Cyclic polypeptides targeting ddr1 and methods of making and using the same

Abstract

The present application relates to a kind of cyclic polypeptide targeted to DDR1 and its preparation method and application, wherein polypeptide is cyclic polypeptide, specifically N3, R3 Or E3 Etc..The present application also includes the method for preparing cyclic polypeptide, wherein phage screening technology is used to construct engineering bacteria, and cyclic polypeptide is synthesized by specific steps.In addition, the present application also relates to the method for preparing the cyclic polypeptide to be applied to the preparation of antitumor drugs.Specifically, the antitumor drug can be used to prepare the drug for treating cancer types such as lung cancer and breast cancer.

Description

Technical Field

[0001] This invention relates to the field of targeted therapies for tumors, and more particularly to a cyclic polypeptide targeting DDR1, its preparation method, and its application. Background Technology

[0002] In recent years, targeted therapy has become a research hotspot in cancer treatment. Within targeted therapy, the tyrosine kinase family is closely related to tumorigenesis. Protein kinases participate in regulating signaling networks crucial for cell growth, proliferation, and survival. Discoidin domain receptor 1 (DDR1) is an important member of the tyrosine kinase receptor (RTK) family. DDR1 expression is increased to varying degrees in various tumor tissues. Integrated diagnosis and treatment targeting DDR1 has broad application prospects and advantages.

[0003] DDR1 is a protein kinase associated with tumorigenesis and development. Its overactivation or aberrant expression is linked to the formation and invasion of various tumors. Therefore, researchers have been exploring the possibility of using DDR1 as a novel therapeutic target for tumors. Currently, diagnostic and therapeutic technologies targeting DDR1 (DNA-dependent protein kinase 1) are still in the research and development stage. Targeted therapies for DDR1 are mainly focused on drug development and clinical trials. Some small molecule inhibitors targeting DDR1 have undergone in vitro and animal experiments, yielding some encouraging results. However, there is currently a lack of drugs with high specificity and efficacy against DDR1.

[0004] In addition, in terms of clinical trials, some antibody drugs targeting DDR1 (such as KT17638, D17125, UC6254, erlotinib, etc.) are undergoing early-stage clinical trials to evaluate their efficacy and safety in certain tumor types.

[0005] Overall, although diagnostic and therapeutic technologies for DDR1 are still under development, this field continues to attract attention from researchers and pharmaceutical companies. It is believed that with further research and trials, DDR1-targeted therapy may become a new treatment approach, bringing more options and hope to cancer patients. However, current research on DDR1 inhibitors mainly focuses on two directions: small molecule inhibitors and antibody drugs. Small molecule inhibitors are one of the common drug design strategies, using methods such as molecular mimicry and drug screening to identify molecules with high selectivity and affinity. Conversely, antibody drugs are another treatment strategy targeting DDR1. Currently, some monoclonal antibody drugs against DDR1 are undergoing clinical trials. Antibody drugs generally have higher specificity and affinity, and can more accurately recognize and bind to DDR1, thereby effectively inhibiting its activity; however, there are currently no reports on research on peptide drugs targeting DDR1. Nevertheless, due to the rapid development and continuous innovation of scientific research, new treatment strategies, including peptide inhibitors, may emerge in the future for the treatment of DDR1. Summary of the Invention

[0006] This invention provides a cyclic polypeptide targeting DDR1, its preparation method, and its application, which fills the gap in the types of drugs targeting DDR1 and can be used as a potential anti-tumor drug for research and development.

[0007] The specific technical solution is as follows:

[0008] A polypeptide targeting DDR1, wherein the polypeptide is a cyclic polypeptide comprising N3, R3, or E3.

