Application of ODC gene deletion in obtaining strong aroma rice
Patent Information
- Application Number
- CN202211017034.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-24
- Publication Date
- 2026-08-21
- Estimated Expiration
- 2042-08-24
AI Technical Summary
然而目前,水稻生产面临着诸多的新挑战,如人口快速增长,全球气候变化以及由此衍生的新的病虫害及其他环境问题
[0041] 1) This invention is the first to discover a novel gene ODC that controls the aroma of rice. This gene encodes ornithine decarboxylase. The deletion of this gene sequence can lead to loss of function, thereby producing aroma in rice.
Smart Images

Figure CN117625675B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of crop breeding, crop quality improvement, and new germplasm creation. Specifically, it relates to the application of ODC gene deletion in obtaining aromatic rice, and in particular to a method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology or hybridization technology. Background Technology
[0002] Rice, a staple food for more than half the world's population, means that global food security largely depends on rice production. Aroma is a crucial attribute of rice, and with changing times, consumers are increasingly focusing on characteristics such as appearance, aroma, and taste. The growing global demand for fragrant rice has attracted the attention of rice producers, prompting them to prioritize enhancing the aroma of their commercial rice varieties.
[0003] 2-Acetyl-1-pyrroline (2-AP) is a major component of fragrant rice. 2-AP imparts a popcorn-like aroma to fragrant rice; comparisons between fragrant and non-fragrant rice reveal that the 2-AP content in fragrant rice is at least 15 times higher than in non-fragrant rice. Badh2, a homolog of betaine aldehyde dehydrogenase in rice, is a gene associated with aroma. In some fragrant rice varieties, an 8bp deletion in exon 7 of this gene leads to the accumulation of 2-AP, resulting in aroma. Large-scale rice genome sequencing provides a foundation for identifying new genes using genome-wide association studies (GWAS). Our analysis of whole-genome sequencing data from local rice varieties revealed a new gene, ODC, that regulates rice aroma. This gene encodes ornithine decarboxylase. In some strongly aromatic rice varieties, a 22bp deletion in the coding region of this gene results in loss of function, leading to increased aroma.
[0004] Genome editing technology is a genetic manipulation technique that targets and modifies DNA sequences at the genome level. The CRISPR / Cas9 system is a gene editing technology system that has emerged in recent years. This system uses non-coding RNA to recognize target sites, anchoring the target gene through the interaction between RNA and DNA. The resulting complex of non-coding RNA and Cas protein then cleaves the corresponding gene site. Currently, the CRISPR / Cas9 system, as a novel gene-targeting editing tool, is simple in structure, low in cost, fast, and efficient, and has been widely used in crop gene editing. With the rapid development of gene editing technology, CRISPR / Cas9 technology has made significant progress in rice gene function research. Editing the rice genome using CRISPR / Cas9 technology to alter various agronomic traits of rice is no longer an insurmountable technical obstacle. In the past few decades, traditional mutant screening and molecular-assisted breeding have made significant contributions to rice production. However, rice production currently faces many new challenges, such as rapid population growth, global climate change, and the resulting new pests, diseases, and other environmental problems. Therefore, there is an urgent need for more advanced technologies and methods to create new rice varieties with higher yields and better quality. Thus, we utilize gene editing or hybridization techniques to edit new aroma-regulating genes (ODCs) to obtain some new aromatic rice germplasm. Summary of the Invention
[0005] Objective of the Invention: This invention unexpectedly discovers that the deletion of the ODC gene can lead to the production of aromatic rice. The ODC gene controls the aroma of rice; it encodes ornithine decarboxylase. Deletion of this gene sequence results in the loss of function of the encoded protein, which in turn produces the aroma of the rice. Based on this idea, one technical problem this invention aims to solve is to obtain aromatic rice by deleting the ODC gene through gene editing. Another technical problem this invention aims to solve is to obtain aromatic rice by hybridizing ODC-deleted rice varieties with aromatic rice varieties.
[0006] The final technical problem to be solved by this invention is to obtain a molecular marker that can identify ODC gene deletions, thereby enabling the identification of aromatic rice varieties.
[0007] Technical Solution: To solve the above technical problems, the present invention adopts the following technical solution: A method for obtaining aromatic rice, the method comprising: downregulating the expression or activity of ornithine decarboxylase in rice, wherein the nucleotide sequence of ornithine decarboxylase is shown in SEQ ID NO: 25.
