Use of gjb5 in cancer prevention, treatment, diagnosis and assessment

Abstract

The application discloses application of GJB5 in cancer prevention, treatment, diagnosis and evaluation. GJB5 gene is significantly highly expressed in various cancers such as pancreatic cancer and early pathological structures thereof, can be used for early diagnosis of pancreatic cancer and the like, and has the advantages of high specificity and sensitivity; the highly expressed GJB5 gene is closely related to poor prognosis, distant metastasis and lymph node metastasis of adenocarcinoma, which indicates that the GJB5 gene can be used as a prognostic marker to provide effective information for metastasis diagnosis and prognosis evaluation of pancreatic cancer and the like. The application discloses an expression inhibitor / overexpression plasmid of the GJB5 gene, including siRNA / PC-GJB5, the siRNA has a good interference effect on the expression of the GJB5 gene, mainly reflected in reducing the survival ability of cancer cells, and has the application potential of clinical gene therapy. Therefore, targeted inhibition of GJB5 represents a new early diagnosis and treatment strategy and scheme of malignant tumors.

Description

[0001] Technology Neighborhood

[0002] This invention relates to the field of tumor molecular biology, specifically to the application of GJB5 in cancer prevention, treatment, diagnosis, and assessment. Technical Background

[0003] Pancreatic cancer is a common malignant tumor of the digestive tract. In my country, the incidence rate is 0.33-0.44 per 1,000, slightly lower than the global average of 0.49 per 1,000. However, overall, the incidence rate is still on the rise. Unlike most cancers, the incidence rate of pancreatic cancer is roughly equal to its mortality rate, with a 5-year survival rate of less than 10%. Furthermore, pancreatic cancer is characterized by difficulties in early diagnosis, high malignancy, and low survival rates. Rapid disease progression due to metastasis is a significant reason for its poor survival and prognosis. Therefore, pancreatic cancer is known as the "king of cancers" in the field of oncology, and effective prevention and control of its occurrence and development are urgently needed. Clinically, pancreatic cancer is mainly classified into four types based on whether metastasis has occurred. Stage I pancreatic cancer is confined to the tumor itself, and the diameter of the primary tumor is generally <4cm, with a relatively good treatment outcome. Stage II is divided into two situations: the tumor lesion diameter is >4cm, but there is no invasion or metastasis; the other is the tumor diameter is <4cm, but lymph node metastasis has occurred. Neither stage invades surrounding blood vessels. Stage III pancreatic cancer does not metastasize to distant sites such as the lungs, liver, or brain, but lymph node metastasis occurs or important blood vessels such as the common hepatic artery are invaded. Stage IV: distant metastasis occurs, the treatment outcome is poor, and surgical removal of all pancreatic malignant tumor cells is the only potentially curative method. Pancreatic cancer patients have an insidious onset and atypical early clinical symptoms, which may manifest as abdominal discomfort or pain, jaundice, symptoms related to diabetes, indigestion or diarrhea, etc., which are easily confused with the symptoms of other digestive system diseases. Some patients have early onset but no discomfort, and by the time obvious symptoms appear, it is already in the middle or late stage. Currently, it is believed that early screening and control can significantly reduce the mortality rate of pancreatic cancer.

[0004] The main methods for diagnosing pancreatic cancer are imaging examinations, blood tests, and pathological biopsy. Imaging examinations can provide a preliminary assessment of the abdominal organs and determine the possibility of pancreatic cancer. Ultrasound and enhanced CT scans are commonly used to detect any space-occupying lesions in the pancreas. However, because the pancreas is located in the dorsal part of the abdomen, small tumors are easily overlooked. Blood tests can monitor blood glucose levels and assess liver and kidney function as well as the patient's overall health. Additionally, testing for blood tumor markers, such as CA199, and monitoring changes in carbohydrate antigens and carcinoembryonic antigens, can help determine the likelihood of pancreatic cancer. However, this method is not very useful for early-stage pancreatic cancer that has not yet invaded or metastasized. The most accurate method is pathological biopsy, primarily using a needle biopsy. A common method is endoscopic ultrasound-guided biopsy, where an endoscope is inserted into the stomach to locate the pancreatic lesion, and a fine needle is used to obtain a biopsy for definitive diagnosis. However, this method is painful for the patient and causes irreversible damage to the organs, potentially leading to secondary complications. Therefore, discovering a tumor marker with higher sensitivity and specificity for the early diagnosis of pancreatic cancer is particularly important for the prevention and treatment of pancreatic cancer.

[0005] Deqiang Zhang discovered that GJB5 inhibits the growth, migration, invasion, and cell cycle of non-small cell lung cancer cells in vitro; in vivo, GJB5 can inhibit the growth of xenograft tumors in nude mice. Therefore, it is believed that GJB5 acts as a tumor suppressor gene in non-small cell lung cancer [PMID: 21777377]. This study shows that GJB5 affects tumor growth, migration, invasion, and cell cycle. However, there are currently no reports on GJB5 in pancreatic cancer. Therefore, the role of GJB5 in pancreatic cancer remains unclear. The results of this study show that the role of GJB5 in pancreatic cancer is the opposite of its role in lung cancer: it acts as a tumor-promoting factor in pancreatic cancer, that is, it promotes the progression of pancreatic cancer. Summary of the Invention

[0006] The technical problem this invention aims to solve is that existing molecular markers for diagnosing early pancreatic cancer suffer from low sensitivity and specificity, easily delaying diagnosis. This invention provides a highly specific and sensitive molecular marker related to pancreatic cancer for early diagnosis. Another objective of this invention is to address the poor efficacy of current malignant tumor treatments by providing an efficient approach to inhibit the proliferation and migration of malignant tumors, thus contributing to the treatment of pancreatic cancer.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] A first aspect of the present invention provides the use of GJB5 inhibitors in the preparation of drugs for preventing cancer, treating cancer, and / or treating inflammation.

[0009] Furthermore, the GJB5 inhibitor is selected from siRNAs that target GJB5.

[0010] Furthermore, the siRNA targeting GJB5 is an oligonucleotide Si-GJB5-1, Si-GJB5-2 and / or Si-GJB5-3;

[0011] The Si-GJB5-1 is composed of double-stranded nucleic acid molecules 1 and 2. Nucleic acid molecule 1 is composed of a positive strand RNA molecule as shown in SEQ ID NO.1 and two dT molecules located at the 3' end. Nucleic acid molecule 2 is composed of an antisense strand RNA molecule as shown in SEQ ID NO.2 and two dT molecules located at the 3' end.

[0012] The Si-GJB5-2 is composed of double-stranded nucleic acid molecules 3 and 4. The nucleic acid molecule 3 is composed of a sense strand RNA molecule as shown in SEQ ID NO.3 and two dT molecules, with the two dT molecules located at the 3' end. The nucleic acid molecule 4 is composed of an antisense strand RNA molecule as shown in SEQ ID NO.4 and dGdC molecules, with the dGdC molecules located at the 3' end.

[0013] Si-GJB5-3 is composed of double-stranded nucleic acid molecules 5 and 6. Nucleic acid molecule 5 consists of a positive strand RNA molecule as shown in SEQ ID NO.5 and two dT molecules located at the 3' end. Nucleic acid molecule 6 consists of an antisense strand RNA molecule as shown in SEQ ID NO.6 and dAdC molecules located at the 3' end.

[0014] Furthermore, the GJB5 inhibitor can effectively promote apoptosis of pancreatic cancer cells and inhibit the proliferation, migration, and cell cycle of pancreatic cancer cells.

[0015] Furthermore, the cancer mentioned is pancreatic cancer.

[0016] Furthermore, the cancers mentioned also include at least one of skin cancer, lung cancer, breast cancer, esophageal cancer, head and neck squamous cell carcinoma, cervical cancer, and prostate cancer.

[0017] Furthermore, the inflammation is pancreatitis.