[0009] Furthermore, the amino acid sequence of the cyclic polypeptide N3 is SEQ ID No:1ACNSSKLHMCGGG (C2-C10 disulfide bond), and its molecular structure is:

[0010]

[0011] Furthermore, the amino acid sequence of the cyclic polypeptide R3 is SEQ ID No: 2ACREPTYNQCGGG (C2-C10 disulfide bond), and its molecular structure is:

[0012]

[0013] Furthermore, the amino acid sequence of the cyclic polypeptide E3 is SEQ ID No:3ACEQANYRICGGG (C2-C10 disulfide bond), and its molecular structure is as follows:

[0014]

[0015] A method for preparing DDR1-targeting cyclic peptides is characterized by the following steps: using a cyclic peptide phage display peptide library kit to select positive clones that can specifically bind to DDR1, extracting and sequencing their DNA, constructing a peptide library based on the sequencing results, and then obtaining the peptide amino acid sequence.

[0016] S1. Using a cyclized peptide phage display peptide library kit, positive clones that can specifically bind to DDR1 were selected, and DNA was extracted and sequenced. Based on the sequencing results, a peptide library was constructed, and the peptide amino acid sequence was obtained.

[0017] S2, synthesize cyclic polypeptides; add AC- and -CGGG structures to both ends of the polypeptide amino acids, and link them with disulfide bonds between C2 and C10 to form cyclic polypeptides.

[0018] A method for preparing cyclic polypeptides yields cyclic polypeptides that specifically bind to DDR1, and the prepared cyclic polypeptides are DDR1-targeting inhibitors for use in the preparation of antitumor drugs.

[0019] Furthermore, the aforementioned anti-tumor drugs are used to treat lung cancer and breast cancer.

[0020] Furthermore, the cyclic polypeptide N3, R3, or E3 can specifically bind to the HARA cell line for the treatment of non-small cell lung cancer (NSCLC).

[0021] Furthermore, the cyclic polypeptide N3, R3, or E3 can specifically bind to the MCF7 cell line for use in invasive ductal carcinoma of breast cancer.

[0022] Introduction to the working principle of this invention:

[0023] This invention synthesizes cyclic peptides N3, R3, and E3 using phage screening technology. These peptides exhibit targeting of DDR1, and DDR1 is highly expressed in NSCLC cells and invasive ductal carcinoma cells. Upregulation of DDR1 promotes the occurrence, development, and invasiveness of malignant tumors, as well as early homing and colonization of tumor cells or bone metastases. Interference with DDR1 expression inhibits tumor growth and metastasis. Targeted therapy with DDR1 can disrupt the collagen fiber arrangement of tumors and neutralize the immune escape function of DDR1, achieving precise tumor treatment without damaging normal organ function. This invention yields cyclic peptides targeting DDR1, and experimental results show that they can bind to lung cancer and breast cancer cell lines that highly express DDR1. Future research could link these peptides with anti-tumor drugs to exert therapeutic effects.

[0024] Compared with the prior art, the beneficial effects of the present invention are:

[0025] (1) A cyclic polypeptide targeting DDR1 was synthesized for the first time, which makes up for the current lack of DDR1 targeting peptides;

[0026] (2) Based on these target peptides, molecular probes and targeted drugs can be synthesized to target tumors that highly express DDR1. Attached Figure Description

[0027] Figure 1 Flowchart of screening technology for Ph.D.-C7C phage display peptide library kit (cyclized peptides);

[0028] Figure 2 Sequencing analysis of positive clones obtained after screening phage display peptide libraries (Ph.D.-C7C);

[0029] Figure 3 This is a molecular structure diagram of the cyclic polypeptide N3 of the present invention;

[0030] Figure 4 This is a molecular structure diagram of the cyclic polypeptide R3 of the present invention;

[0031] Figure 5 This is a molecular structure diagram of the cyclic polypeptide E3 of the present invention;

[0032] Figure 6 This is a high-performance liquid chromatography (HPLC) analysis report of the cyclic polypeptide N3 of the present invention;

[0033] Figure 7 This is a high-performance liquid chromatography (HPLC) analysis report of the cyclic polypeptide R3 of the present invention;

[0034] Figure 8 This is a high-performance liquid chromatography (HPLC) analysis report of the cyclic polypeptide E3 of the present invention;

[0035] Figure 9 Fluorescence image of FITC-N3 binding to HARA lung cancer cells;

[0036] Figure 10 Fluorescence image of FITC-N3 binding to MCF7 breast cancer cells;

[0037] Figure 11 The image shows the fluorescence of FITC-R3 binding to HARA lung cancer cells.