[0008] The methods for downregulating the expression or activity of ornithine decarboxylase in rice include: knocking out or silencing the ODC gene in the rice genome; or transferring a downregulator of ODC gene transcription, polypeptide expression or polypeptide activity into rice; or hybridizing ODC-deficient rice varieties with aromatic rice varieties.
[0009] The downregulator is an interfering molecule that specifically interferes with the expression of the ODC gene. The interfering molecule is a dsRNA, antisense nucleic acid, small interfering RNA, microRNA, or sgRNA that inhibits or silences the ODC gene or its transcripts, or a construct that can express or form the dsRNA, antisense nucleic acid, small interfering RNA, or microRNA.
[0010] The nucleotide sequence of the downregulated rice ODC gene is shown in SEQ ID NO.1 or SEQ ID NO.3, and the amino acid sequence of the downregulated rice ornithine decarboxylase is shown in SEQ ID NO.2 or SEQ ID NO.4.
[0011] The present invention also includes a method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology. The method involves designing a target sequence for editing the sgRNA recognition site of the ODC gene, constructing a CRISPR / Cas9-ODC gene editing vector, and transforming the vector into rice to obtain aromatic rice.
[0012] The target sequence of the sgRNA recognition site is 5'-tgttcgcggcgtggtggcgc-3' (SEQ ID NO.5) or 5'-cgccgagcagcgccgggttg-3' (SEQ ID NO.6).
[0013] The method for constructing the CRISPR / Cas9-ODC gene editing vector is as follows:
[0014] (a) Preparation of target adapters: The adapter primer pairs ODC Spacer1 F and ODC Spacer1 R were mixed, denatured at high temperature, and then annealed to obtain the target adapter ODC spacer1; similarly, the adapter primer pairs ODC Spacer2 F and ODC Spacer2 R were mixed, denatured at high temperature, and then annealed to obtain the target adapter ODC spacer2.
[0015] (b) Preparation of sgRNA ligation products: sgRNA1 ligation products were obtained by ligation reaction using pYLsgRNA-OsU3 intermediate vector, target adapter ODC spacer1, DNA ligase, and BsaI; the target adapter ODC spacer2 was ligated using the same method to obtain sgRNA2 ligation products.
[0016] (c) Amplification of sgRNA expression cassette: The sgRNA1 ligation product was amplified by first-round PCR using primer pair 1 and primer pair 2 to obtain first-round PCR product 1 and first-round PCR product 2, respectively. Then, a second-round PCR was performed using amplification primer pair 1 to obtain first-round PCR product 1 and first-round PCR product 2. The obtained PCR product is the sgRNA1 expression cassette. The sgRNA2 ligation product was amplified by first-round PCR using the same method to obtain first-round PCR product 3 and first-round PCR product 4. Then, a second-round PCR was performed using amplification primer pair 2 to obtain first-round PCR product 3 and first-round PCR product 4. The obtained PCR product is the sgRNA2 expression cassette.
[0017] (d) Ligate the sgRNA1 expression cassette and the sgRNA2 expression cassette to the CRISPR / Cas9 expression vector to obtain the ligation product;
[0018] (e) The ligation product from step (d) is heat-transformed into Escherichia coli to obtain recombinant bacteria, and a positive plasmid containing the target band is extracted.
