative PCR (RT-qPCR) method to detect the expression of N gene in PEDV N and PDCoV

[0049] Vero, PK, and ST cells infected with the virus were collected separately. RNA was extracted using TRIzol reagent (TaKaRa, China) via the phenol-chloroform method. The PEDV N gene and PDCoV N gene were detected by RT-qPCR. The specific methods are as follows:

[0050] Internal reference primer:

[0051] Qpβ-actin-F: CGGGACATCAAGGAGAAGC (SEQ ID NO: 1);

[0052] Qpβ-actin-R: ACAGCACCGTGTTGGCGTAGAG (SEQ ID NO: 2);

[0053] N gene: QpPDN-F: ACGTCGTAAGACCCAGCATC (SEQ ID NO:3);

[0054] QpPDN-R:CCCACCTGAAAGTTGCTCTC (SEQ ID NO:4);

[0055] QpPEN-F:ACTACCTCGGAACAGGACCTCA (SEQ ID NO:5);

[0056] QpPEN-R: AGACGCCTTTCTGACACCCA (SEQ ID NO: 6).

[0057] The qRT-PCR reaction system is shown in Table 1.

[0058] Table 1 qRT-PCR reaction system

[0059]

[0060] Reaction conditions:

[0061] Reverse transcription reaction: 42℃, 5 min; PCR reaction: 95℃, 10 s, 95℃, 5 s, 60℃, 30 s, 40 cycles; Amplification curve and melting curve: 65℃, 5 s, 95℃, 0.5℃.

[0062] (2) Protein blot analysis

[0063] Protein lysates were obtained from cells using ice-cold RIPA lysis buffer. Protein samples were subjected to SDS-PAGE and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 1 h at room temperature, then incubated at 37°C or 4°C for 2 h or overnight with primary antibodies (anti-PEDV N MAb 1:5000; anti-PDCoV N MAa 1:5000; anti-β-actin MAb 1:3000; anti-β-tubulin MAb 1:300; anti-ERK1 / 2 MAb 1:1000; anti-pERK1 / 2 MAb 1:2000). Afterward, the membranes were washed four times for 10 min each time, with the addition of HRP-bound secondary antibodies (goat anti-mouse IgG HRP 1:5000; goat anti-rabbit IgG HRP 1:500), and incubated at room temperature for 1 h. Protein bands were detected by ECL.

[0064] (3) Indirect immunofluorescence analysis (IFA)

[0065] Cells were seeded into 12-well plates and incubated for 12 h. Before virus inoculation, cells were exposed to different concentrations of NAM (0, 0.25, and 0.5 mM) for 1 h. Next, 0.5–1 ml of virus culture (MOI = 0.1–1) was seeded into cells and incubated for 1 h. Cells were then infected with the virus and exposed to the corresponding concentration of NAM for 24 h. Cells were then fixed with 4% paraformaldehyde. Cells were then infiltrated with 0.1% Triton X-100 and blocked with 3% bovine serum albumin (BSA). Cells were incubated with mouse anti-PEDVNMAb (1:2000) primary antibody at room temperature for 2 h. After washing three times with PBS, FITC-conjugated goat anti-mouse (1:2500) was added, and cells were incubated at room temperature for 1 h. After washing three more times with PBS, cells were stained with DAPI (1:2000) for 10 min, washed three times with PBS at room temperature, and then observed under a confocal microscope.

[0066] The results showed that NAM treatment inhibited PEDV replication in a dose-dependent manner. Figure 2 (B and C in the middle).

[0067] This embodiment also investigated the antiviral activity of NAM against PEDV infection in Vero cells, including the effects of different infection times and MOIs on PEDV replication. The experiment was divided into four groups: a NAM treatment group (Vero cells infected with PEDV were treated with 0.5 mM NAM along with 0.1 MOI and 1 MOI of virus), a blank control group (Vero cells were treated with virus only without NAM), and a control group (Vero cells were infected with 0.1 MOI and 1 MOI of PEDV at 24 h, 36 h, and 48 h). The differences in Vero cell cytopathic effects caused by different infection times and MOIs were observed under a microscope. Results are shown in (…). Figure 2 (D). Cells were collected at 12h, 24h, 36h, 48h, and 60h after PEDV infection with Vero, and RNA was extracted. Viral copy number was detected by qRT-PCR. Growth curves showed that NAM treatment significantly reduced PEDV production, but this was not affected by infection time or dosage. Figure 2 (E).