[0018] GJB5 is highly expressed in pancreatic cancer cell lines and pancreatic cancer tissues, as well as in pancreatitis stimulated by inflammatory substances and in early pancreatic injury tissues (ADM and PanIN).

[0019] A second aspect of the present invention is to provide a pharmaceutical composition for preventing cancer, treating cancer and / or treating inflammation, said pharmaceutical composition comprising a GJB5 inhibitor.

[0020] Furthermore, the GJB5 inhibitor is selected from siRNAs that target GJB5.

[0021] Furthermore, the siRNA targeting GJB5 is an oligonucleotide Si-GJB5-1, Si-GJB5-2, and / or Si-GJB5-3.

[0022] A third aspect of the present invention is to provide the use of the GJB5 gene, GJB5 mRNA and / or GJB5 protein in the preparation of cancer diagnostic and / or prognostic assessment products.

[0023] Furthermore, in the aforementioned applications, the GJB5 gene, GJB5 mRNA, and / or GJB5 protein serve as targets for cancer diagnosis; and in the aforementioned applications, the GJB5 gene, GJB5 mRNA, and / or GJB5 protein serve as biomarkers for prognostic assessment.

[0024] Furthermore, the cancers include at least one of pancreatic cancer, skin cancer, lung cancer, breast cancer, esophageal cancer, head and neck squamous cell carcinoma, cervical cancer, and prostate cancer.

[0025] Furthermore, the cancer diagnosis includes early cancer diagnosis, distant cancer metastasis diagnosis, and / or lymph node metastasis diagnosis.

[0026] Furthermore, the products include chips and reagent kits.

[0027] A fourth aspect of the present invention is to provide an expression plasmid for the GJB5 gene, wherein the overexpression plasmid is an overexpression plasmid designed based on the CDS sequence of the GJB5 gene using plasmid pcDNA3.1 (PC-3.1) as a vector; the CDS sequence of the GJB5 gene is shown in SEQ ID NO.9.

[0028] Furthermore, the overexpression plasmid can promote the proliferation, migration, and cell cycle of pancreatic cancer cells, and inhibit apoptosis of pancreatic cancer cells.

[0029] A fifth aspect of the present invention is to provide the use of the overexpression plasmid described in the fourth aspect in the preparation of medicaments for treating skin cancer, esophageal cancer, and prostate cancer.

[0030] The technical solution of this invention has the following advantages:

[0031] 1. The cancer biomarker provided by this invention, wherein the cancer is pancreatic cancer, and the cancer biomarker includes the GJB5 gene and / or the GJB5 gene expression product. The GJB5 gene expression product includes GJB5 mRNA and / or GJB5 protein. This invention has found that the expression level of the GJB5 gene (Gene ID: 2709) in pancreatic cancer cell lines and pancreatic cancer tissues is significantly higher than that in normal pancreatic cell lines (HPNE and HPDE) and normal pancreatic tissues, suggesting a correlation between the expression level of the GJB5 gene and pancreatic cancer. Furthermore, in existing reports, GJB5 has been significantly downregulated in skin melanoma, esophageal cancer, prostate cancer, and head and neck squamous cell carcinoma, suggesting that it has high specificity as a cancer diagnostic biomarker. The expression product of the GJB5 gene is a target for early diagnosis and risk screening of pancreatic cancer, which is beneficial for improving the early diagnosis rate and specificity of pancreatic cancer diagnosis. The expression product of the GJB5 gene serves as a diagnostic indicator for non-invasive screening of pancreatic cancer, monitoring the clinical treatment efficacy of pancreatic cancer and providing important clinical information for the prevention, detection, and treatment of pancreatic cancer. This is beneficial for improving patients' quality of life and survival rates. This invention further validated the correlation between the GJB5 gene and the proliferation, migration, cell cycle, and apoptosis of pancreatic cancer cells through cell-related experiments. In pancreatic cancer cells overexpressing the GJB5 gene, cell proliferation and migration were enhanced. However, after interfering with GJB5 gene expression using siRNA, the proliferation, migration, and cell cycle of pancreatic cancer cells were inhibited, and the apoptosis rate increased. This indicates that the GJB5 gene can serve as a molecular therapeutic target for pancreatic cancer, providing a basis for the treatment and personalized therapy of pancreatic cancer.

[0032] 2. The cancer biomarker provided by this invention, through analysis of clinical cancer data, shows that the expression level of the GJB5 gene is significantly correlated with skin cancer, esophageal cancer, prostate cancer, head and neck squamous cell carcinoma, cervical cancer, lung cancer, and thymoma (P < 0.05).

[0033] 3. Detecting the expression of the GJB5 gene can provide important clinical evidence for the diagnosis or treatment of the aforementioned cancers.

[0034] 4. Uses of the GJB5 gene, mRNA, and protein provided by this invention: The GJB5 gene shows significant expression differences in cancers at different stages, suggesting that the GJB5 gene and its expression products can serve as molecular diagnostic markers for pancreatic cancer staging. Patients with high GJB5 gene expression have significantly shorter survival times than those with low GJB5 expression, indicating that high GJB5 gene expression is associated with poor prognosis. Therefore, the GJB5 gene and / or its expression products can serve as prognostic markers for pancreatic cancer, used to predict patient outcomes. Furthermore, the GJB5 gene and its expression products can also serve as therapeutic targets for pancreatic cancer, used in the preparation of drugs for treating pancreatic cancer, assisting in clinical treatment of pancreatic cancer, and improving cancer treatment efficacy.

[0035] 5. The GJB5 gene expression inhibitor siRNA provided by this invention has a good interference effect when used for gene inhibition. It can effectively inhibit the expression of GJB5 gene, inhibit the proliferation, migration, and cell cycle of tumor cells, and promote cancer cell apoptosis, showing certain potential for gene therapy.

[0036] 6. The overexpression plasmid provided by this invention can be used as an inhibitor of certain tumors, such as skin cancer, esophageal cancer and prostate cancer, for molecular targeted therapy. Attached Figure Description

[0037] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0038] Figure 1 B and Figure 1 C shows the immunohistochemical staining results of GJB5 protein in pancreatic cancer tissue (Tumor, experimental group) from Example 1. Figure 1 Image A shows the immunohistochemical staining results of GJB5 protein in adjacent normal tissue (Adjacent, control group) from Example 1; where... Figure 1 D- Figure 1 F is respectively for Figure 1 A- Figure 1 Enlarged view of C.

[0039] Figure 2 A shows the immunoblotting results of GJB5 protein in pancreatic cancer cell lines (10 types, experimental group) and normal pancreatic cell lines (2 types, HPNE and HPDE, control group) in Example 2. Figure 2Figure B shows the RT-qPCR results of GJB5 RNA in pancreatic cancer cell lines (10 types, experimental group) and normal pancreatic cell lines (2 types, HPNE and HPDE, control group) in Example 2.

[0040] Figure 3 Figure A shows the analysis of clinical data results of GJB5 in human pancreatic cancer tissue (tumor, experimental group) and normal pancreatic tissue (normal, control group) in Example 3; Figure 3 B is a graph showing the analysis of clinical data results of GJB5 in normal pancreatic tissue (normal, control group), pancreatic carcinoma in situ tissue (primary, experimental group), and metastatic pancreatic cancer tissue (metastasis, experimental group) in Example 3. Figure 3 C is a graph showing the relationship between GJB5 expression and patient prognosis; Figure 3 D is a graph showing the expression analysis of GJB5 in different cancer stages (G1-4); Figure 3 E represents the bioinformatics analysis results of GJB5 mRNA expression in tumor samples and paired normal tissues, where each point represents the expression level in the sample.