[0019] The adapter primer pair used in step (a) includes ODC Spacer F1 and ODC Spacer R1; or ODC Spacer F2 and ODC Spacer R2, and the specific adapter primer pair sequences are as follows:
[0020] ODC Spacer F1: GGCAtgttcgcggcgtggtggcgc; SEQ ID NO.7
[0021] ODC Spacer R1: AAACgcgccaccacgccgcgaaca; SEQ ID NO.8
[0022] ODC Spacer F2: GTTGcgccgagcagcgccgggttg; SEQ ID NO.9
[0023] ODC Spacer R2: AAACcaacccggcgctgctcggcg; SEQ ID NO.10
[0024] Wherein, the primer combination 1 used in step (c) is the forward primer CTCCGTTTTACCTGTGGAATCG (SEQ ID NO. 11) and the reverse primer of the target sequence 1 adapter: AAACgcgccaccacgccgcgaaca (SEQ ID NO. 8) or the reverse primer of the target sequence 2: AAACcaacccggcgctgctcggcg (SEQ ID NO. 10), and the primer combination 2 is the reverse primer: CGGAGGAAAATTCCATCCAC (SEQ ID NO. 12) and the forward primer of the target sequence 1 adapter: GGCAtgttcgcggcgtggtggcgc (SEQ ID NO. 7) or the forward primer of the target sequence 2 adapter: GTTGcgccgagcagcgccgggttg (SEQ ID NO. 9);
[0025] Wherein, in step (c), the amplification primer pair 1 is Uctcg-B1' and gRcggt-B2, and the amplification primer pair 2 is Uctcg-B2' and gRcggt-BL;
[0026] Uctcg-B1':TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG (SEQ ID NO.13)
[0027] gRcggt-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC (SEQ ID NO.14)
[0028] Uctcg-B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG (SEQ ID NO.15)
[0029] gRcggt-BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC; (SEQ ID NO. 16)
[0030] The method includes transferring the obtained CRISPR / Cas9 gene editing vector containing the target band into Agrobacterium EHA105, transforming rice (Suijing 18 rice) to obtain T0 generation transgenic plants, and using amplification primer pairs to amplify and sequence three pairs of T0 generation transgenic plants to obtain plants with ODC deletion mutations.
[0031] Among them, the amplification primer pair 3 is 5'-CAGAAGCAGAAATCCATGGCAG-3' (SEQ ID NO.17) and 5'-TGGTTCCCAAGTTTAGCATGGC-3' (SEQ ID NO.18).
[0032] The method further includes the removal of the T-DNA vector from the T0 generation transgenic plants containing the ODC gene mutation and the T1 generation plants after self-pollination. The T-DNA vector includes the hygromycin phosphotransferase gene HPT, the nuclease gene Cas9, and the sgRNA encoding gene.
[0033] The T-DNA vector knockout process involves simultaneously detecting the HPT, Cas9, and sgRNA encoding genes of T1 generation plants containing ODC gene mutations, repeating the process multiple times, and selecting T1 generation single plants that do not carry these three genes as the target plants.
[0034] The HPT gene detection method uses genomic DNA from T1 generation plants with ODC gene mutation as a template and performs PCR amplification with primers 35S-NTF1 and HYG-TR2. Meanwhile, the Cas9 gene detection method uses genomic DNA from T1 generation plants with ODC gene mutation as a template and performs PCR amplification with primers UBI-F1-NEW and CL-R2-NEW. When neither HPT gene nor Cas9 gene is detected simultaneously, it indicates that T-DNA has been successfully knocked out.
[0035] Among them, the primers are 35S-NTF1: 5'-ACAATCCCACTATCCTTCGCAAG-3' (SEQ ID NO.19), HYG-TR2: 5'-GTACTTCTACACAGCCATCGGTC-3' (SEQ ID NO.20), UBI-F1-NEW: 5'-tttccccaacctcgtgttgttc-3' (SEQ ID NO.21), CL-R2-NEW: 5'-gaggttcttcttgatggagtgg-3' (SEQ ID NO.22), ODC-F2: 5'-CAGAAGCAGAAATCCATGGCAG' (SEQ ID NO.17), and ODC-R3: 5'-TGGTTCCCAAGTTTAGCATGGC-3' (SEQ ID NO.18).
[0036] As one embodiment of the present invention, the present invention also provides a method for rapidly obtaining aromatic rice using gene editing CRISPR / Cas9 technology. The method involves designing a target sequence for editing the sgRNA recognition site of the ODC gene, constructing a CRISPR / Cas9-ODC gene editing vector, and transforming the vector into rice to obtain aromatic rice without T-DNA.
[0037] As one embodiment of the present invention, the present invention also provides molecular markers for identifying ODC deletion, the molecular markers being ODC-M1F and / or ODC-M1R, wherein the base sequence of ODC-M1F is 5'-TTACCGGACTCGTGCGGACCAT-3' (SEQ ID NO.23), and the base sequence of ODC-M1R is 5'-ATCTTGCCGACCTCCTCCTCG-3' (SEQ ID NO.24).
[0038] The present invention also includes the application of the molecular markers for identifying ODC deficiency in the identification of aromatic rice varieties.
