Liver tumor targeting drug and preparation method and application thereof

Abstract

The application belongs to the technical field of tumor medicine, and particularly relates to a liver tumor targeting drug and a preparation method and application thereof. The drug disclosed by the application uses LNPs as a carrier, and is wrapped with CjABE mRNA and sgRNA, is applied to the treatment of liver tumors, and through replacement of uridine with pseudouridine, achieves editing of a TERT-124C>T gene mutation in a targeted manner, so as to achieve the purpose of inhibiting the growth of liver tumors.

Description

Technical Field

[0001] This invention belongs to the field of oncology medical technology, specifically relating to targeted drugs for liver tumors, their preparation methods, and applications. Background Technology

[0002] In recent years, researchers have developed various vectors for CRISPR system delivery and gene editing, mainly including two categories: viral vectors and non-viral vectors. Viral vectors commonly used for CRISPR-Cas9 delivery include adenoviruses, adeno-associated viruses (AAVs), retroviruses, and lentiviruses. The first in vivo CRISPR-Cas9 therapy to enter clinical trials involved implanting CRISPR-Cas9 packaged with adeno-associated virus AAV5 into the eye for safety and efficacy evaluation (NCT03872479). AAV consists of an icosahedral protein shell approximately 26 nm in diameter and a single-stranded DNA approximately 4.7 kb in length. AAV vectors have many advantages, such as non-pathogenicity, long-term gene expression capability, and the ability to infect both dividing and non-dividing cells. However, AAV still has limitations when used for in vivo delivery of CRISPR-Cas9: 1) The ideal AAV vector size is 4.1–4.9 kb. Although AAV can carry vectors larger than its genome size, efficiency drops sharply. Therefore, AAV is generally not suitable for delivering large gene sequences; 2) Neutralizing antibodies against AAV are prevalent in most populations, which reduces therapeutic efficacy; 3) Long-term transgenic expression of AAV carries risks due to the potential for off-target effects caused by persistent expression of the Cas9 nuclease. Therefore, although viral vectors offer high delivery efficiency, they suffer from drawbacks such as small payload capacity, susceptibility to immune responses, and unpredictable genome integration events. While viral vectors are commonly used in basic research for CRISPR / Cas9 editing systems, their limited delivery efficiency due to the large size of Cas9 vectors has constrained their application in cancer treatment. Furthermore, virus-mediated random integration carries oncogenic risks, and persistent expression of Cas9 and gRNA not only increases the probability of off-target effects but also allows Cas9 protein to trigger an immune response. Therefore, viral vectors are not the optimal choice for clinical applications.

[0003] Viral vectors have limitations in terms of packaging capacity and safety, such as off-target effects and immunogenicity. These problems can be addressed through delivery methods using non-viral materials. To avoid the toxic side effects of adeno-associated viruses (AAVs), delivering relevant mRNA via non-viral vectors for the treatment of related diseases has shown significant advantages. Non-viral vectors mainly include liposomes, dendritic cells (DCs), inorganic nanoparticles, and cationic cell-penetrating peptides. Among them, liposomes offer unique advantages for mRNA delivery: 1) Liposomes are spherical vesicles that can encapsulate mRNA, resisting the action of nucleases; 2) Liposomes resemble cell membranes, easily fusing with recipient cells and resulting in high transfection efficiency; 3) Liposomes can deliver mRNA fragments of different sizes; 4) Liposomes as delivery vectors are not limited by the host. To date, liposomes have become the most effective non-viral vector for mRNA delivery. Liposomes are lipid bimolecular spherical structures formed in aqueous solution. Because nucleic acids and cell membranes are negatively charged, the repulsive force between them prevents nucleic acid delivery into cells. Packaging negatively charged nucleic acids into positively charged liposomes can promote delivery into cells. This method overcomes the immunogenicity problem that viral vectors may cause, making it safer. Lipid nanoparticles (LNPs) are commonly used for nucleic acid delivery and are one of the mainstream delivery carriers. LNPs generally consist of an aqueous core surrounded by a lipid bilayer shell, which is composed of different lipids, each of which performs a different function.

[0004] Currently, CRISPR system delivery can be achieved via plasmid DNA, mRNA, or direct delivery of Cas9 / gRNA ribonucleoproteins (RNPs). Among these, plasmid delivery of CRISPR / Cas9 systems was the earliest researched, including the use of viral and non-viral delivery vectors. Plasmid delivery of CRISPR systems offers good expression stability and high translation efficiency, but its prolonged intracellular expression carries risks such as potential genome insertion, induction of immune responses, and unpredictable off-target events. Compared to plasmid delivery, which requires transcription and translation for Cas9 gene editing, delivery of CRISPR systems in the form of Cas9 mRNA or LNPs is more timely, easier to regulate, and therefore safer.