[0038] Figure 12 Fluorescence image of FITC-R3 binding to MCF7 breast cancer cells;

[0039] Figure 13 Fluorescence image of FITC-E3 binding to HARA lung cancer cells;

[0040] Figure 14This is a fluorescence image showing the binding of FITC-E3 to MCF7 breast cancer cells. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that these descriptions are merely exemplary and not intended to limit the scope of the invention. Furthermore, in the following descriptions, well-known structures and techniques have been omitted to avoid unnecessarily obscuring the concept of the invention.

[0042] Example 1: Specific steps for synthesizing cyclic polypeptides N3, R3, and E3

[0043] 1. Selection

[0044] The NEB random peptide library: Ph.D.-C7C phage display peptide library kit (cyclized peptides) was screened using DDR1 Protein, Human, Recombinant (His Tag) protein to obtain 1-5 positive clones.

[0045] 2. Phage ELISA identification

[0046] 2.1 Preparation of Phage Supernatant

[0047] 1) Dilute ER2738 cultured overnight at a ratio of 1:100 and dispense 1 mL into centrifuge tubes.

[0048] 2) Pick a single clone into a centrifuge tube.

[0049] Note: Plaques on the plates should not be kept for more than 3 days and should be stored at 4°C. Each plate should contain no more than 100 single clones to ensure that only single clones are picked.

[0050] 3) Incubate at 37℃ and 220rpm for 4.5-5 hours.

[0051] Note: The incubation time should not exceed 5 hours.

[0052] 4) Centrifuge at 14000 rpm for 30 seconds, and transfer the supernatant to a new centrifuge tube; centrifuge at 14000 rpm for 30 seconds, and transfer 80% of the supernatant to a new centrifuge tube, which is the Phage supernatant.

[0053] 2.2 Phage ELISA Detection

[0054] 1) Coating: Coat DDR1 protein, 0.1 μg / mL, at 4°C overnight.

[0055] 2) Sealing: 2% skim milk powder, 200μL / well, 37℃ for 1h.

[0056] 3) Primary antibody: Phage supernatant, 100 μL / well, 37℃ for 1 h.

[0057] 4) Secondary antibody: anti-M13 antibody (HRP), 1:20000, 100μL well, 37℃ for 1h.

[0058] 5) Color development: 100 μL of color development solution per well, 37℃, 15 min.

[0059] 6) Termination: 100 μL of termination solution per well.

[0060] 7) Reading board: Antibody titer.

[0061] 3. Single-stranded DNA extraction and sequencing

[0062] 3.1 Single-stranded DNA extraction and sequencing

[0063] 1) Dilute ER2738 cultured overnight at a ratio of 1:100 and dispense 1 mL into centrifuge tubes.

[0064] 2) Pick a single clone into a centrifuge tube.

[0065] Plaques on the plates should not be kept for more than 3 days and should be stored at 4°C. Each plate should contain no more than 100 single clones to ensure that only single clones are picked.

[0066] 3) Incubate at 37℃ and 220rpm for 4.5-5 hours.

[0067] Note: The incubation time should not exceed 5 hours.

[0068] 4) Centrifuge at 14000 rpm for 30 seconds, and transfer the supernatant to a new centrifuge tube; centrifuge at 14000 rpm for 30 seconds, and transfer 500 μL of supernatant to a new centrifuge tube.

[0069] 5) Add 200 μL of 20% PEG / 2.5M NaCl, mix by inverting the container, and let stand at room temperature for 20 min.