[0039] In the method of hybridizing ODC-deficient rice varieties with aromatic rice varieties, the ODC-deficient rice variety is an ODC gene-edited plant, and the aromatic rice variety is a Badh2-deficient rice variety.
[0040] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0041] 1) This invention is the first to discover a novel gene ODC that controls the aroma of rice. This gene encodes ornithine decarboxylase. The deletion of this gene sequence can lead to loss of function, thereby producing aroma in rice.
[0042] 2) This invention presents a method for rapidly obtaining aromatic rice using CRISPR / Cas9 gene editing technology. This method is simple, easy to operate, convenient, and fast, and can quickly obtain aromatic rice without T-DNA.
[0043] 3) The gene-edited Suijing 18 rice with ODC mutation obtained in this invention has a 1-fold increase in the content of the aroma substance 2-AP compared with the Suijing 18 rice without mutation. Attached Figure Description
[0044] Figure 1 This is a schematic diagram of the gene structure and target sequence of ODC;
[0045] Figure 2 To identify aromatic rice using molecular markers for ODC;
[0046] Figure 3PCR identification of ODC gene in T1 generation gene-edited plants;
[0047] Figure 4 PCR identification of the Hpt gene in T1 generation gene-edited plants;
[0048] Figure 5 PCR identification of the Cas9 gene in T1 generation gene-edited plants;
[0049] Figure 6 Comparison of nucleotide sequences of ODC gene-edited rice with wild-type rice;
[0050] Figure 7 Comparison of the content of 2-AP, an aroma compound, in ODC gene-edited rice.
[0051] Figure 8 Nucleotide sequence alignment of ODCs of Nanjing 46 and Erxiang;
[0052] Figure 9 Identification of ODC molecular markers in the F2 population of the Nanjing 46 and Erxiang assemblages;
[0053] Figure 10 Determination of 2-AP content in the F2 population of Nanjing 46 and Erxiang combination. Detailed Implementation
[0054] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0055] Example 1: Obtaining the full-length ODC gene of wild-type rice
[0056] Genomic DNA was extracted from Suijing 18, a common japonica rice seed, using conventional methods. The Suijing 18 seed was obtained from the germplasm resource platform of the Jiangsu Academy of Agricultural Sciences. Primers were designed based on the ODC gene (NCBI: XR_001543149) in the NCBI reference genome for amplification. The ODC gene was amplified using Takara PrimerSTAR Max DNA Polymerase (purchased from Takara). The reaction system is as follows:
[0057]
[0058] The PCR amplification reaction procedure uses a two-step method, combining annealing and extension at 68 degrees Celsius.
[0059] The procedure is as follows: Pre-denaturation: 98℃ for 3 min; 35 cycles: denaturation at 98℃ for 10 sec; extension at 68℃ for 1 min; holding at 72℃ for 10 min.
[0060] 2 μL of PCR product was analyzed by 1% agarose gel electrophoresis. Once the expected size fragment was detected... Figure 3 The remaining PCR products were cleaned and recovered using a PCR cleaning kit (Axygen), cloned into the pMD19-T vector (Takara), and then transformed into *E. coli* DH5α. For each transformation, 12 *E. coli* clones were randomly selected for PCR testing. Six clones with positive PCR results were sent to Nanjing Yidao Biotechnology Co., Ltd. for sequencing to obtain the ODC gene sequence. The gene fragment is 1374 bp in length. The sequencing results of the ODC gene fragment of *Suijing 18* are as follows: (SEQ ID NO.25)
[0061]
[0062] Example 2: Development of ODC-based aroma molecule markers
[0063] Molecular markers ODC-M1F and ODC-M1R were designed based on the ODC-deleted sequence. The base sequence of the molecular marker ODC-M1F is 5'-TTACCGGACTCGTGCGGACCAT-3' (SEQ ID NO.23), and the base sequence of the molecular marker ODC-M1R is 5'-ATCTTGCCGACCTCCTCCTCG-3' (SEQ ID NO.24).
[0064] The PCR reaction system is as follows:
[0065]
[0066]
[0067] The PCR reaction program was as follows: 95℃ for 10 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 28 cycles; 72℃ for 5 min.