[0068] Example 3

[0069] Experiments on the antiviral activity of NAM against PDCoV infection in LLC-PK1 and ST cells

[0070] PDCoV was used to infect LLC-PK1 and ST cells, and different concentrations of NAM (0, 0.05, 0.1, and 0.25 mM) were added to the culture medium to co-treat the LLC-PK1 and ST cells with the virus. The treatment effect was evaluated using the Western blotting and qRT-PCR methods described in Example 2. Figure 3 (A). NAM dose-dependent inhibition of PDCoV replication was also found in the PDCoV group. The results indicate that NAM inhibits PDCoV production in a dose-dependent manner, independent of cell type, infection dose, and time. Figure 3 (B)

[0071] Example 4

[0072] NAM inhibits the viral replication lifecycle

[0073] To investigate the inhibitory effect of NAM on PEDV or PDCoV infection, we compared the effects of NAM on different stages of the viral replication life cycle (MOI=1).

[0074] Place the cells at 35cm 2 The following three experiments were conducted in a petri dish:

[0075] (1) Adhesion: Cells were pretreated with NAM and without NAM for 2 hours, then cultured at 4°C for 2 hours, and then replaced with fresh culture medium containing the virus for another 24 hours. Cells were collected and stored at -70°C for real-time RT-PCR or TCID. 50 The method determines the number of virus copies.

[0076] (2) Internalization: at 35cm 2 Cells cultured in culture dishes were pre-cooled to 4°C for 0.5 h, then infected with the virus and incubated at 4°C for 1 h. The supernatant was discarded, and the cells were washed three times. Fresh medium with and without NAM was added, and the temperature was increased to 37°C and held for 2 h to allow viral entry. The cells were washed three times and held at 37°C for 24 h. The cells were then collected and analyzed using TCID45. 50 Viral titers were determined using the method of qRT-PCR.

[0077] (3) Replication: Cells were infected with the virus. Two hours after infection, the cell supernatant was removed, and the cells were cultured in fresh medium with or without NAM. After 24 hours, infected cells were collected for RT-PCR or TCID. 50 analyze.

[0078] (4) For release, cells were infected with the virus for 10 hours, the cell supernatant was removed, and the cells were cultured for 6 hours in fresh medium with or without NAM. The cell supernatant was collected and treated with TCID45. 50 Method titration.

[0079] To further investigate which steps of the viral life cycle NAM treatment affects, NAM was added to cells at different stages of viral infection, including attachment, internalization, replication, and release. The results are as follows: Figure 4 As shown, there were no significant differences between the NAM-treated group and the untreated group during viral attachment, internalization, and release. Furthermore, NAM treatment significantly inhibited RNA synthesis. NAM treatment had no effect on viral release. Both viruses showed consistent results. In summary, NAM primarily inhibits PEDV and PDCoV infection during the replication phase of the viral life cycle.

[0080] Example 5

[0081] NAM antiviral activity assay

[0082] The efficacy of NAM treatment at different stages of viral infection (MOI = 0.01) was compared in LLC-PK1 and Vero cells to investigate the inhibitory effect of PEDV or PDCoV infection at different stages. In short, cells were seeded in 6-well plates and the following three experiments were performed:

[0083] (1) The first group, referred to as the pretreatment group, exposed cells to NAM for 1 h before virus inoculation. Afterward, the cells were washed twice with PBS. Fresh maintenance medium was added to the plates and incubated for 24 h.

[0084] (2) The second group was the co-treatment group, in which cells were infected with the virus for 1 hour and exposed to NAM or not exposed to NAM. After washing twice, maintenance medium with the corresponding concentration of NAM was added and incubated for 24 hours.

[0085] (3) The last group was designated as the post-treatment group. First, cells were infected with the virus at 37°C for 1 hour. Cells were washed twice and incubated with maintenance medium containing or without NAM. Cell culture supernatant was collected after 24 hours. All groups were analyzed in three independent experiments. As previously stated, the antiviral activity of NAM was demonstrated by RT-PCR and TCID. 50 Analysis confirmed.