[0041] Figure 4 The Kras mutant mouse (KRAS) provided in Example 3 G12D Figure showing the expression of GJB5 in a mouse model of early pancreatic cancer lesions induced by cerulein. Figure 4 Figure A shows the expression of GJB5 in mouse pancreatic tissue (Normal), mouse pancreatic cancer tissue (PDAC) after untreated (Normal), mouse pancreatic cancer tissue (Injury), mouse pancreatic cancer tissue (Kras), mouse pancreatic cancer tissue (Kras_injury) after Kras mutation (Kras), mouse pancreatic cancer tissue (Kras_injury). Figure 4 B is a diagram showing the results of labeling various cell types in the pancreas of Kras mutant mice based on RNA sequencing results and molecular markers. Figure 4 C is Figure 4 Based on B, this diagram shows the cell types expressing GJB5 in the pancreas of Kras mutant mice. Figure 4 D is a graph showing the expression of GJB5 under the induction of taeniacin (NaCl is the control group); Figure 4 E represents the relationship between GJB5 expression and the number of days of induction with thymol (D1: day 1; D7: day 7; D28: day 28) (WT is the control group).

[0042] Figure 5 Figure A shows the protein expression results of knocking down GJB5 (Si-GJB5) in Example 4. Figure 5 Figure C shows the analysis results of knocking down GJB5 RNA expression in Example 4. Figure 5B is a graph showing the protein expression results of GJB5 (PC-GJB5) overexpression in Example 4; Figure 5 D is a graph showing the analysis of RNA expression results of GJB5 overexpression in Example 4.

[0043] Figure 6 A and Figure 6 Figure B shows the inhibition of pancreatic cancer cell proliferation after GJB5 knockdown in Example 5. Figure 6 C and Figure 6 Figure D shows the effect of GJB5 overexpression on pancreatic cancer cell proliferation in Example 5.

[0044] Figure 7 A and Figure 7 B is a graph showing the inhibition of pancreatic cancer cell migration after GJB5 knockdown in Example 6, along with its analysis. Figure 7 E- Figure 7 F); Figure 7 C and Figure 7 D is a graph showing the effect of GJB5 overexpression on pancreatic cancer cell migration in Example 6, and its analysis. Figure 7 G- Figure 7 H).

[0045] Figure 8 A and Figure 8 C is a cell cycle diagram and its analysis diagram of pancreatic cancer cell CFPAC-1 after GJB5 knockdown in Example 7; Figure 8 B and Figure 8 D is a cell cycle diagram and analysis of pancreatic cancer cells MIAPaCa-2 inhibited after GJB5 knockdown in Example 7. Figure 8 F); Figure 8 G and Figure 8 I is a cell cycle diagram and analysis of pancreatic cancer cell PL45 after GJB5 overexpression in Example 7. Figure 8 K); Figure 8 H and Figure 8 J is a cell cycle diagram and analysis of pancreatic cancer cells HPAF-|| after GJB5 overexpression in Example 7. Figure 8 L).

[0046] Figure 9 The GJB5 knockdown provided in Example 8 of this invention promotes the development of CFPAC-1 in pancreatic cancer cells. Figure 9 A / Figure 9 C) and MIAPaCa-2 ( Figure 9 B / Figure 9 D) Apoptosis and its analysis diagram ( Figure 9 E- Figure 9 F); GJB5 overexpression inhibited PL45 in pancreatic cancer cells (F); Figure 9 G / Figure 9 I) and HPAF-||( Figure 9 H / Figure 9 J) Period and its analysis diagram ( Figure 9 K- Figure 9 L);

[0047] Figure 10 The GJB5 inhibitor provided in Example 9 of this invention inhibits pancreatic cancer cells BxPC-3 ( Figure 10 A- Figure 10 B) and CFPAC-1 ( Figure 10 C- Figure 10 D) In ​​vivo proliferation and its analysis diagram ( Figure 10 E- Figure 10 F); GJB5 overexpression plasmid promotes HPAF-||( Figure 10 G- Figure 10 H) and SW1990 Figure 10 I- Figure 10 J) In vivo tumor formation and its analysis diagram ( Figure 10 K- Figure 10 L);

[0048] Figure 11 The protein content of GJB5 provided in Example 10 of this invention in wild-type mice (WT), Kras mutant mice (KC), pancreatin-induced early pancreatic cancer lesion model mice (CAE), and pancreatic duct ligation-induced early pancreatic cancer lesion model mice (PDL) is shown to be... Figure 11 A) and RNA( Figure 11 The expression of B) (WT is the control group); the comparison of GJB5 with relevant biomarkers (Amylase, Ck19) in the early pancreatic cancer lesion model ( Figure 11 C) and its analysis diagram ( Figure 11 D);

[0049] Figure 12 The normal mouse pancreas tissue provided in Example 10 of the present invention ( Figure 12 A) and pancreatic tissue from Kras mutant mice ( Figure 12 C) Pancreatic tissue from a mouse model of early pancreatic cancer lesions induced by taurine (CAE). Figure 12 Pancreatic tissue from mouse models of early pancreatic cancer lesions (E) and pancreatic duct ligation (PDL) (E) Figure 12 Immunohistochemical staining results of GJB5 protein in G) Figure 12 B / Figure 12 D / Figure 12 F / Figure 12 H is Figure 12 A / Figure 12 C / Figure 12 E / Figure 12 (G corresponds to the magnified image, WT is the control group). Detailed Implementation

[0050] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention. Unless otherwise stated, the experimental methods disclosed in the present invention are all based on conventional techniques in the art, and all primer synthesis and sequencing work was completed by Sangon Biotech Co., Ltd. (Guangzhou). Unless otherwise stated, the reagents and raw materials used in the following embodiments are all commercially available.

[0051] Unless otherwise specified, all pancreatic cancer cell lines, HPNE cells, and HPDE cells were purchased from the American Type Culture Collection (ATCC). All cell lines were cultured at 37°C and 5% CO2 as monolayer adherents, supplemented with 10% fetal bovine serum, sodium pyruvate, non-essential amino acids, L-glutamine, and vitamin solution. Anti-GJB5 (PA5-103852) antibody was purchased from Invitrogen (Thermo Fisher Scientific); anti-β-actin (20536-1-AP) antibody was purchased from Proteintech (Annoren Biotech). Rain frog extract powder (HY-A0190) was purchased from MCE. The animal anesthetic Afodin (M2920) was purchased from Nanjing Aibei Biotechnology. Specific targeting siRNAs were purchased from GenePharma. The three pairs of oligonucleotide siRNA sequences and the Si-NC sequence of GJB5 are shown in Table 1. The nucleotide sequence of Si-NC was a random sequence (as a negative control). The primer sequences for real-time PCR and reverse transcription PCR are shown in Table 2. The siRNA design and synthesis method is as follows: starting from the AUG start codon of the transcript (mRNA), search for the "AA" doublet sequence and record the 19 bases at its 3' end as potential siRNA target sites. The selected sequences are compared with public databases to ensure that the target sequence has no homology with other genes. Potential sequences are compared with corresponding genome databases (human, mouse, rat, etc.) to exclude sequences homologous to other coding sequences / ESTs. Suitable target sequences are selected for synthesis. This siRNA is obtained through chemical synthesis, produced under ISO 9000 quality standards, and the product is precisely quantified by spectrophotometer and purified by HPLC to achieve a full-length double-stranded siRNA content >97%. The characteristic bond of this siRNA sequence is the dTdT hanger at the siRNA end, which maintains the stability of the siRNA.

[0052] Table 1

[0053]

[0054] In each oligonucleotide, A, G, C, and U represent adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, and uracil ribonucleotide, respectively. The addition of two dTdT or dAdC tails at the 3' end guides the siRNA to form the RNAi silencing complex and also prevents degradation by nucleases.