[0005] LNPs can be prepared using various methods, such as lipid vesicle extrusion, lipid rehydration, nanoprecipitation, and microfluidic mixing. However, the most common method involves rapidly mixing water and lipid components. Microfluidics, with its excellent reproducibility, has become the preferred method for preclinical research. LNPs are highly customizable nucleic acid vectors and have shown great potential in mRNA vaccines. Their potential value in treating rare diseases and cancer should not be overlooked. mRNA therapy can help generate therapeutic proteins to restore the function of damaged tissues or organs. Extensive scientific research worldwide is being conducted to design and refine the individual components of LNPs for efficient and safe delivery of nucleic acids of interest. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a targeted drug for liver tumors, its preparation method and application. The drug uses LNPs as carriers to encapsulate mRNA based on CjABE and sgRNA, and is applied to the treatment of liver tumors. By replacing uridine with pseudouridine, the drug can be targeted to edit the gene mutation of TERT-124C>T, thereby inhibiting the growth of liver tumors.

[0007] This invention is achieved through the following technical solution:

[0008] The liver tumor targeted drug of the present invention is made by encapsulating CjABE mRNA and sgRNA using lipid nanoparticles as carriers. The nucleotide sequence of the CjABE mRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2.

[0009] The method for preparing the liver tumor-targeting drug includes the following steps:

[0010] (1) Preparation of CjABE mRNA: Using linearized plasmid DNA with nucleotide sequence SEQ ID NO.3 as a template, CjABE mRNA containing N1-methylpseudouridine and capped and polyadenylated was synthesized by in vitro transcription using T7 RNA polymerase; the open reading frame (ORF) of the CjABE mRNA contains an N-terminal nuclear localization sequence (NLS) and an HA tag;

[0011] (2) Preparation of sgRNA: Using linearized plasmid DNA with nucleotide sequence SEQ ID NO.4 as a template, sgRNA containing N1 methylpseudouridine was generated by in vitro transcription using T7 RNA polymerase.

[0012] (3) Self-assembly of LNPs: The lipid mixture is dissolved in ethanol and referred to as the organic phase; the RNA mixture and the targeting peptide prepared in steps (1) and (2) are dissolved in sodium citrate buffer and referred to as the aqueous phase; the organic phase and the aqueous phase are mixed and placed in a microfluidic device to obtain LNPs containing CjABE mRNA and sgRNA, which are the liver tumor targeting drugs.

[0013] Preferably, the lipid mixture is obtained by mixing SM102, DSPC, cholesterol and DSPE-PEG2000 in a molar ratio of 50:10:38.5:1.5.

[0014] Preferably, the targeting peptide is composed of a mixture of DSPE-PEG2000-cRGD, C16-TAT and lipids in a weight ratio of 1:1:10.

[0015] Preferably, in the RNA mixture, the weight ratio of CjABE mRNA to sgRNA is 2:1, and the N / P ratio is 6:1.

[0016] Preferably, the organic phase and the aqueous phase are mixed in a volume ratio of 1:3.

[0017] Preferably, the extrusion flow rate of the organic phase is 4 mL / min, and the extrusion flow rate of the aqueous phase is 12 mL / min.

[0018] Preferably, the citrate buffer solution has a pH of 4.0.

[0019] Preferably, SM102 and DSPC (1,2-distearyl-sn-glycerol-3-phosphocholine) were purchased from Shochem (Shanghai) Co., Ltd.

[0020] Preferably, DSPE (1,2-distearyl-glycerol-3-phosphoethanolamine)-PEG2000 and DSPE-PEG2000-cRGD were purchased from Xi'an Ruixi Biotechnology Co., Ltd.

[0021] Preferably, C16-TAT (C16-GGRKKRRQRRRPQ) was purchased from Nanjing Yuantai Biotechnology Co., Ltd.

[0022] Preferably, the preparation of CjABE mRNA and sgRNA was carried out by Guangzhou RIBOBIO Co., Ltd., and the self-assembly of LNP was carried out by Micro&Nano (Shanghai) Biotechnology Co., Ltd.

[0023] Preferably, the LNPs obtained in step (3) should be dialyzed twice in PBS buffer (pH 7.4) containing 2% sucrose, each time for 12 hours, to remove ethanol.

[0024] This invention provides the application of the liver tumor targeted drug in the treatment of liver tumors. By replacing uridine with pseudouridine, the gene mutation of TERT-124C>T is edited in a targeted manner to inhibit the growth of liver tumors.

[0025] The sequence of SEQ ID NO.1 is as follows:

[0026] AUGUACCCAUACGAUGUUCCAGAUUACGCUUCGCCGAAGAAAAAGCGCAAGGU

[0027] CUCCGAAGUCGAGUUUUCCCAUGAGUACUGGAUGAGACACGCAUUGACUCUCGCAA

[0028] AGAGGGCUUGGGAUGAACGCGAGGUGCCCGUGGGGGCAGUACUCGUGCAUAACAAU

[0029] CGCGUAAUCGGCGAAGGUUGGAAUAGGCCGAUCGGACGCCACGACCCCACUGCACA

[0030] UGCGGAAAUCAUGGCCCUUCGACAGGGAGGGCUUGUGAUGCAGAAUUAUCGACUUA

[0031] UCGAUGCGACGCUGUACGUCACGCUUGAACCUUGCGUAAUGUGCGCGGGAGCUAUG

[0032] AUUCACUCCCGCAUUGGACGAGUUGUAUUCGGUGCCCGCGACGCCAAGACGGGGUGC

[0033] CGCAGGUUCACUGAUGGACGUGCUGCAUCACCCAGGCAUGAACCACCGGGUAGAAA

[0034] UCACAGAAGGCAUAUUGGCGGACGAAUGUGCGGCGCUGUUGUCCGACUUUUUCGC

[0035] AUGCGGAGGCAGGAGAUCAAGGCCCAGAAAAAAGCACAAUCCUCUACUGACUCGGG

[0036] AGGAUCUUCGGGAUCAGAAACCCCGGGCACAUCCGAGUCUGCCACACCAGAAUCUUC

[0037] GGGAGGAUCUUCCGAAGUCGAGUUUUCCCAUGAGUACUGGAUGAGACACGCAUUGA

[0038] CUCUCGCAAAGAGGGCUAGGGAUGAACGCGAGGUGCCCGUGGGGGCAGUACUCGUG

[0039] CUUAACAAUCGCGUAAUCGGCGAAGGUUGGAAUAGGGCGAUCGGACUCCACGACCC

[0040] CACUGCACAUGCGGAAAUCAUGGCCCUUCGACAGGGAGGGCUUGUGAUGCAGAAUU

[0041] AUCGACUUAUCGAUGCGACGCUGUACGUCACGUUUGAACCUUGCGUAAUGUGCGCG

[0042] GGAGCUAUGAUUCACUCCCGCAUUGGACGAGUUGUAUUCGGUGUCCGCAACGCCAA

[0043] GACGGGUGCCGCAGGUUCACUGAUGGACGUGCUGCAUUACCCAGGCAUGAACCACC

[0044] GGGUAGAAAUCACAGAAGGCAUAUUGGCGGACGAAUGUGCGGCGCUGUUGUGCUAC

[0045] UUUUUUCGCAUGCCGAGGCAGGUGUUCAACGCCCAGAAAAAAGCACAAUCCUCUAC

[0046] UGACUCGGGAGGAUCUUCGGGAUCAGAAACCCCGGGCACAUCCGAGUCUGCCACACC

[0047] AGAAUCUUCGGGAGGAUCUGCCCGCAUCCUCGCUUUCGCCAUCGGAAUCUCUAGUA

[0048] UCGGAUGGGCCUUCUCUGAAACGACGAACUGAAAGACUGCGGCGUGAGAAUCUUC

[0049] ACAAAGGUUGAAACCCUAAAACAGGCGAGUCUUUAGCCUCUGCCACGUAGGUGGC

[0050] CCGCUCCGCCCGAAAAAGGCUGGCUCGGCGGAAGGCUCGCCUCAACCACUUGAAGCA

[0051] UUUGAAUGCUAAUGAGUUCAAACUGACUACGAAGAUUACCAGUCCUUCGACGAGU

[0052] CAUUGGCAAAAGCCUACAAAGGCAGCCUUAUCAGUCCUUAUGAGUUGAGAUUUCGC

[0053] GCACUCAACGAACUGCUUUCUAAGCAAGACUUUGCUAGGGUCAUUCUGCACAUCGC

[0054] AAAACGGCGAGGUUAUGACGAUAUCAAGAACUCCGACGAUAAAGAAAAGGGAGCCA

[0055] UUCUCAAGGCGAUCAAACAGAAUGGAAAAUUGGCAAACUACCAGAGUGUGGGC

[0056] GAGUAUCUGUAUAAAGAGAUUUCCAGAAGUUUAAGGAAAACAGCAAGGAGUUAC

[0057] AAACGUCAGAAAUAAAAAGGAGUCUUACGAGAGAUGCAUCGCGCAGUCAUUCCUCA

[0058] YOUR AREA

[0059] AAGAAGUUCGAAGGAGGGUUCUUUCCGUGGCGUUUUACAAGAGGCGCUCAAAGA

[0060] CUUCCCCACCUGGUUGGUAAGUUUCUCACGGAUGAGAAGCGAGCUCCCA

[0061] AAAAUUCCCCCUGCUUUUUUUGCCCUGACUCGGAUCAUUAACCUGCUG

[0062] AAAACCUGAAAAAUACUGAAGGGAUCUUGUAUCGAAGGACGACCUAAAUGGCACU

[0063] CCUGAAUGAAGUGCUCAAAAACGGAACUCUAACCUAUAAACAGACCAAGAAAUUAC

[0064] UGGGGCUCUCUGUCAGACUACGAGUUCAAGGCGAGAAGGGUACUUAUUUUAUCGAA