[0070] 6) Centrifuge at 4℃ and 14000rpm for 10 minutes, then discard the supernatant. (The phage precipitate may not be visible.)

[0071] 7) Instantly centrifuge, discarding all the pure essence.

[0072] 8) Add 100 μL of Iodide Buffer and resuspend and mix well. Add 250 μL of ethanol and incubate at room temperature for 20 min.

[0073] Note: Short-term room temperature incubation can effectively precipitate single-stranded phage DNA, allowing most of the phage proteins to remain in the solution.

[0074] 9) Centrifuge at 4℃ and 14000rpm for 10min, and discard the supernatant. Wash twice with 0.5mL of 70% ice-cold ethanol, centrifuge at 4℃ and 14000rpm for 10min, and discard the supernatant. Dry for 3-5min.

[0075] 10) Resuspend in 30 μL of TE and store at -20°C.

[0076] 11) Use a 96 sequencing primer to sequence and verify single-stranded DNA.

[0077] 3.2 Sequencing Results

[0078] A total of 11 positive clones were sequenced, and 4 sequences showed bimodal peaks (Ph.D.-C7C), with 3 successfully sequenced. Of the 3 successfully sequenced sequences, 3 contained peptides that met the screening criteria. The results are as follows: Figure 1 As shown.

[0079] Results and Discussion: After screening and ELISA detection in steps 1 and 2, phages that could target and bind to DDR1 were obtained, while phages that could not bind to DDR1 were washed out. The phages that bound to DDR1 in the Ph.D.-C7C peptide library were further extracted for DNA and sequenced in step 3. In step 4, amino acid sequences were constructed based on the base sequences of the bound phage DNA, resulting in three cyclic polypeptide structures.

[0080] 4. Based on the sequencing results, the base and amino acid sequences of the three cyclic polypeptides are shown in Table 1.

[0081] Table 1. Peptide sequences obtained through screening

[0082] AATAGTTCGAAGCTTCATATG NSSKLHM CGTGAGCCGACTTATAATCAG REPTYNQ GAGCAGGCTAATTATCGGATT EQANYRI

[0083] 5. Chemically synthesize polypeptides by adding AC- and -CGGG structures to both ends of the polypeptides shown in Table 1, and then linking them with disulfide bonds between C2 and C10 to form cyclic polypeptides, as shown in Table 1. Figure 3-5 The three cyclic polypeptides N3, R3, and E3 are shown. The synthesized cyclic polypeptides are as follows: The chemical structural formula of N3 is: C 48 H 79 N 17 O 17 S3, molecular structural formula as follows Figure 3 The amino acid sequence is SEQ ID No: 1ACNSSKLHMCGGG (C2-C10 disulfide bond); the chemical structural formula of R3 is: C 48 H 80 N 18 O 20S2, molecular structural formula as follows Figure 4 The amino acid sequence of R3 is SEQ ID No: 2ACREPTYNQCGGG (C2-C10 disulfide bond); the chemical structure of E3 is: C 53 H 82 N 18 O 19 S2, molecular structural formula as follows Figure 5 The amino acid sequence of E3 is SEQ ID No: 3ACEQANYRICGGG (C2-C10 disulfide bond). High-performance liquid chromatography (HPLC) analysis showed that the molecular weights of the three cyclic polypeptide main peaks were consistent with theoretical values. Figure 6 , 7 As shown in Figure 8.

[0084] Example 2: Results and Discussion of In Vitro Binding Assay

[0085] In vitro binding assays were performed using cyclic peptides synthesized through screening that could bind to DDR1 and coated DDR1 protein. The results showed that all three peptides could bind to DDR1 protein in vitro, and the absorbance of the bound peptides was detected at A450 nm. Moreover, the binding gradually decreased with increasing sample dilution. The results are shown in Table 2.

[0086] ELISA testing

[0087] 1) Coating: Coat DDR1 protein, 0.1 μg / mL, at 4°C overnight.