[0055] Table 2

[0056] CX31.1-primer forward ACCTGGTGAGCAAGAGATGC CX31.1-primer reverse CACCCGAAAGGAGGTCGTC β-actin-primer forward CTCCATCCTGGCCTCGCTGT β-actin-primer reverse GCTGTCACCTTCACCGTTCC

[0057] The overexpression plasmid PC-GJB5 was purchased from GenScript Biotech Inc. The CDS sequence of the GJB5 gene was subcloned into a backbone vector. The CDS sequence of the GJB5 gene from 5' to 3' is shown in SEQ ID NO. 9. The backbone vector used was the commonly used plasmid vector pcDNA3.1 (PC-3.1) with a C-terminal DYK tag. The method for obtaining the overexpression plasmid PC-GJB5 was as follows: after gene analysis, the mix synthetic sequence was directly synthesized and constructed into a vector using AflII and XhoI sites. PCR: pre-denaturation: 94–96℃, denaturation: 94–96℃, annealing: 60–68℃, extension: 72℃. The amplified PCR product of the target gene was ligated into the linearized pcDNA3.1(+)-C-DYK vector. The ligation product was then transformed into competent cells using a heat shock method. The transformed product was evenly spread on LB agar plates containing ampicillin and incubated overnight at 37°C. Using a sterile pipette tip, 3-6 single colonies were picked and cultured in LB liquid medium containing ampicillin. After incubation, nucleic acid dyes were added for electrophoresis. Clones with bands matching the expected size were selected for plasmid extraction via shaking and sequencing, followed by sequencing and enzyme digestion verification. The overexpression plasmid's sequence characteristic is a DNA sequence ending with the DYK protein, used for later identification of successful gene transfer into target cells. Additionally, it contains an ampicillin DNA sequence for screening successfully transfected cells.

[0058] Gene symbol:hGJB5

[0059] Express Cloning Vector:pcDNA3.1+C-DYK

[0060] NCBI Transcript ID:NM_005268.4

[0061] SEQ ID NO.9: CDS sequence (822nt) of the GJB5 gene:

[0062] ATGAACTGGAGTATCTTTGAGGGACTCCTGAGTGGGGTCAACAAGTACTCCACAGCCTTTGGGCGCATCTGGCTGTCTCTGGTCTTCATCTTCCGCGTGCTGGTGTACCTGGTGACGGCCGAGCGTGTGGAGTGATGACCACAAGGACTTCGACTGCAATACTCGCCAGCCCGGCTGCTCCAACGTCTGCTTTGATGAGTTCT TCCCTGTGTCCCATGTGCGCCTCTGGGCCCTGCAGCTTATCCTGGTGACATGCCCCTCACTGCTCGTGGTCATGCACGTGGCCTACCGGGAGGTTCAGGAGAAGAGGCACCGAGAAGCCCATGGGGAGAACAGTGGGCGCCTCTACCTGAACCCCGGCAAGAAGCGGGGTGGGCTCTGGTGGACATATGTCTGCAGCCTAGTGTTC AAGGCGAGCGTGGACATCGCCTTTCTCTATGTGTTCCACTCATTCTACCCCAAATATATCCTCCCTCCTGTGGTCAAGTGCCACGCAGATCCATGTCCCAATATAGTGGACTGCTTCATCTCCAAGCCCTCAGAGAAGAACATTTTCACCCTCTTCATGGTGGCCACAGCTGCCATCTGCATCCTGCTCAACCTCGTGGAGCTCA TCTACCTGGTGAGCAAGAGATGCCACGAGTGCCTGGCAGCAAGGAAAGCTCAAGCCATGTGCACAGGTCATCACCCCCACGGTACCACCTCTCCTGCAAACAAGACGACCTCCTTTCGGGTGACCTCATCTTTCTGGGCTCAGACAGTCATCCTCCTCTCTTACCAGACCGCCCCCGAGACCATGTGAAGAAAACCATTCTGTGA

[0063] Female athymic nude mice and C57BL / 6 mice were purchased from Hunan Slack Jingda Laboratory Animal Company. (KRAS) G12D Mice and PDX1-Cre mice were purchased from Shanghai Southern Model Biotechnology Co., Ltd. All animals were housed at the university's animal barrier center, a facility approved by the relevant national laboratory animal care assessment and certification body in accordance with current regulations and standards.

[0064] Example 1: Immunohistochemical staining experiment of GJB5 expression in human pancreatic cancer.

[0065] This embodiment provides a method for detecting the protein expression level of the GJB5 gene in pancreatic cancer tissue (Tumor, experimental group) and normal tissue (Adjacent, control group), as detailed below:

[0066] (1) Place the paraffin sections on a biological tissue baking machine and dewax and hydrate them at 62°C for 30 minutes using routine methods.

[0067] (2) Antigen retrieval: Tris-EDTA buffer (pH 9.0) was used to retrieve antigens by microwave, and the mixture was allowed to cool naturally to room temperature. Phosphate-buffered saline (PBS) was added, and the mixture was placed on a shaker and washed for 5 minutes × 3 times at room temperature.

[0068] (3) Use an immunohistochemistry pen to draw a circle around the sample tissue;

[0069] (4) Inactivate endogenous peroxidase with 3% hydrogen peroxide (H2O2)-methanol at room temperature for 10 minutes. Add T-BST, place on a shaker, and wash for 5 minutes × 3 times;

[0070] (5) Add 10% goat serum (GS) and block at room temperature for 30 minutes;

[0071] (6) Remove serum, add GJB5 primary antibody (1:200), and incubate overnight at 4°C;

[0072] (7) Add triethanolamine buffered saline solution-Tween 80 (TBS-T), wash on a shaker for 5 minutes × 3 times;

[0073] (8) Add biotin-labeled goat anti-rabbit secondary antibody (Goat Anti-rabbit IgG / HRP) and incubate at room temperature for 30-60 minutes;

[0074] (9) Add TBS-T, place on a shaker, and wash for 5 minutes × 3 times;

[0075] (10) DAB color development, observe the reaction termination point under a microscope, and place the paraffin section in TBS-T to terminate the color development.

[0076] (11) Place on a shaker and wash with TBS-T for 5 minutes × 3 times;

[0077] (12) Hematoxylin rede staining, water washing to return to blue;

[0078] (13) Conventionally dehydrated and transparent, then sealed with neutral resin.

[0079] Depend on Figure 1It can be seen that GJB5 protein staining was negative in normal tissue (Adjacent, control group), while it was positive in pancreatic cancer tissue (Tumor, experimental group).

[0080] Example 2: Western blotting and real-time quantitative polymerase chain reaction (RT-qPCR) experiments on the expression of human pancreatic cancer cell line GJB5.

[0081] This embodiment provides a method for detecting the expression levels of GJB5 gene messenger ribonucleic acid (mRNA) and protein in pancreatic cell lines (HPNE and HPDE, control group) and pancreatic cancer cell lines (AsPC-1, BxPC-3, CAPAN-2, CFPAC-1, HPAC, HPAF-||, MIA PaCa-2, PANC-1, PK-59, PL45, experimental group), as detailed below:

[0082] (1) Routinely culture pancreatic cell lines and pancreatic cancer cell lines until the cells enter the exponential proliferation phase;

[0083] (2) Wash three times with cold PBS, and add total RNA extraction reagent (Trizol) and protein lysis buffer (RIPALysis Buffer, containing 1% phosphatase inhibitor and 1% protease inhibitor) to extract RNA and protein respectively.

[0084] (3) Add 1 / 5 volume of chloroform to the sample, invert to mix, and let stand at room temperature for 10 minutes. Then centrifuge at 16,000 g for 15 minutes at 4°C.

[0085] (4) Take the supernatant, place it in a new centrifuge tube (EP tube), add an equal amount of isopropanol, gently invert and mix, let it stand at room temperature for 10 minutes, and then centrifuge at 16000g for 10 minutes.

[0086] (5) Discard the supernatant, add 1 mL of 75% ethanol to the EP tube, invert and mix until the precipitate separates from the tube wall, then centrifuge at 7500g for 5 minutes at 4°C, and repeat once.