[0068] Molecular identification was performed on the fragrant rice variety (Erxiang, China Rice Germplasm Bank, Hangzhou, China). After amplifying the ODC-free variety Nipponbare, the DNA fragment length was 385 bp. When amplifying the variety containing the ODC deletion, the DNA fragment length was 363 bp. Figure 2 As indicated by the arrows, lane 1 is for the cultivar Nika, which lacks ODC, and lane 2 is for the cultivar Nipponbare, which has no fragrance and does not lack ODC.
[0069] Example 3: Obtaining ODC gene editing materials
[0070] 1. Based on the recognition characteristics of CRISPR / Cas9 target sites, the 221-240bp region of the CDS region of the ODC gene (sequence 5'-tgttcgcggcgtggtggcgc-3') was selected as target sequence 1, and the 285-304bp region was selected as target sequence 2 (sequence 5'-cgccgagcagcgccgggttg-3'). The adapter primers are as follows:
[0071] ODC Spacer1 F: GGCAtgttcgcggcgtggtggcgc;
[0072] ODC Spacer1 R:AAACgcgccaccacgccgcgaaca;
[0073] ODC Spacer2 F:GTTGcgccgagcagcgccgggttg;
[0074] ODC Spacer2 R:AAACcaacccggcgctgctcggcg;
[0075] The target sequence is driven by the OsU3 promoter.
[0076] 2. Construction of pYLCRISPR / Cas9-ODC gene editing vector
[0077] The gene editing vector was constructed according to Ma et al. (2016), Mol Plant. 9(7): 961-74. The specific steps are as follows:
[0078] (1) Target connector preparation
[0079] 10 μL of each of the target sequence adapter primers (ODC Spacer1 F and ODC Spacer1 R, ODC Spacer2 F and ODC Spacer2 R) were mixed and denatured at 90 °C for 30 s, followed by slow annealing at a rate of 0.1 °C / min to prepare the adapter fragments of target sequence 1 and target sequence 2: ODC spacer1 and ODC Spacer2, respectively.
[0080] (2) Preparation of sgRNA expression cassette
[0081] The connection reaction is carried out according to the following reaction system:
[0082]
[0083]
[0084] After mixing, the mixture was incubated at 37°C for 5 min and at 20°C for 5 min for 5 cycles to obtain template 1 for preparing the sgRNA1 expression cassette and template 2 for preparing the sgRNA2 expression cassette.
[0085] pYLsgRNA-OsU3a is an intermediate vector that serves as the promoter and guide sequence backbone for the sgRNA expression cassette. It was developed by the team of Academician Liu Yaoguang of South China Agricultural University, referring to Ma et al. (2016), Mol Plant. 9(7): 961-74.
[0086] (3) Amplification of sgRNA expression cassette
[0087] (a) First round of amplification:
[0088] Using primer combination 1: forward primer: CTCCGTTTTACCTGTGGAATCG and target sequence 1 adapter reverse primer: AAACgcgccaccacgccgcgaaca or target sequence 2 reverse primer: AAACcaacccggcgctgctcggcg, perform PCR amplification according to the following reaction system:
[0089]
[0090] The PCR reaction program was as follows: 94℃ for 1 min; 98℃ for 10 s, 60℃ for 15 s, 68℃ for 20 s, for 28 cycles; to obtain product 1 for preparing the Spacer1 expression cassette or product 3 for preparing the Spacer2 expression cassette, which can be used directly for subsequent experiments or stored at -20℃.
[0091] Using primer combination 2: reverse primer: CGGAGGAAAATTCCATCCAC and target sequence 1 adapter forward primer: GGCAtgttcgcggcgtggtggcgc or target sequence 2 adapter forward primer: GTTGcgccgagcagcgccgggttg, perform PCR amplification according to the following reaction system:
[0092]
[0093] The PCR reaction program was as follows: 94℃ for 1 min; 98℃ for 10 s, 60℃ for 15 s, 68℃ for 20 s, for 28 cycles; to obtain product 2 for preparing Spacer 1 expression cassette or product 4 for preparing Spacer 2 expression cassette, which can be used directly for subsequent experiments or stored at -20℃.
[0094] (b) Second round of amplification: Using Uctcg-B1' and gRcggt-B2 as amplification primers, a second round of PCR was performed on products 1 and 2 obtained from the first round of PCR to obtain the Spacer1 expression cassette; using Uctcg-B2' and gRcggt-BL as amplification primers, a second round of PCR was performed on products 3 and 4 obtained from the first round of PCR to obtain the Spacer2 expression cassette;
[0095]
[0096] The PCR reaction program was as follows: 94℃ for 2 min; 98℃ for 10 s, 58℃ for 15 s, 68℃ for 20 s, for 25 cycles; the obtained Spacer1 expression cassette or Spacer2 expression cassette could be used directly for subsequent experiments or stored at -20℃.