[0088] 2) Sealing: 2% skim milk powder, 200μL / well, 37℃ for 1h.

[0089] 3) Primary antibody: 100 μL / well, 37℃ for 1 h.

[0090] 4) Secondary antibody: anti-M13 antibody (HRP), 1:20000, 100μL well, 37℃ for 1h.

[0091] 5) Color development: 100 μL of color development solution per well, 37℃, 15 min.

[0092] 6) Termination: 100 μL of termination solution per well.

[0093] 7) Reading board: Antibody titer

[0094] Table 2: ELISA validation of the binding of the three cyclic peptides to DDR1

[0095]

[0096] (Note: The first column is the sample dilution rate, and the following three columns are the absorbance of the three cyclic peptides, respectively.)

[0097] Example 3: Cell fluorescence binding assay

[0098] After cells reached 80% confluency on a glass slide, they were incubated, washed, fixed, and then subjected to a blocking process. First, three polypeptides were labeled with fluorescein-5-aminothiourea (FITC) to obtain three fluorescent polypeptide probes: FITC-N3, FITC-R3, and FITC-E3. These three fluorescent polypeptides were then used to interact with cells (HARA cells for lung cancer and MCF7 cells for breast cancer) for approximately 1 hour before detection. DAPI staining, overnight incubation, and washing were performed to assess the binding of the three cyclic polypeptides to the cells.

[0099] Analysis of experimental results: All three fluorescent peptide probes, FITC-N3, FITC-R3, and FITC-E3, were able to bind to cells (HARA cells for lung cancer; MCF7 cells for breast cancer), such as... Figures 9-14 As shown, green fluorescence was detected after FITC-peptides bound to cells, and binding occurred in the cell membrane, cytoplasm, and nucleus. The blue sphere in the middle of the cell in the figure is the cell nucleus. Figure 9 , Figure 10 FITC-N3 binds to HARA cells in lung cancer and MCF7 cells in breast cancer; Figure 11 , Figure 12 FITC-R3 binds to HARA cells in lung cancer and MCF7 cells in breast cancer; Figure 13 , Figure 14 FITC-E3 binds to HARA cells in lung cancer and MCF7 cells in breast cancer.

[0100] It should be understood that the specific embodiments described above are merely illustrative of the invention or for explaining the principles of the invention, and do not constitute a limitation thereof. Therefore, any modifications, equivalent substitutions, improvements, etc., made without departing from the spirit and scope of the invention should be included within the protection scope of the invention. Furthermore, the appended claims are intended to cover all variations and modifications falling within the scope and boundaries of the appended claims, or equivalent forms of such scope and boundaries.

Claims

1. A cyclic polypeptide targeting DDR1, characterized in that, The cyclic polypeptide is N3, R3, or E3; The amino acid sequence of the cyclic polypeptide N3 is shown in SEQ ID No:1, and its molecular structure is as follows: ； The amino acid sequence of the cyclic polypeptide R3 is shown in SEQ ID No:2, and its molecular structure is as follows: ； The amino acid sequence of the cyclic polypeptide E3 is shown in SEQ ID No:3, and its molecular structure is as follows: 。 2. An application of the cyclic polypeptide targeting DDR1 according to claim 1, wherein the cyclic polypeptide targeting DDR1 can specifically bind to DDR1 to prepare a cyclic polypeptide inhibitor targeting DDR1, and the cyclic polypeptide inhibitor targeting DDR1 is used to prepare anti-lung cancer and anti-breast cancer tumor drugs.

3. The application according to claim 2, characterized in that, The lung cancer is non-small cell lung cancer, and the breast cancer is invasive ductal carcinoma.

4. The application according to claim 3, characterized in that, The cyclic polypeptide N3, R3, or E3 can specifically bind to the lung cancer HARA cell line.

5. The application according to claim 3, characterized in that, The cyclic polypeptide N3, R3, or E3 can specifically bind to the breast cancer MCF7 cell line.

Images