[0087] (6) Discard the supernatant, let stand at room temperature for 10 minutes to allow the precipitate to become transparent, and add 20 μL of RNase-free water;

[0088] (7) Detection of RNA concentration using a UV spectrophotometer;

[0089] (8) Perform routine RNA reverse transcription and RT-qPCR:

[0090] (9) After adding RIPA lysis buffer, scrape the cells off with a cell scraper and place them in an EP tube;

[0091] (10) Cell disruption was performed using an ultrasonic tissue disruptor (power: 40w, time: 1 minute);

[0092] (11) Centrifuge at 12,000 rpm at 4°C for 15 minutes, and place the supernatant into a new EP tube;

[0093] (12) Add dioctanine protein quantification kit (BCA Assay Kit), react at 37℃ for 30 minutes, and then detect the protein concentration with an enzyme-linked immunosorbent assay (ELISA) reader;

[0094] (13) Take 10 μg of protein solution, add 5× protein precipitation buffer and PBS, and incubate at 100℃ for 10 minutes in a constant temperature metal bath to denature the protein.

[0095] (14) Routine gel electrophoresis (10% gel) and membrane transfer;

[0096] (15) Seal with 5% skim milk solution for 1 hour;

[0097] (16) Add anti-GJB5 antibody, place on a shaker, and incubate overnight at 4°C;

[0098] (17) Add TBS-T and clean for 5 minutes × 3;

[0099] (18) Add goat anti-rabbit secondary antibody and incubate at room temperature on a shaker for 1 hour;

[0100] (19) Add TBS-T and clean for 5 minutes × 3;

[0101] (20) Immunoblotting was performed using a chemiluminescence imaging system.

[0102] The above steps (3)-(8) describe the procedures for RNA extraction and RT-qPCR detection of GJB5 RNA levels. Experimental results... Figure 2 Results B showed that, compared with normal pancreatic cells HPNE and HPDE, the RNA level of GJB5 in the vast majority of pancreatic cancer cells was upregulated; the above (9)-(20) are the operations of protein extraction and immunoblotting, and the experimental results Figure 2 A showed that the protein level of GJB5 was upregulated in the vast majority of pancreatic cancer cells, consistent with the results of RNA analysis, proving that GJB5 is highly expressed in pancreatic cancer.

[0103] Example 3: Clinical data mining and analysis.

[0104] This embodiment provides a method for detecting the RNA expression level of the GJB5 gene in pancreatic cancer tissues, including primary, metastatic, and staged (G1 / G2 / G3 / G4) tumors, as well as normal tissues, using bioinformatics analysis. Specifically, the method involves obtaining GJB5 RNA expression data from pancreatic cancer tissue samples and adjacent normal tissues. GJB5 RNA expression data and patient samples were downloaded from the TCGA database. The Wilcoxon rank sum test was used to detect the difference in GJB5 expression levels between normal (control group) and cancerous (experimental group) tissues. Furthermore, the expression changes of GJB5 between common tumors and normal tissues were compared to study the differences in GJB5 expression in different tumors. Finally, patient survival was analyzed to investigate the relationship between GJB5 and the prognosis of pancreatic cancer. In mouse tissues, the differences in GJB5 expression in early pancreatic cancer lesions (acinar-ductal metaplasia (ADM) and pancreatic cancer (PDAC) were analyzed between normal pancreas (normal, control group) and pancreatic cancer induced by villosatin (injury / CAE, experimental group), Kras mutation (Kras, experimental group), and Kras mutation followed by villosatin induction (Kras_injury, experimental group). Furthermore, by collecting RNA sequencing information and re-plotting using GJB5 markers, the cell types expressing GJB5 in the pancreatic tissues of Kras mutant mice were investigated.

[0105] Figure 3 A showed that the expression of the GJB5 gene in pancreatic cancer (tumor, experimental group) was significantly higher than that in normal tissue (normal, control group); Figure 3 B showed that the expression of the GJB5 gene was significantly higher in primary (experimental group) and metastatic pancreatic cancer (experimental group) than in normal tissue (normal, control group). Figure 3 C showed that high expression of GJB5 was associated with low survival time in pancreatic cancer patients; Figure 3 D shows that as the tumor progresses through further stages, the expression level of GJB5 also increases (normal is the control group, and Gx / G1 / G2G3 / G4 are the experimental groups). Figure 3 E is a graph comparing the RNA expression of GJB5 in various tumor tissues with normal tissues in clinical practice. "" indicates that GJB5 is elevated in tumor tissues, and the font color is darker; "" indicates that GJB5 is decreased in tumor tissues, and the font color is lighter; unmarked indicates no statistical difference. Figure 3 The results showed that the expression level of the GJB5 gene was downregulated in esophageal cancer, prostate cancer, and skin melanoma; and upregulated in cervical squamous cell carcinoma, lung squamous cell carcinoma, pancreatic cancer, and thymoma, with significant correlations.

[0106] Figure 4 A shows that in mice treated with crotonin (injury), Kras-mutated pancreatic tissue (Kras), and Kras-mutated tissue treated with crotonin (Kras_injury), the expression of GJB5 in the pancreas was upregulated (normal was the control group). Figure 4 B represents RNA sequencing data from the TCGA database, which uses specific markers to label specific cell populations. Figure 4 C was used to regroup and label the cell types expressing GJB5 in mouse pancreatic tissue. The results showed that GJB5 is expressed in the acinar cells of the mouse pancreas; Figure 4 Figures D and E show that GJB5 expression was upregulated in early pancreatic cancer lesions induced by taurine in mice (NaCl and WT control groups, CAE experimental group). This further validates the correlation between GJB5 gene expression and early pancreatic cancer lesions, suggesting that GJB5 gene can serve as an effective cancer biomarker for pancreatic cancer diagnosis and treatment.

[0107] Example 4: Knockdown / overexpression of GJB5 in pancreatic cancer cell lines.

[0108] This embodiment provides methods for GJB5 gene knockdown and overexpression, and methods for detecting their effects.

[0109] (1) Knockdown of GJB5: 5×10^5 BxPC-3 and MIA PaCa-2 cells were evenly seeded in two six-well plates. The next day, routine siRNA transfection was performed using lipo3000: 8 EP tubes were prepared and divided into A1, A2, A3, A4 and B1, B2, B3, B4. 2×125μl of serum-reduced medium (OPTI-MEM) was added to A1, A2, A3, A4 and B1, B2, B3, B4. Then, 2×5μl of lipo3000 was added to A1, A2, A3, A4, B1, B2, B3, B4, and B4 respectively. 2×5μl of Si-NC (control group) was added to B1, 2×5μl of Si-GJB5-1 (experimental group) was added to B2, 2×5μl of Si-GJB5-2 (experimental group) was added to B3, and 2×5μl of Si-GJB5-3 (experimental group) was added to B4. The cells were incubated for 5 minutes. Then, mix A1 with B1, A2 with B2, A3 with B3, and A4 with B4 separately, and let stand for 15 minutes. Finally, add 1 ml of serum-free medium + 250 μl of AB transfection mixture to each well and place in an incubator. Change the medium after 6-8 hours, replacing it with medium containing 10% serum.

[0110] (2) GJB5 overexpression: 5×10^5 and 8×10^5 PL45 and HPAF-|| cells were evenly seeded in two six-well plates, respectively. The next day, the overexpression plasmids were transfected using lipo3000: six EP tubes were prepared and divided into A1, A2, A3 and B1, B2, B3. 2×125μl of OPTI-MEM medium was added to A1, A2, A3 and B1, B2, B3. Then, 2×5μl of lipo3000 was added to A1, A2, A3, B1, A2, B3, and B3 respectively. 1μg PC-3.1 + 2×5μl P3000 reagent (control group) was added to B1, 2×1μg PC-GJB5 + 2×5μl P3000 reagent was added to B2, and 2×2.5μg PC-GJB5 + 2×5μl P3000 reagent was added to B3. The cells were incubated for 5 minutes. Then, mix A1 with B1, A2 with B2, and A3 with B3 separately, and let stand for 15 minutes. Finally, add 1 ml of serum-free medium + 250 μl of AB transfection mixture to each well and place in an incubator. Change the medium after 6-8 hours, replacing it with medium containing 10% serum.