[0097] Uctcg-B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG
[0098] gRcggt-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC
[0099] Uctcg-B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG
[0100] gRcggt-BL: AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC
[0101] (4) sgRNA expression cassette ligation
[0102] Perform sgRNA expression cassette ligation according to the following reaction system.
[0103]
[0104] After mixing, incubate at 37°C for 10 min, then add 0.5 μL T4 buffer and 0.1 μL T4 enzyme, incubate at 37°C for 2 min; incubate at 10°C for 3 min, incubate at 20°C for 5 min, repeat 15 cycles, incubate at 37°C for 2 min.
[0105] (5) E. coli transformation and validation
[0106] The ligation product was transformed into *E. coli* DH5α using the heat shock method. The bacterial suspension was plated on LB agar plates containing 50 mg / L kanamycin and incubated for 12 h. Single colonies that grew on the plates were picked and propagated by shaking. PCR verification was performed using the bacterial suspension as a template.
[0107] The PCR reaction system is as follows:
[0108]
[0109] The PCR reaction program was as follows: 95℃ for 10 min; 95℃ for 30 s, 51℃ for 30 s, 72℃ for 45 s, 28 cycles; 72℃ for 5 min. The amplified products were recorded by agarose gel electrophoresis. Bacterial cultures containing the target band were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with expectations, and the final plant expression vector plasmid CRISPR / Cas9-ODC was obtained.
[0110] (6) Obtaining T0 generation ODC gene-edited plants
[0111] The CRISPR / Cas9-ODC plasmid was transformed into Agrobacterium strain EHA105. The rice variety Suijing 18 was then transformed using the Agrobacterium-mediated transformation method.
[0112] Example 4: Obtaining plants without T-DNA insertion and analyzing ODC gene knockout
[0113] T0 generation genome-edited plants of Suijing 18 were grown in an incubator, self-pollinated, and seeds were harvested. After the seeds broke dormancy, they were soaked, sown in seedling trays, and placed in a culture room. When the seedlings grew to two leaves and one bud, genomic DNA was extracted from each plant using the CTAB method. The detection was performed using primers encoding the Hpt gene (35S-NTF1: 5'-ACAATCCCACTATCCTTCGCAAG-3', HYG-TR2: 5'-GTACTTCTACACAGCCATCGGTC-3'), primers encoding the Cas9 nuclease (UBI-F1-NEW: 5'-tttccccaacctcgtgttgttc-3', CL-R2-NEW: 5'-gaggttcttcttgatggagtgg-3'), and primers encoding the sgRNA gene (ODC-F2: 5'-CAGAAGCAGAAATCCATGGCAG-3', ODC-R3: 5'-TGGTTCCCAAGTTTAGCATGGC-3').
[0114] The PCR reaction system consisted of 2.6 μL of sterile water, 2.0 μL of primers (10 pM), 1.0 μL each of the front and back primers, 1.0 μL of diluted DNA template, 0.4 μL of DNA polymerase, 10 μL of dedicated buffer, and 4 μL of dNTPs.
[0115] The PCR reaction conditions were: 96℃ pre-denaturation for 3 min; 98℃ denaturation for 100 sec, 60℃ annealing for 30 sec, 68℃ extension for 30 sec, for 32 cycles; and a final extension at 68℃ for 5 min.
[0116] PCR reactions were performed using an Eppendorf Mastercycle thermal cycler. Amplification products were separated by agarose gel electrophoresis, photographed using a gel imaging system, and the results were recorded. Amplification results for the ODC gene, Hpt gene, and Cas9 gene are shown below. Figure 3 , Figure 4 and Figure 5 .
[0117] The above test results indicate that Figure 4 and Figure 5 Lanes 1, 2, 4, 5, 6, 8, 10, 11, 12, 14, and 15 do not carry T-DNA. The individual strains corresponding to these lanes are numbered FL-1 to FL-10.