[0065] UUCAAAAAGUAUAAGGAGUUCAUUAAGCAUUGGGGGAACACAACCUCAGCCAGGA

[0066] CGAUCUCAAUGAAUUGCCAAGGACAUCACGCUGAUUAAAGACGAGAUAAACUGA

[0067] AAAAGGCACUGGCCAAGUAUGACCUCAACGAACCAGAUCGACUCUGUCCAAG

[0068] CUGGAGUUCAAAGACCACCUAAACAUAUCCUUUCAAAGCCCUGAAACUGGUCACCCCU

[0069] CUAAUGCUCGAAGGAAAAAAAAUACGACGAGGCGUGUAAUGAACUGAAUCUUAAGGU

[0070] GGCCAUCAAUGAGGAUAAGAGGACUUUCCAGCCUUUAACGAGACAUAUAUACA

[0071] AAGACGAGGUCACAAACCCGGUUGUGCUGAGGCCAUAAAGAGUAUCGGAGGUU

[0072] CUGAAUGCCCUCCUGAAGAAGUACGGCAAAGUGCACAAAUAAUAUCGAAUUGGC

[0073] UAGGGAGGUGGGGAAGAACCAUCUCACCGAGCAAAGAUCGAGAAAGAGCAGAAUG

[0074] AGACUACAAAGCCAAGAAAGACGCCGAACUGGAGUGCGAAAAGCUGGGCUUAAA

[0075] AUAAAACAGUAAAAACAUCCUGAAAUUAAGAUUGUUACAAAGAGCAAAAGGAGUUUUG

[0076] CGCCUACUCAGGGGAAAAAAUCAAAAAUAUCAGACCUGCAGGACGAGAAAAUUGCUGG

[0077] AGAUCGACCACAUCUAUCCGUAUAGCAGGUCAUUGACGAUUCCUACAUGAAAAAA

[0078] GUGCUUGUGUUUACCAAACAGAAACCAAGAAAAGCUGAACCAAACCCCCCUUUGAGGC

[0079] UUUCGGAAACGACUCAGCCAAGUGGCAGAAAAUCGAAAGUCCUAGCCAAGAAUCUGC

[0080] CUACAAAAAACAAAAGAGGAUUCUGUAAGACUAUAAGGACAAGGAACAGAAA

[0081] AACUUUAAAGACAGGAACCUGAAUGACACGAGGUACAUUGCGCGACUGGUUCUAAA

[0082] CUAUACCAAAGACUACCUGGAUUUCCUCCCUCUGAGCGACGACGAGAAUACUAAAC

[0083] UGAAUGAUACCCAGAAAGGCUCAAAGGUCCACGUUGAGGCUAAGUCCGGGAGCUG

[0084] ACUAGCGCCCUCCGCCACACGUGGGGCUUCAGCGCCAAAGAUCGGAAUAAUCAUCUU

[0085] CAUCACGCUAUUGAUGCAGUAAUCAUAGCCUACGCUAACAACAGCAUCGUGAAAGC

[0086] CUUCUCCGAUUUCAAGAAAGAACAGGAGUCUAAUAGCGCCGAGUUGUACGCCAAGA

[0087] AAAUUUCCGAAUUGGACUAUAAAAAUAAGAGAAAAUUCUUCGAACCCUUCUCCGGG

[0088] UUUCGCCAAAAGGUCUUAGAUAAGAUCGACGAGAUUUUCGUUUCCAAGCCCGAAAG

[0089] AAAAAAGCCUUCAGGGGCACUGCACGAAGAGACAUUCCGCAAGGAAGAGGAAUUUU

[0090] ACCAAUCUUACGGUGGUAAAGAGGGAGUUCUGAAGGCUCUGGAGCUUGGGAAGAUC

[0091] CGCAAGGUAAACGGGAAAAUCGUGAAAAACGGGGACAUGUUCAGGGUGGAUAUCUU

[0092] CAAGCACAAAAAGACCAACAAGUUCUACGCAGUACCCAUCUACACUAUGGAUUUCG

[0093] CUUUAAAGGUUCUCCCAAAUAAGGCGGUGGCUCGAUCGAAGAAAGGAGAGAUCAAG

[0094] GACUGGAUCUUAAUGGAUGAAAAUUACGAGUUUUGCUUCUCGCUCUACAAAGAUAG

[0095] CCUGAUUCUGAUCCAGACAAAAGACAUGCAGGAACCAGAAUUUGUUUAUUAUAACG

[0096] CCUUCACGAGCAGUACAGUGUCCCUGAUUGUGAGCAAGCAUGAUAACAAGUUCGAG

[0097] ACUCUGUCUAAGAAUCAGAAAAUCCUUUUCAAGAACGCCAACGAGAAGGAGGUCAU

[0098] CGCAAAGUCAAUUGGCAUCCAAAACCUGAAGGUGUUCGAGAAAUACAUAGUGUCCG

[0099] CACUCGGUGAAGUAACUAAAGCCGAAUUUCGACAGCGCGAGGAUUUUAAGAAAAGC

[0100] CCCAAGAAGAAGAGAAAGGUGGAGGCCAGCUAA

[0101] The sequence of SEQ ID NO.2 is as follows:

[0102] GGCCCGGAAGGGGCUGGGCCGUUUUAGUCCCUGAAAAGGGACUAAAAUAAAGAGUUUGCGGGACUCUGCGGGGUUACAAUCCCCUAAAACCGC

[0103] The sequence of SEQ ID NO.3 is as follows:

[0104] GCCACCATGTACCCATACGATGTTCCAGATTACGCTTCGCCGAAGAAAAAGCGCAA

[0105] GGTCTCCGAAGTCGAGTTTTCCCATGAGTACTGGATGAGACACGCATTGACTCTCGCAA

[0106] AGAGGGCTTGGGATGAACGCGAGGTGCCCGTGGGGGCAGTACTCGTGCATAACAATCG

[0107] CGTAATCGGCGAAGGTTGGAATAGGCCGATCGGACGCCACGACCCCACTGCACATGCGG

[0108] AAATCATGGCCCTTCGACAGGGAGGGCTTGTGATGCAGAATTATCGACTTATCGATGCGA

[0109] CGCTGTACGTCACGCTTGAACCTTGCGTAATGTGCGCGGGAGCTATGATTCACTCCCGCA

[0110] TTGGACGAGTTGTATTCGGTGCCCGCGACGCCAAGACGGGTGCCGCAGGTTCACTGATG

[0111] GACGTGCTGCATCACCCAGGCATGAACCACCGGGTAGAAATCACAGAAGGCATATTGGC

[0112] GGACGAATGTGCGGCGCTGTTGTCCGACTTTTTTCGCATGCGGAGGCAGGAGATCAAGG

[0113] CCCAGAAAAAAGCACAATCCTCTACTGACTCGGGAGGATCTTCGGGATCAGAAACCCC

[0114] GGGCACATCCGAGTCTGCCACACCAGAATCTTCGGGAGGATCTTCCGAAGTCGAGTTTT

[0115] CCCATGAGTACTGGATGAGACACGCATTGACTCTCGCAAAGAGGGCTAGGGATGAACGC

[0116] GAGGTGCCCGTGGGGGCAGTACTCGTGCTTAACAATCGCGTAATCGGCGAAGGTTGGAA

[0117] TAGGGCGATCGGACTCCACGACCCCACTGCACATGCGGAAATCATGGCCCTTCGACAGG

[0118] GAGGGCTTGTGATGCAGAATTATCGACTTATCGATGCGACGCTGTACGTCACGTTTGAAC

[0119] CTTGCGTAATGTGCGCGGGAGCTATGATTCACTCCCGCATTGGACGAGTTGTATTCGGTG

[0120] TCCGCAACGCCAAGACGGGTGCCGCAGGTTCACTGATGGACGTGCTGCATTACCCAGGC

[0121] ATGAACCACCGGGTAGAAATCACAGAAGGCATATTGGCGGACGAATGTGCGGCGCTGTT

[0122] GTGCTACTTTTTTCGCATGCCGAGGCAGGTGTTCAACGCCCAGAAAAAAGCACAATCCT

[0123] CTACTGACTCGGGAGGATCTTCGGGATCAGAAACCCCGGGCACATCCGAGTCTGCCACA

[0124] CCAGAATCTTCGGGAGGATCTGCCCGCATCCTCGCTTTCGCCATCGGAATCTCTAGTATC

[0125] GGATGGGCCTTCTCTGAAAACGACGAACTGAAAGACTGCGGCGTGAGAATCTTCACAA

[0126] AGGTTGAAAACCCTAAAACAGGCGAGTCTTTAGCTCTGCCACGTAGGTTGGCCCGCTCC

[0127] GCCCGAAAAAGGCTGGCTCGGCGGAAGGCTCGCCTCAACCACTTGAAGCATTTGATAG

[0128] CTAATGAGTTCAAACTGAACTACGAAGATTACCAGTCCTTCGACGAGTCATTGGCAAAA

[0129] GCCTACAAAGGCAGCCTTATCAGTCCTTATGAGTTGAGATTTCGCGCACTCAACGAACT

[0130] GCTTTCTAAGCAAGACTTTGCTAGGGTCATTCTGCACATCGCAAAACGGCGAGGTTATG

[0131] ACGATATCAAGAACTCCGACGATAAAGAAAAGGGAGCCATTCTCAAGGCGATCAAACA

[0132] GAATGAGGAAAAATTGGCAAACTACCAGAGTGTGGGCGAGTATCTGTATAAAGAGTATT

[0133] TCCAGAAGTTTAAGGAAAACAGCAAGGAGTTTACAAACGTCAGAAATAAAAAGGAGTC

[0134] TTACGAGAGATGCATCGCGCAGTCATTCCTCAAAGATGAGCTGAAGCTGATATTTAAGAA

[0135] GCAACGCGAATTTGGTTTCTCATTCTCTAAGAAGTTCGAAGAGGAGGTTCTTTCCGTGG

[0136] CGTTTTACAAGAGGGCGCTCAAAGACTTCTCCCACCTGGTTGGTAACTGTAGTTTCTTCA

[0137] CGGATGAGAAGCGAGCTCCCAAAAATTCTCCCCTGGCTTTCATGTTTGTTGCCCTGACTC

[0138] GGATCATTAACCTGCTGAACAACCTGAAAAATACTGAAGGGATCTTGTATACGAAGGAC

[0139] GACCTAAATGCACTCCTGAATGAAGTGCTCAAAAACGGAACTCTAACCTATAAACAGAC