[0111] (3) Routine RNA and protein extraction were performed 48 hours after transfection (same as in Example 2);

[0112] (4) RT-qPCR was performed to detect the expression level of GJB5 RNA (same as in Example 2);

[0113] (5) Perform immunoblotting to detect the expression level of GJB5 protein (same as in Example 2).

[0114] Experimental results Figure 5 A showed that siRNA effectively knocked down the protein expression level of GJB5 in pancreatic cancer cell lines BxPC-3 and MIA PaCa-2; experimental results Figure 5 B showed that PC-GJB5 effectively increased the protein expression levels of pancreatic cancer cell lines PL45 and HPAF-||GJB5. Figure 5 C showed that siRNA could effectively knock down the RNA expression levels of pancreatic cancer cell lines BxPC-3 and MIA PaCa-2GJB5; while Figure 5 D-scans showed that PC-GJB5 can effectively increase the RNA expression levels of pancreatic cancer cell lines PL45 and HPAF-||GJB5.

[0115] Example 5: Proliferation Experiment of Human Pancreatic Cancer Cell Lines

[0116] This embodiment provides an experimental method for investigating the proliferation changes of pancreatic cancer cells after GJB5 knockdown and overexpression. The specific procedures are as follows:

[0117] (1) GJB5 knockdown: BxPC-3 (3000 cells / well) and CFPAC-1 (3000 cells / well) cells were seeded into two 96-well plates (6 x 10 wells in the middle). The next day, routine siRNA transfection was performed using lipo3000: Four EP tubes were prepared, divided into A1, A2 and B1, B2. 60 × 5 μl of OPTI-MEM medium was added to A1, A2 and B1, B2. Then, 60 × 0.2 μl of lipo3000 was added to A1 and A2, 60 × 0.2 μl of Si-NC was added to B1, and 60 × 0.2 μl of Si-GJB5-2 was added to B2. The mixtures were incubated for 5 minutes. Then, A1 and B1, and A2 and B2 were mixed and incubated for 15 minutes. The original medium in the 96-well plates was discarded, and two 15 ml centrifuge tubes were filled with 60 × 100 μl of serum-free medium. Finally, the transfection mixtures of A1 and B1 (Si-NC group, control group) and A2 and B2 (Si-GJB5 group, experimental group) were added to two 15ml centrifuge tubes respectively and mixed well. 110μl of the transfection system was added sequentially to every other well in each column of a 96-well plate. After 6-8 hours, 100μl of whole serum culture medium was added to the original liquid.

[0118] (2) GJB5 overexpression: PL45 (4000 cells / well) and HPAF-|| (7000 cells / well) cells were seeded in two 96-well plates (6 x 10 wells in the middle). The next day, routine overexpression plasmid transfection was performed using lipo3000: four EP tubes were prepared, divided into A1, A2 and B1, B2. 60 × 5 μl of OPTI-MEM medium was added to A1, A2 and B1, B2. Then, 60 × 0.2 μl of lipo3000 was added to A1 and A2, 60 × 0.1 μg of PC-3.1 (control group) and 60 × 0.2 μl of P3000 reagent were added to B1, and 60 × 0.1 μg of PC-GJB5 and 60 × 0.2 μl of P3000 reagent were added to B2. The mixtures were incubated for 5 minutes. Then, A1 and B1, and A2 and B2 were mixed and incubated for 15 minutes. Discard the original culture medium in the 96-well plate. Take two 15ml centrifuge tubes and add 60×100μl of serum-free culture medium to each. Finally, add the transfection mixture of A1 and B1 (PC-3.1 group, control group) and the transfection mixture of A2 and B2 (PC-B5 0.1μg group, experimental group) to the two 15ml centrifuge tubes respectively, and mix well. Add 110μl of the transfection system to each column of 96-well plates, alternating columns. After 6-8 hours, add 100μl of whole serum culture medium to the original liquid.

[0119] (3) On days 0 / 1 / 3 / 4 / 5 after adding the transfection reagent, discard the culture medium of one column of Si-NC group and Si-GJB5 group, add 110 μl of serum-free medium: CCK8 reagent = 10:1 mixture, place in 37℃ 5% CO2 culture conditions, and detect cell absorbance with an enzyme-linked immunosorbent assay reader after 2 hours.

[0120] (4) Plot the absorbance (Optical Density: OD) against time to show the cell proliferation.

[0121] Experimental results Figure 6 A and Figure 6 B showed that, compared with the control group (Si-NC), the GJB5 knockdown group (Si-GJB5) effectively inhibited the proliferation of pancreatic cancer cells BxPC-3 and CFPAF-1; experimental results Figure 6 C and Figure 6 The results showed that, compared with the control group (PC-3.1), the GJB5 overexpression group (PC-GJB5 0.1 μg) effectively promoted the proliferation of pancreatic cancer cells PL45 and HPAF-||, and the difference was statistically significant. This example demonstrates that GJB5 can promote the in vitro proliferation of pancreatic cancer, while the small molecule inhibitor Si-GJB5 can effectively inhibit the proliferation effect induced by GJB5.

[0122] Example 6: Migration experiment of human pancreatic cancer cell line.

[0123] This embodiment provides an experimental method for investigating the migration changes of pancreatic cancer cells after GJB5 knockdown and overexpression. The specific procedures are as follows:

[0124] (1) Drawing board: Use a ruler to draw 4-5 straight lines evenly in the horizontal direction of the two six-hole boards;

[0125] (2) Knockdown of GJB5: 5 × 10^5 BxPC-3 and MIA PaCa-2 cells were evenly seeded in two six-well plates, respectively. The next day, transfection was performed using the same knockdown transfection protocol as in Example 4 (only Si-GJB5-2 transfection was used as the Si-GJB5 experimental group). 48-72 h after transfection, the cell density was observed under a microscope. After the cells reached confluence, 4-5 straight lines were drawn on the cells with a pipette tip, and the cells were washed 4 times with PBS. The cells were photographed under a microscope, and 5-6 points were taken and marked as the 0h time point. Subsequently, the corresponding points were photographed at 12h, 24h, and 48h.

[0126] (3) GJB5 overexpression: 6×10^5 AsPC-1 cells and 8×10^5 HPAF-|| cells were evenly seeded in two six-well plates. The next day, transfection was performed using the same overexpression transfection protocol as in Example 4. 48-72 h after transfection, the cell density was observed under a microscope. After the cells reached confluence, 4-5 straight lines were drawn on the cells with a pipette tip, and the cells were washed 4 times with PBS. The cells were photographed under a microscope, and 5-6 points were taken and marked as the 0h time point. Subsequently, the corresponding points were photographed at 12h, 24h, and 48h.

[0127] (4) Use ImageJ software to process and analyze the results.

[0128] Experimental results: Figure 7 Figures A and B show that, compared with the control group (Si-NC), the GJB5 knockdown group (Si-GJB5) effectively inhibited the migration of pancreatic cancer cells BxPC-3 and MIA PaCa-2; experimental results Figure 7 Figures C and 7D show that, compared with the control group (PC-3.1), the GJB5 overexpression group (PC-GJB5) effectively promoted the migration of pancreatic cancer cells AsPC-1 and HPAF-||, and the difference was statistically significant. This example demonstrates that GJB5 can effectively promote the in vitro migration of pancreatic cancer cell lines, while the small molecule inhibitor of GJB5, Si-GJB5-2, can effectively inhibit the migration effect induced by GJB5.

[0129] Example 7: Cycle experiment of human pancreatic cancer cell line.

[0130] This embodiment provides an experimental method for studying the cell cycle status of pancreatic cancer cells after GJB5 knockdown / overexpression.

[0131] (1) Five × 10^5 MIA PaCa-2 (si group), CFPAC-1 (si group), PL45 (PC group) and eight × 10^5 HPAF-|| (PC group) cells were evenly seeded in two six-well plates, with each cell type seeded in two wells, and placed in a culture environment of 37℃ and 5% CO2.