[0086] To evaluate the therapeutic effect of NAM on PEDV infection, NAM was added to the culture medium before (pretreatment), during (co-treatment), and after (post-treatment). Figure 5 NAM pretreatment had no effect on PEDV infection. Treatment with 0.5 mM NAM had antiviral effects on viral replication in both the pre-treatment and post-treatment groups, with TCID... 50 They decreased by approximately 0.35 and 0.7 log10, respectively.

[0087] The effect of NAM on PDCoV replication was also evaluated. A similar phenomenon was observed in NAM-treated PDCoV; NAM pretreatment had no effect on PDCoV titers. Treatment with 0.25 mM NAM had an antiviral effect on viral replication in both the pre-treatment and post-treatment groups, with a TCID of [missing value]. 50 Decrease by 0.7 and 0.9 log10 respectively.

[0088] Example 6

[0089] Inhibition of ERK1 / 2 / MAPK activity by NAM

[0090] Previous studies have shown that NAM inhibits the expression of C / EBPa, PPARα, and AP-1 in HepAD38 and HepG2.2.15 cells. AP-1, C / EBPa, and PPARα are all downstream transcription factors of ERK1 / 2. NAM may participate in the regulation of transcription factors AP-1, C / EBPa, and PPARα by affecting ERK1 / 2 activity. To verify this hypothesis, this study used Western blot to assess the effect of NAM on pERK1 / 2 activity in Vero and LLC-PK1 cells.

[0091] Analysis showed that NAM treatment did indeed inhibit the activation of ERK1 / 2 and CREB. Figure 6 (A). Furthermore, qRT-PCR results showed that NAM treatment inhibited transcription in C / EBPa ( Figure 6 (B). These data suggest that NAM may regulate the replication of PEDV and PDCoV by affecting the activity of transcription factor C / EBPa through the ERK1 / 2 pathway.

[0092] The results of the above examples show that NAM treatment inhibits the replication of PEDV and PDCoV in a dose-dependent manner, and this inhibition is independent of viral dose or infection time. Furthermore, the results indicate that NAM treatment has no significant effect on the nucleoprotein quantity of PEDV and PDCoV in the early stages of replication, but is significant during the RNA synthesis stage. RNA synthesis is a crucial part of viral replication. As a key component of the tricarboxylic acid cycle, NAM may participate in the regulation of viral replication by modulating cellular metabolism. We have determined that NAM can be used to treat PEDV and PDCoV infection, but has no effect on prevention. Although PEDV and PDCoV have similar clinical symptoms, they belong to different coronavirus genera and encode different nucleotide and amino acid sequences. NAM has inhibitory effects not only on alpha coronavirus PEDV and delta coronavirus PDCoV, but also on beta coronavirus SARS-CoV-2.

[0093] In summary, the experiments of this invention demonstrate that NAM treatment significantly inhibits the replication of PEDV and PDCoV, primarily during the replication phase of the viral life cycle. Furthermore, the antiviral effect on viral replication differs before and after treatment. ERK1 / 2 activity is significantly downregulated in NAM-treated cells. The data suggest that NAM treatment inhibits the replication of PEDV and PDCoV, possibly by activating the ERK1 / 2 / MAPK pathway and downregulating transcription factor expression levels. Overall, this invention is the first to demonstrate that NAM may not only be an important antiviral factor for porcine enteric coronaviruses but also a potential candidate factor for evaluation against other human and animal coronaviruses.

[0094] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of nicotinamide in the preparation of a drug for treating a virus that causes diarrhea in animals, wherein the virus causing diarrhea in animals is porcine epidemic diarrhea virus and a coronavirus, wherein the porcine epidemic diarrhea virus is porcine epidemic diarrhea virus and the coronavirus is porcine deltacoronavirus.

2. The application according to claim 1, characterized in that, The nicotinamide inhibits the replication life cycle of viruses that cause diarrhea in animals.

3. The application according to claim 1, characterized in that, The effective concentration of nicotinamide is not less than 0.5 mM.

4. The application according to claim 3, characterized in that, Nicotinamide inhibits viral replication by regulating the activity of transcription factor C / EBPa through the ERK1 / 2 pathway.

Images