[0140] CAAGAAATTACTGGGGCTCTCTGACGACTACGAGTTCAAGGGCGAGAAGGGTACTTATT

[0141] TTATCGAATTCAAAAAGTATAAGGAGTTCATTAAAGCATTGGGGGAACACAACCTCAGC

[0142] CAGGACGATCTCAATGAAATTGCCAAGGACATCACGCTGATTAAAGACGAGATAAAACT

[0143] GAAAAAGGCACTGGCCAAGTATGACCTCAACCAGAACCAGATCGACTCTCTGTCCAAG

[0144] CTGGAGTTCAAAGACCACCTAAACATATCCTTCAAAGCCCTGAAACTGGTCACCCCTCT

[0145] AATGCTCGAAGGAAAAAAATACGACGAGGCGTGTAATGAACTGAATCTTAAGGTGGCCA

[0146] TCAATGAGGATAAGAAGGACTTTCTTCCAGCCTTTAACGAGACATATTACAAAGACGAG

[0147] GTCACAAACCCGGTTGTGCTGAGGGCCATAAAAGAGTATCGGAAGGTTCTGAATGCCCT

[0148] CCTGAAGAAGTACGGCAAAGTGCACAAAATAAATATCGAATTGGCTAGGGAGGTGGGG

[0149] AAGAACCATTCTCAGCGAGCAAAGATCGAGAAAGAGCAGAATGAGAACTACAAAGCCA

[0150] AGAAAGACGCCGAACTGGAGTGCGAAAAGCTGGGGCTTAAAATAAACAGTAAAAACAT

[0151] CCTGAAATTAAGATTGTTCAAAGAGCAAAAGGAGTTTTGCGCCTACTCAGGGGAAAAA

[0152] ATCAAAATATCAGACCTGCAGGACGAGAAAATGCTGGAGATCGACCACATCTATCCGTAT

[0153] AGCAGGTCATTTGACGATTCCTACATGAACAAAGTGCTTGTGTTTACCAAACAGAACCA

[0154] AGAAAAGCTGAACCAAACCCCCTTTGAGGCTTTCGGAAACGACTCAGCCAAGTGGCAG

[0155] AAAATCGAAGTCCTAGCCAAGAATCTGCCTACAAAAAAACAAAAGAGGATTCTTGATAA

[0156] GAACTATAAGGACAAGGAACAGAAAAACTTTAAAGACAGGAACCTGAATGACACGAGG

[0157] TACATTGCGCGACTGGTTCTAAACTATACCAAAGACTACCTGGATTTCCTCCCTCTGAGC

[0158] GACGACGAGAATACTAAACTGAATGATACCCAGAAAGGCTCAAAGGTCCACGTTGAGG

[0159] CTAAGTCCGGGATGCTGACTAGCGCCCTCCGCCACACGTGGGGCTTCAGCGCCAAAGAT

[0160] CGGAATAATCATCTTCATCACGCTATTGATGCAGTAATCATAGCCTACGCTAACAACAGCA

[0161] TCGTGAAAGCCTTCTCCGATTTCAAGAAAGAACAGGAGTCTAATAGCGCCGAGTTGTAC

[0162] GCCAAGAAAATTTCCGAATTGGACTATAAAAATAAGAGAAAATTCTTCGAACCCTTCTCC

[0163] GGGTTTCGCCAAAAGGTCTTAGATAAGATCGACGAGATTTTCGTTTCCAAGCCCGAAAG

[0164] AAAAAAGCCTTCAGGGGCACTGCACGAAGAGACATTCCGCAAGGAAGAGGAATTTTAC

[0165] CAATCTTACGGTGGTAAAGAGGGAGTTCTGAAGGCTCTGGAGCTTGGGAAGATCCGCA

[0166] AGGTAAACGGGAAAATCGTGAAAAACGGGGACATGTTCAGGGTGGATATCTTCAAGCA

[0167] CAAAAAGACCAACAAGTTCTACGCAGTACCCATCTACACTATGGATTTCGCTTTAAAGGT

[0168] TCTCCCAAATAAGGCGGTGGCTCGATCGAAGAAAGGAGAGATCAAGGACTGGATCTTAA

[0169] TGGATGAAAATTACGAGTTTTGCTTCTCGCTCTACAAAGATAGCCTGATTCTGATCCAGA

[0170] CAAAAGACATGCAGGAACCAGAATTTGTTTATTATAACGCCTTCACGAGCAGTACAGTG

[0171] TCCCTGATTGTGAGCAAGCATGATAACAAGTTCGAGACTCTGTCTAAGAATCAGAAAAT

[0172] CCTTTTCAAGAACGCCAACGAGAAGGAGGTCATCGCAAAGTCAATTGGCATCCAAAAC

[0173] CTGAAGGTGTTCGAGAAATACATAGTGTCCGCACTCGGTGAAGTAACTAAAGCCGAATT

[0174] TCGACAGCGCGAGGATTTTAAGAAAAGCCCCAAGAAGAAGAGAAAGGTGGAGGCCAG

[0175] CTAA

[0176] The sequence of SEQ ID NO.4 is as follows:

[0177] GGCCCGGAAGGGGCTGGGCCGTTTTAGTCCCTGAAAAGGGACTAAAATAAAGAGT TTGCGGGACTCTGCGGGGTTACAATCCCCTAAAACCGC

[0178] Compared with the prior art, the beneficial effects of the present invention are:

[0179] In vitro synthesized mRNA exhibits high immunogenicity and may induce a significant inflammatory response. The human immune response to mRNA is primarily related to uridine (partially composed of uracil), and this invention utilizes pseudouracil to replace uracil, thereby reducing the immune system's recognition of mRNA. However, uncoated mRNA is inherently unstable and readily degrades rapidly due to nucleases and autolysis. The LNP-coated mRNA of this invention is protected from extracellular ribonucleases and facilitates intracellular mRNA delivery. Attached Figure Description

[0180] Figure 1 Schematic diagram of LNP preparation, demonstrating the construction of LNPs encapsulating Cas9 mRNA and sgRNA based on microfluidic lipid mixing;

[0181] Figure 2 Huh7 cells were transfected with the specified LNPs at a concentration of 2 μg / mL. 48 hours after LNP transfection, Western blot analysis of the proteins was performed using the specified antibody.

[0182] Figure 3 A schematic diagram of the time sequence of LNP transfection and DNA sequencing. Huh7 cells were transfected with specified LNPs at a concentration of 2 μg / mL. Ten days after LNP transfection, the DNA regions flanking -124C>T in the TRET promoter were analyzed by Sanger DNA sequencing. The arrows indicate mutations.

[0183] Figure 4 Huh7 cells were transfected with the specified LNPs at a concentration of 2 μg / mL, and Western blot analysis of the proteins was performed on day 10 using the specified antibody.

[0184] Figure 5 The flowchart illustrates the injection of LNPs into tumors. Huh7 cells were injected into the livers of athymic nude mice (n=5 per group). At designated time points after Huh7 injection, specified LNPs were injected via the tail vein. Mice were sacrificed 35 days after cell injection. Tumor growth was observed 35 days later. Arrows indicate tumors (middle), and tumor volume (right) was calculated. Data are expressed as mean ± SD. Student's t-test showed ***P<0.001. Scale bar is 1 cm.

[0185] Figure 6 Tumor tissues from different mice were mixed together, and the DNA region of the TERT promoter-124C>T mutation on chromosome 5 of each group of mice (n=5) was analyzed by Sanger sequencing. The arrows indicate the mutations.

[0186] Figure 7Immunohistochemical analysis of xenograft tumors in nude mice (n=5) was performed using indicator antibodies. Representative immunohistochemical staining is shown in the figure. Data are mean ± SD. Student t test was performed. ***P<0.001. Scale bar is 50 μm. Detailed Implementation

[0187] To make the objectives and technical solutions of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings. Unless otherwise specified, the experimental methods described in the following tests are conventional methods; for tests where specific techniques or conditions are not specified, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions; unless otherwise specified, the reagents and materials described are commercially available.

[0188] The liver tumor targeted drug of the present invention is made by encapsulating CjABE mRNA and sgRNA using lipid nanoparticles as carriers. The nucleotide sequence of the CjABE mRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2.

[0189] The method for preparing the liver tumor-targeting drug includes the following steps:

[0190] (1) Preparation of CjABE mRNA: Using linearized plasmid DNA with nucleotide sequence SEQ ID NO.3 as a template, CjABE mRNA containing N1-methylpseudouridine and capped and polyadenylated was synthesized by in vitro transcription using T7 RNA polymerase; the open reading frame (ORF) of the CjABE mRNA contains an N-terminal nuclear localization sequence (NLS) and an HA tag;

[0191] (2) Preparation of sgRNA: Using linearized plasmid DNA with nucleotide sequence SEQ ID NO.4 as a template, sgRNA containing N1 methylpseudouridine was generated by in vitro transcription using T7 RNA polymerase.

[0192] (3) Self-assembly of LNPs: The lipid mixture was dissolved in ethanol and referred to as the organic phase; the RNA mixture and the targeting peptide prepared in steps (1) and (2) were dissolved in sodium citrate buffer and referred to as the aqueous phase; the organic phase and the aqueous phase were placed in a microfluidic device at a volume ratio of 1:3; the organic phase was co-extruded at a flow rate of 4 mL / min and the aqueous phase at a flow rate of 12 mL / min to obtain LNPs containing CjABE mRNA and sgRNA, which are the liver tumor targeted drugs described above;

[0193] (4) The LNPs obtained in step (3) should be dialyzed twice in PBS buffer (pH 7.4) containing 2% sucrose for 12 hours each time to remove ethanol.

[0194] The lipid mixture is obtained by mixing SM102, DSPC, cholesterol and DSPE-PEG2000 in a molar ratio of 50:10:38.5:1.5.

[0195] The targeting peptide is composed of a mixture of DSPE-PEG2000-cRGD, C16-TAT and lipids in a weight ratio of 1:1:10.

[0196] The RNA mixture consists of CjABE mRNA and sgRNA in a weight ratio of 2:1 and an N / P ratio of 6:1.

[0197] The citrate buffer solution has a pH of 4.0.