[0132] (2) The next day, routine transfection was performed using lipo3000: 8 EP tubes were prepared and divided into A1, A2, A3, A4 and B1, B2, B3, B4. 2×125μl of OPTI-MEM medium was added to A1, A2, A3, A4 and B1, B2, B3, B4. Then, 2×5μl of lipo3000 was added to A1, A2, A3, A4, B1, B2, A3, B4, B1, B2, B3, B4, B1, B2, B3, B4, B1, B2, B3, B4, B3, B4, and B4, respectively. The tubes were then incubated for 5 minutes. Subsequently, A1 and B1, A2 and B2, A3 and B3, and A4 and B4 were mixed separately and allowed to stand for 15 minutes. Cells were washed twice with PBS. Finally, 1 ml of serum-free medium + 250 μl of AB transfection mixture was added to a six-well plate and incubated at 37°C with 5% CO2. After 6-8 hours, the medium was changed to whole serum medium and incubated at 37°C with 5% CO2 for 48 hours.

[0133] (3) Aspirate the cell culture medium into a 15ml centrifuge tube, wash with PBS, add an appropriate amount of trypsin cell digestion solution to digest the cells, and then add serum-containing culture medium to stop the digestion.

[0134] (4) Collect the cell suspensions in groups into centrifuge tubes from (3), centrifuge at 250g for 5 minutes, and discard the supernatant;

[0135] (5) Add 2ml PBS to resuspend the cells, centrifuge at 250g for 5 minutes, and discard the supernatant;

[0136] (6) Add 1 ml of 70% ethanol and fix the cells overnight at 4°C.

[0137] (7) The next day, add 1 ml of PBS to resuspend, centrifuge at 250 g for 5 minutes, and discard the supernatant;

[0138] (8) Add 0.5 ml of propidium iodide staining solution (0.5 ml staining buffer + 25 μl 20X propidium iodide + 10 μl 50X RNase A) to each group and incubate on ice in the dark for 2-3 hours;

[0139] (9) Routine testing was performed using flow cytometry.

[0140] Experimental results: Figure 8 A- Figure 8D showed that compared with the control group (Si-NC), the GJB5 knockdown group (Si-GJB5) had a lower proportion of G2 / M cells, suggesting that GJB5 knockdown inhibits the cell cycle of pancreatic cancer cells MIA PaCa-2 and CFPAC-1. Figure 8 E- Figure 8 F is a statistical graph of the results. Experimental results Figure 8 G- Figure 8 J showed that compared with the control group (PC-3.1), the GJB5 overexpression group (PC-GJB5) had a higher proportion of G2 / M cells, suggesting that GJB5 overexpression promotes the cell cycle of pancreatic cancer cells PL45 and HPAF-||. Figure 8 K- Figure 8 L represents the statistical results. The results of this example indicate that GJB5 can promote the cell cycle of pancreatic cancer cells, while the GJB5 inhibitor Si-GJB5-2 can arrest the cell cycle of pancreatic cancer cells.

[0141] Example 8: Apoptosis experiment of human pancreatic cancer cell line.

[0142] This embodiment provides an experimental method for detecting apoptosis in pancreatic cancer cells after GJB5 knockdown / overexpression.

[0143] (1) Five × 10^5 MIA PaCa-2, CFPAC-1PL45 and eight × 10^5 HPAF-|| cells were evenly seeded in two six-well plates, with three wells for each cell type, and placed in a culture environment of 37℃ and 5% CO2.

[0144] (10) The next day, routine transfection was performed using lipo3000 liposomes: 12 EP tubes were prepared and divided into A1, A2, A3, A4, A5, A6 and B1, B2, B3, B4, B5, B6. In this study, A1, A2, A3, A4, A5, A6 and B1, B2, B3, B4, B5, B6 were each given 2×125μl of OPTI-MEM medium. Subsequently, A1, A2, A3, A4, A5, A6 were given 2×5μl of lipo3000; B1 was given 2×5μl of PBS (Si blank control: Mock); B2 was given 2×5μl of Si-NC (Si negative control); B3 was given 2×5μl of Si-GJB5-2 (Si experimental group); B4 was given 2×5μl of P3000 transfection reagent and 2×5μl of PBS (PC blank control: Mock); B5 was given 2×5μl of P3000 transfection reagent and 2×1μg of PC-3.1 (PC negative control: PC-3.1); and B6 was given 2×5μl of P3000 transfection reagent and 2×1μg of... PC-B5 (PC experimental group: PC-B5) was incubated for 5 minutes. Then, A1 and B1, A2 and B2, A3 and B3, A4 and B4, A5 and B5, and A6 and B6 were mixed separately and incubated for 15 minutes. Cells were washed with PBS. Finally, 1 ml of serum-free medium + 250 μl of the AB transfection mixture was added to each well of a six-well plate, and the plates were incubated at 37°C with 5% CO2.

[0145] (2) Change the medium after 6-8 hours, replace it with whole serum culture medium, and place it in an incubator for 48 hours;

[0146] (3) Aspirate the cell culture medium into a 15ml centrifuge tube, wash the cells once with PBS, add an appropriate amount of trypsin cell digestion solution to digest the cells, and then add whole serum culture medium to stop digestion.

[0147] (4) Collect the cell suspensions in groups into centrifuge tubes from (3), centrifuge at 250g for 5 minutes, and discard the supernatant;

[0148] (5) Add 2ml PBS to resuspend the cells, centrifuge at 250g for 5 minutes, and discard the supernatant;

[0149] (6) Resuspend the cells in 1 ml of PBS and count them;

[0150] (7) Take three 100,000 cell resuspensions from each of the two Mock groups, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, add 195 μl Annexin V-FITC binding solution and gently resuspend the cells, which are the blank control group, FITC single positive group, and PI single positive group, respectively; take 100,000 cell resuspensions from each of the Si-NC and PC-3.1 groups as the negative control group (Si-NC and PC-3.1); take 100,000 cell resuspensions from each of the Si-GJB5 and PC-B5 groups as the experimental group (Si-GJB5 and PC-B5);

[0151] (8) No dye was added to the blank control group;

[0152] (9) 195 μl Annexin V-FITC binding solution and 5 μl Annexin V-FITC diluted 10 times with PBS were added to the FITC single positive group, negative control group, and experimental group, and mixed well.

[0153] (10) Add 10 μl of propidium iodide staining solution to the PI single positive group, negative control group, and experimental group, and mix well.

[0154] (11) Incubate on ice in the dark for 15 minutes;

[0155] (12) Routine testing was performed using flow cytometry.

[0156] Experimental results Figure 9 A- Figure 9 D showed that, compared with the control group (Si-NC), the GJB5 knockdown group (Si-GJB5) effectively promoted apoptosis in pancreatic cancer cells MIA PaCa-2 and CFPAC-1, especially early apoptosis. Figure 9 E- Figure 9 F is a statistical graph of the results. Experimental results Figure 9 G- Figure 9 J showed that, compared with the control group (PC-3.1), the GJB5 overexpression group (PC-GJB5) effectively inhibited the apoptosis of pancreatic cancer cells PL45 and HPAF-||. Figure 9 K- Figure 9 L represents the statistical results. This example demonstrates that GJB5 can inhibit apoptosis in pancreatic cancer cells, while the GJB5 inhibitor Si-GJB5 can effectively inhibit GJB5, thereby promoting apoptosis in pancreatic cancer cells. Combined with analysis in Example 5, small molecule inhibitors of GJB5 may inhibit the proliferation of pancreatic cancer cells by promoting apoptosis.

[0157] Example 9: Experiment on xenograft of pancreatic cancer in mice.

[0158] This embodiment provides an experimental method for xenografting of human pancreatic cancer cell lines with GJB5 knockdown into nude mice to investigate the effect of GJB5 on the proliferation of pancreatic cancer cells in vivo. The specific procedures are as follows:

[0159] (1) Take 3×10 6 One BxPC-3 (si group), one CFPAC-1 (si group), 5×10 6 One SW1990 (PC group), 8×10 6 Two HPAF-|| (PC group) cells were evenly seeded into eight 15cm culture dishes, with two dishes containing each cell type. The dishes were then incubated at 37℃ with 5% CO2.