[0118] To further determine the base mutation status of the ODC gene in FL-1 to FL-10, specific primers were used to detect the target sites: ODC-F2 (5'-CAGAAGCAGAAATCCATGGCAG-3') and ODC-R3 (5'-TGGTTCCCAAGTTTAGCATGGC-3'). Amplification was then performed, followed by sequencing analysis. The results showed that, compared to wild-type ODC, the ODC gene sequences of FL-1 to FL-6 had one more bp in ODC spacer1 and one less bp in ODC spacer2. The nucleotide sequences are shown in SEQ ID NO.1, and the amino acid sequences are shown in SEQ ID NO.2. Similarly, the ODC gene sequences of FL-7 to FL-10 had one less bp in ODC spacer1 and one less bp in ODC spacer2 compared to wild-type ODC. The nucleotide sequences are shown in SEQ ID NO.3, and the amino acid sequences are shown in SEQ ID NO.4.
[0119] Example 5: Aroma determination of ODC mutant plants
[0120] To determine the aroma of ODC mutant plants, the aroma compound 2-AP was analyzed using GC-MS. Rice seeds of Suijing 18 and ODC gene-edited plants FL-1 and FL-7 were dehulled and ground into powder. 0.25 g of powder was placed in a 1.5 ml mass spectrometry bottle, and 1 ml of a mixture (1.7 μL trimethylpyridine TMP, 200 ml anhydrous ethanol, and 200 ml dichloromethane) was added. The bottle was sealed with sealing film and plastic wrap, and incubated in an 80℃ water bath for 3 hours. The supernatant was collected, centrifuged at 12000 rpm for 5 minutes, and filtered through a syringe and filter membrane. 2 μL of the supernatant was added to an internal tube for GC-MS analysis. The following formula was used for calculation:
[0121] 2-AP content = (2-AP peak area × TMP content) / TMP peak area
[0122] TMP: 2,4,6-Trimethylpyridine; 2-AP: 2-Acetyl-1-pyrrolidine
[0123] like Figure 7 As shown, using wild-type Suijing 18 as a control, we compared ODC gene-edited plants FL-1 and FL-7 and found that the 2-AP content of ODC gene-edited plants was much higher than that of wild-type plants.
[0124] Example 6: Aroma analysis of offspring from crosses between varieties with Badh2 deletion and ODC deletion
[0125] The variety Nanjing 46, which contains Badh2 deficiency, was crossed with the variety Erxiang, which lacks ODC. The ODC deficiency status of Erxiang is as follows: Figure 8 As shown, molecular identification of F2 progeny was performed using ODC-M1F and ODC-M1R molecular markers. Figure 9 Individuals with only Badh2 deficiency (S1), only ODC deficiency (S2), and both Badh2 and ODC deficiency (S3) were identified. The 2-AP content of these individuals was measured. The highest 2-AP content was found in individuals with both Badh2 and ODC deficiency (S3), followed by individuals with Badh2 deficiency (S1), and the lowest was found in individuals with ODC deficiency (S2). Figure 10 ).
Claims
1. A method for obtaining aromatic rice, characterized in that, The method includes: downregulating the expression or activity of ornithine decarboxylase in rice, wherein the nucleotide sequence of the gene encoding the ornithine decarboxylase is shown in SEQ ID NO:
25.
2. The method according to claim 1, characterized in that, The method for downregulating the expression or activity of ornithine decarboxylase in rice includes: knocking out or silencing it in the rice genome. ODC Genes; or may be downregulated ODC Downregulators of gene transcription, peptide expression, or peptide activity are transferred into rice, or... ODC The missing rice variety was hybridized with a fragrant rice variety, and the downregulator was a specific interfering agent. ODC Interfering molecules in gene expression, wherein the interfering molecules are inhibitors or silencers. ODC The dsRNA, antisense nucleic acid, small interfering RNA, or microRNA of a gene or its transcript, or a construct that can express or form the dsRNA, antisense nucleic acid, small interfering RNA, or microRNA.
3. The method according to claim 2, characterized in that, The use ODC In the method of hybridizing a missing rice variety with a fragrant rice variety, the fragrant rice variety is... Badh2 Missing rice varieties.
4. The method according to claim 1, characterized in that, The rice after the adjustment ODC The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.3, and the amino acid sequence of the downregulated rice ornithine decarboxylase is shown in SEQ ID NO.2 or SEQ ID NO.