[0198] SM102 and DSPC (1,2-distearyl-sn-glycerol-3-phosphocholine) were purchased from Shochem (Shanghai) Co., Ltd.

[0199] DSPE (1,2-distearyl-glycerol-3-phosphoethanolamine)-PEG2000 and DSPE-PEG2000-cRGD were purchased from Xi'an Ruixi Biotechnology Co., Ltd.

[0200] C16-TAT (C16-GGRKKRRQRRRPQ) was purchased from Nanjing Yuantai Biotechnology Co., Ltd.

[0201] The preparation of CjABE mRNA and sgRNA was carried out by Guangzhou RIBOBIO Co., Ltd., and the self-assembly of LNP was carried out by Micro&Nano (Shanghai) Biopharmaceutical Co., Ltd.

[0202] LNPs containing CjABE mRNA and sgRNA were labeled as 124 LNPs, while LNPs without CjABE mRNA and sgRNA were labeled as MOCK LNPs. Animal studies were conducted as follows:

[0203] (1) Animal experiments:

[0204] Five-week-old male BALB / c nude mice, specifically pathogen-free, were ordered from Vital Rivers and housed in microisolated cages under pathogen-free conditions. The animals were fed for one week prior to the experiment. One million Huh7 cells were added to 20 μL of DMEM containing 50% matrix gel and injected into the livers of five 6-week-old male BALB / c athymic nude mice. Treatment with LNPs targeting TERT-124C>T was initiated four days after tumor cell injection. The LNPs were administered via tail vein injection, with each mouse receiving 200 μL (each mL of LNPs containing 100 μg CjABE mRNA and 100 μg sgRNA). The mice were euthanized 28 days after injection. The livers of each mouse were dissected, fixed in formalin, and embedded in paraffin. Tumor volume was calculated using the formula V = 1 / 2a. 2 b(V, volume; a, shortest diameter; b, longest diameter). This study was conducted in accordance with relevant institutional and national guidelines and regulations.

[0205] (2) Immunohistochemical staining:

[0206] Mouse tumor samples were fixed, paraffin-embedded, and sectioned (5 μm). Paraffin-embedded xenograft tissue sections were stained with anti-TERT, Ki67, or lysed PARP1 antibodies. Immunohistochemistry was then performed on the sections using the SuperPicture Polymer Detection Kit (Life Technologies, Thermo Fisher Scientific). Slides were then mounted on universal scaffolds (Research Genetics, Huntsville, AL) and photographed under an optical microscope.

[0207] (3) Statistical Analysis

[0208] The mean values ​​obtained from the control group and the experimental group were analyzed for statistical significance. Unpaired t-tests and one-way ANOVA were performed using Microsoft Excel and GraphPad PRISM 6 (GraphPad Software). A p-value less than 0.05 was considered statistically significant.

[0209] The final conclusion is as follows: Figure 1-7 LNPs-mediated delivery of CjABE mRNA and sgRNA can effectively correct mutated TERT promoters in HCC cells and inhibit liver tumor growth.

Claims

1. A targeted drug for liver tumors, characterized in that: It is made by encapsulating CjABE mRNA and sgRNA using lipid nanoparticles as carriers. The nucleotide sequence of the CjABE mRNA is shown in SEQ ID NO.1, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO.

2. The liver tumor targeted drug is prepared by the following steps: (1) Preparation of CjABE mRNA: Using linearized plasmid DNA with nucleotide sequence as shown in SEQ ID NO.3 as a template, CjABE mRNA containing N1-methylpseudouridine and capped and polyadenylated was synthesized by in vitro transcription using T7 RNA polymerase; the open reading frame of the CjABE mRNA contains an N-terminal nuclear localization sequence and an HA tag. (2) Preparation of sgRNA: Using linearized plasmid DNA with nucleotide sequence as shown in SEQ ID NO.4 as a template, sgRNA containing N1 methylpseuuridine was generated by in vitro transcription using T7 RNA polymerase. (3) Self-assembly of LNPs: The lipid mixture is dissolved in ethanol and is referred to as the organic phase; the RNA mixture and the targeting peptide prepared in steps (1) and (2) are dissolved in sodium citrate buffer and referred to as the aqueous phase; the organic phase and the aqueous phase are mixed and placed in a microfluidic device to obtain LNPs containing CjABE mRNA and sgRNA, which are the liver tumor targeted drugs described above. The lipid mixture was obtained by mixing SM102, DSPC, cholesterol, and DSPE-PEG2000 in a molar ratio of 50:10:38.5:1.

5. The targeted peptide is composed of a mixture of DSPE-PEG2000-cRGD, C16-TAT and lipids, with a weight ratio of 1:1:

10. In the RNA mixture, the weight ratio of CjABE mRNA to sgRNA is 2:1, and the N / P ratio is 6:1; The organic phase and the aqueous phase are mixed at a volume ratio of 1:3; The extrusion flow rate of the organic phase was 4 mL / min, and the extrusion flow rate of the aqueous phase was 12 mL / min.

2. The use of the liver tumor-targeting drug according to claim 1 in the preparation of a medicament for treating liver tumors.

Images