[0160] (2) The following day, routine transfection was performed using liposome lipo3000: Eight 15ml centrifuge tubes were prepared and divided into A1, A2, A3, A4 and B1, B2, B3, B4. Each of A1, A2, A3, A4 and B1, B2, B3, B4 was filled with 2×1.75ml OPTI-MEM medium. Then, A1, A2, A3, A4 were filled with 2×70μl lipo3000, B1 was filled with 2×70μl Si-NC (Si control group), B2 was filled with 2×70μl Si-GJB5-2 (Si experimental group), B3 was filled with 2×14μg PC-3.1 (PC control group), and B4 was filled with 2×14μg PC-3B5 (PC experimental group). The mixtures were incubated for 5 minutes. Then, A1 and B1, A2 and B2, A3 and B3, and A4 and B4 were mixed and incubated for 15 minutes. During the process, the cells were washed twice with PBS. Finally, 14 ml of serum-free culture medium + 3.5 ml of AB transfection mixture were added to each culture dish and placed in a culture environment of 37°C and 5% CO2.

[0161] (3) Change the medium after 8 hours, replace it with a medium containing 10% serum, and place it in an incubator for 24 hours;

[0162] (4) Add an appropriate amount of pancreatic enzyme cell digestion solution to digest the cells, and then add culture medium containing 10% serum to stop the digestion.

[0163] (5) Collect the cell suspensions in groups into 15ml centrifuge tubes, centrifuge at 1000rpm for 5 minutes, and discard the supernatant;

[0164] (6) Add 3ml PBS to resuspend the cells, centrifuge at 1000rpm for 5 minutes, and discard the supernatant;

[0165] (7) Resuspend the cells in 2 ml of PBS and count them using a cell counter;

[0166] (8) Take 10 ml of the contents of each 15 ml culture dish. 7Each resuspended cell (50 μl system) was evenly dispensed into 5 EP tubes, with 10 cells per tube for the Si group. 6 10 cells, 2 x 10 cells per tube in PC group 6 One cell, then add 50 μl of matrix gel to each tube, mix well and place on ice;

[0167] (9) Pancreatic cancer cells were injected subcutaneously into the dorsal side of nude mice. The length and width of the tumor were measured every three days using calipers. Tumor-bearing mice were euthanized at a designated time point near death or after inoculation, and the tumors were removed and weighed. The tumor volume (mm³) was calculated using the formula: minor diameter... 2 × major diameter / 2.

[0168] The experimental results are shown in Figure 10 A- Figure 10 D: Compared with the control group (Si-NC), the GJB5 knockdown group (Si-GJB5) had smaller tumor volume, smaller tumor weight, and slower growth rate. Figure 10 E- Figure 10 F represents the tumor weight statistics. Experiment Figure 10 G- Figure 10 Compared with the control group (PC-3.1), the GJB5 overexpression group (PC-GJB5) had larger tumor volume, greater tumor weight, and a higher tumorigenesis rate. Figure 10 K is a statistical chart of tumor formation rate. Figure 10 L represents the tumor weight analysis diagram. This example shows that Si-GJB5-2 can inhibit in vivo tumor growth based on tumor growth trend, tumor volume, and tumor weight, while PC-GJB5 can promote in vivo tumor growth and increase the tumor formation rate of xenografts in nude mice.

[0169] Example 10: Constructing a mouse ADM model and comparing the expression levels of GJB5.

[0170] This embodiment provides the RNA and protein expression of GJB5 in multiple tissues and organs of mice, and establishes an ADM model of early pancreatic cancer lesions in mice to compare the expression of GJB5, perform RNA and protein molecular-level verification, and further verify the results through immunohistochemical experiments. The specific procedures are as follows:

[0171] (1) Seven- to eight-week-old C57BL / 6 mice were euthanized, and several common tissues and organs were removed. One part was used to extract RNA (same as in Example 2), and the other part was used to extract protein (same as in Example 2).

[0172] (2) ADM model induced by bacitracin: 500 μg of bacitracin was dissolved in 500 μL of dimethyl sulfoxide (DMSO), and then 4500 μL of physiological saline was added to prepare a 100 μg / ml stock solution. Experimental group: The 100 μg / ml bacitracin stock solution was diluted tenfold with physiological saline and injected intraperitoneally into C57BL / 6 mice at a dose of 50 μg / kg. The injections were given for two consecutive days, eight times a day, with a one-hour interval between each injection. Control group (WT): Bacitracin was replaced with an equal volume of physiological saline, and the same treatment was performed. The mice were euthanized at designated time points, and pancreatic tissue was collected. RNA was extracted from one portion of the tissue (same as in Example 2), protein was extracted from another portion (same as in Example 2), and the remaining tissue was subjected to routine paraffin dehydration and embedding (same as in Example 1).

[0173] (3) ADM model induced by pancreatic duct ligation (PDL): C57BL / 6 mice were anesthetized with afodin (mouse weight / g × 10ul). The abdomen of the mice was cut open in a sterile operating table to locate the pancreas. Experimental group: The pancreas was ligated with sutures on the head side, and then the abdomen of the mice was routinely sutured until the mice woke up. Control group (WT): No ligation was performed. After locating the pancreas, the abdominal cavity was directly sutured. The mice were euthanized after 7 days, and pancreatic tissue was harvested. RNA was extracted from one part of the tissue, protein was extracted from another part of the tissue, and the remaining tissue was routinely dehydrated and embedded in paraffin.

[0174] (4) Kras mutant mice: Experimental group: Purchased Kras mutant mice G12D Mice were mated with PDX1-Cre promoter mice to produce pancreas-specific activating Kras mutant mice. The control group (WT) consisted of PDX1-Cre mice from the same batch or wild-type mice. The mice were euthanized at 10-12 months of age, and pancreatic tissue was harvested. RNA was extracted from one portion of the tissue, protein from another, and the remaining tissue underwent routine paraffin dehydration and embedding.

[0175] (5) Perform routine Western blotting and RT-qPCR experiments (same as in Example 2);

[0176] (6) Perform routine immunohistochemical staining experiments (same as in Example 1).

[0177] Experimental results Figure 11 A- Figure 11 B shows that, compared with the control group WT, the protein content of GJB5 in the CAE, PDL, and KC groups ( Figure 11 A) and RNA ( Figure 11 B) Expression levels were upregulated; experimental results Figure 11 C- Figure 11The results showed that at the RNA level, acinar cell marker amylase was downregulated in early pancreatic cancer lesions (ADM) tissues (CAE, PDL, KC), while ductal cell marker cytokeratin 19 (CK19) was significantly upregulated, and GJB5 was also upregulated. The differences were statistically significant compared to the control group (WT). Figure 12 A- Figure 12 H shows that, compared with the control group WT ( Figure 12 Compared to A), GJB5 showed better performance in ADM tissue (CAE-) of early-stage pancreatic cancer lesions. Figure 12 E, PDL- Figure 12 G, KC- Figure 12 C) Upward adjustment, among which Figure 12 B / Figure 12 D / Figure 12 F / Figure 12 H / are respectively Figure 12 A / Figure 12 C / Figure 12 E / Figure 12 Enlarged view of G. This example shows that GJB5 is upregulated in an ADM model of early pancreatic cancer, suggesting the potential of GJB5 as a molecular marker for early pancreatic cancer lesions.

Claims

1. The application of GJB5 inhibitors in the preparation of drugs for treating pancreatic cancer, characterized in that, The GJB5 inhibitor is a siRNA that targets GJB5; the siRNA is composed of double-stranded nucleic acid molecules 3 and 4, nucleic acid molecule 3 is composed of the sense strand RNA molecule shown in SEQ ID NO.3 and 2 dTs, with the 2 dTs located at the 3' end; nucleic acid molecule 4 is composed of the antisense strand RNA molecule shown in SEQ ID NO.4 and dGdC, with the dGdC located at the 3' end.

Images