4.
5. A method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology, characterized in that, The method described is designed for editing. ODC The target sequence of the sgRNA recognition site of the gene was identified, and a CRISPR / Cas9-ODC gene editing vector was constructed from it. This vector was then transformed into rice to obtain aromatic rice. ODC The nucleotide sequence of the gene is shown in SEQ ID NO:
25.
6. The method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology according to claim 5, characterized in that, The target sequence of the sgRNA recognition site is shown in SEQ ID NO.5 or SEQ ID NO.
6.
7. The method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology according to claim 5, wherein the CRISPR / Cas9-ODC gene editing vector is constructed as follows: (a) Preparation of target adapters: The adapter primer pairs ODC Spacer1 F and ODC Spacer1 R were mixed, denatured at high temperature, and then annealed to obtain the target adapter ODC spacer1; similarly, the adapter primer pairs ODC Spacer2 F and ODC Spacer2 R were mixed, denatured at high temperature, and then annealed to obtain the target adapter ODC spacer2. ODC Spacer1 F: GGCAtgttcgcggcgtggtggcgc; ODC Spacer1 R:AAACgcgccaccacgccgcgaaca; ODC Spacer2 F:GTTGcgccgagcagcgccgggttg; ODC Spacer2 R:AAACcaacccggcgctgctcggcg; (b) Preparation of sgRNA ligation products: sgRNA1 ligation products were obtained by ligation reaction using pYLsgRNA-OsU3 intermediate vector, target adapter ODC spacer1, DNA ligase, and BsaI; the target adapter ODC spacer2 was ligated using the same method to obtain sgRNA2 ligation products. (c) Amplification of sgRNA expression cassette: The sgRNA1 ligation product was amplified by first-round PCR using primer pair 1 and primer pair 2 to obtain first-round PCR product 1 and first-round PCR product 2, respectively. Then, a second-round PCR was performed using amplification primer pair 1 to obtain first-round PCR product 1 and first-round PCR product 2. The obtained PCR product is the sgRNA1 expression cassette. The sgRNA2 ligation product was amplified by first-round PCR using the same method to obtain first-round PCR product 3 and first-round PCR product 4. Then, a second-round PCR was performed using amplification primer pair 2 to obtain first-round PCR product 3 and first-round PCR product 4. The obtained PCR product is the sgRNA2 expression cassette. Primer combination 1: Forward primer: CTCCGTTTTACCTGTGGAATCG and target sequence 1 adapter reverse primer: AAACgcgccaccacgccgcgaaca or target sequence 2 reverse primer: AAACcaacccggcgctgctcggcg; Primer combination 2: Reverse primer: CGGAGGAAAATTCCATCCAC and target sequence 1 adapter forward primer: GGCAtgttcgcggcgtggtggcgc or target sequence 2 adapter forward primer: GTTGcgccgagcagcgccgggttg, Amplification primer pair 1 is Uctcg-B1' and gRcggt-B2, and amplification primer pair 2 is Uctcg-B2' and gRcggt-BL. Uctcg-B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG, gRcggt-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC; Uctcg-B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG, gRcggt-BL: AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC; (d) Ligate the sgRNA1 expression cassette and the sgRNA2 expression cassette to the CRISPR / Cas9 expression vector to obtain the ligation product; (e) The ligation product from step (d) is heat-transformed into Escherichia coli to obtain recombinant bacteria, and positive plasmids containing the target band are extracted.
8. The method for rapidly obtaining aromatic rice based on CRISPR / Cas9 technology according to claim 5, characterized in that, The method includes transferring the CRISPR / Cas9-ODC gene editing vector into Agrobacterium EHA105, transforming rice to obtain T0 generation transgenic plants, and amplifying and sequencing three pairs of T0 generation transgenic plants using amplification primers to identify them. ODC For plants with deletion mutations, the amplification primer pair 3 is shown in SEQ ID NO.17 and SEQ ID NO.
18.
9. Identification of rice ODC The primer pair for gene deletion is ODC-M1F and ODC-M1R, the base sequence of ODC-M1F is shown in SEQ ID NO.23, and the base sequence of ODC-M1R is shown in SEQ ID NO.24.
Citation Information
Patent Citations
Application of transcription factor OsEPR1 as negative regulatory factor in increasing content of volatile metabolites in rice
CN119685394A