Serine hydroxymethyltransferase mutant and its use in l-serine production

CN117645983BActive Publication Date: 2026-08-21JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311606402.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-28
Publication Date
2026-08-21
Estimated Expiration
2043-11-28

AI Technical Summary

Technical Problem

目前工业上生产L-丝氨酸主要是使用化学法,但其具有成本高、转化效率低和环境污染问题严重等缺点

Benefits of technology

[0027] This invention obtained a serine hydroxymethyltransferase mutant by replacing glutamic acid at position 160 with leucine, glutamic acid at position 193 with glutamine, and glutamic acid at position 266 with methionine in a serine hydroxymethyltransferase derived from *E. coli*. This mutant not only improves the enzyme activity and thermostability of serine hydroxymethyltransferase but also enhances its ability to synthesize L-serine in *E. coli*, making it more suitable for industrial production. The specific improvements of the mutant compared to the wild-type enzyme are as follows:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117645983B_ABST
    Figure CN117645983B_ABST
Patent Text Reader

Abstract

The application discloses a serine hydroxymethyltransferase mutant and application thereof in L-serine production, and belongs to the technical field of enzyme engineering. In the application, glutamic acid at the 160th position of serine hydroxymethyltransferase from diesel fuel alkane bacteria is replaced by leucine, glutamic acid at the 193th position is replaced by glutamine, and glutamic acid at the 266th position is replaced by methionine. The mutant enzyme activity is 35.4% higher than that of the wild type, and the thermal stability is 2.57 times that of the wild type. The serine hydroxymethyltransferase mutant provided in the application has higher efficiency in catalyzing synthesis of L-serine from glycine and formaldehyde, and the final yield is as high as 92.88 g / L. The recombinant serine hydroxymethyltransferase mutant of the application can better meet the industrial production demand, and solves the problems of low activity, low stability, low expression amount and low synthesis yield of L-serine of the serine hydroxymethyltransferase in the prior art.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention discloses a serine hydroxymethyltransferase mutant and its application in L-serine production, belonging to the field of enzyme engineering technology. Background Technology

[0002] L-Serine (L-Ser), a non-essential amino acid, plays an indispensable role in the biosynthesis of various amino acids, phospholipids, choline, purines, and other important substances in organisms. It is also a significant source of active one-carbon units in the body. In recent years, L-serine has demonstrated incredible potential in the food, biopharmaceutical, and cosmetic fields. As a nutritional supplement, L-serine is added to foods and functional beverages to replenish essential nutrients. In the pharmaceutical industry, L-serine is not only an important pharmaceutical raw material, but its derivatives also have a wide range of applications. L-serine is also widely added to cosmetics to increase cell surface activity and for anti-aging purposes. Currently, the industrial production of L-serine mainly uses chemical methods, but these methods suffer from high costs, low conversion efficiency, and serious environmental pollution. While reported microbial methods have low activity and yield, improving the enzyme activity of serine hydroxymethyltransferase is of great significance for the industrial production of L-Ser. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides a serine hydroxymethyltransferase mutant and its application in L-serine production. Using serine hydroxymethyltransferase derived from *Eclipta prostrata* as the parent, this invention mutates to obtain a serine hydroxymethyltransferase mutant. The enzyme activity and catalytic ability of this serine hydroxymethyltransferase mutant are both improved. When constructed into *Escherichia coli*, it exhibits high enzyme conversion efficiency and shows promising industrial potential.

[0004] The first objective of this invention is to provide a serine hydroxymethyltransferase, wherein the serine hydroxymethyltransferase uses the amino acid sequence shown in SEQ ID NO.3 as a parent, and the parent is subjected to one or more mutations as shown in (a)-(c) below:

[0005] (a) The glutamic acid at position 160 is mutated to leucine;

[0006] (b) The glutamic acid at position 193 is mutated to glutamine;

[0007] (c) Glutamic acid at position 266 is mutated to methionine.

[0008] In one embodiment, the serine hydroxymethyltransferase uses the amino acid sequence shown in SEQ ID NO.3 as the parent, and mutates glutamic acid at position 160 to leucine, glutamic acid at position 193 to glutamine, and glutamic acid at position 266 to methionine to obtain a serine hydroxymethyltransferase with the amino acid sequence shown in SEQ ID NO.1.

[0009] A second objective of this invention is to provide a gene encoding the serine hydroxymethyltransferase.

[0010] In one embodiment, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0011] A third objective of this invention is to provide a vector containing the said gene.

[0012] The type of vector containing the above-mentioned gene is not particularly limited and can be any vector such as plasmid, bacteriophage, granule, virus, YAC vector, shuttle vector, etc. Furthermore, the vector is not limited, but preferably a vector capable of expressing the gene within bacteria, such as *E. coli*. Even further, as a preferred example, the vector can be plasmid pET28a, without limitation.

[0013] A fourth object of the present invention is to provide a recombinant cell containing the above-mentioned gene or the above-mentioned vector.

[0014] In one embodiment, the recombinant cells of the present invention can be obtained by introducing the gene or the vector into a host.

[0015] In one embodiment, the host may be selected from microorganisms such as bacteria and fungi. Examples of bacteria include Escherichia coli and Bacillus subtilis, and examples of fungi include Pichia pastoris and Saccharomyces cerevisiae. Preferably, it is Escherichia coli or a mutant strain thereof. As a preferred example, there is no limitation, and the host may be Escherichia coli BL21(DE3).

[0016] The fifth objective of this invention is to provide a method for producing L-serine, wherein a substrate containing glycine and formaldehyde is mixed with the serine hydroxymethyltransferase or the recombinant cells in the presence of a coenzyme to produce L-serine; the coenzyme includes tetrahydrofolate and pyridoxal phosphate.

[0017] In one embodiment, the concentration of the tetrahydrofolic acid is 1-20 mM, preferably 10 mM.

[0018] In one embodiment, the concentration of pyridoxal phosphate is 0.1-1 mM, preferably 0.4 mM.

[0019] In one embodiment, the concentration of glycine is 0.5-2M, preferably 1.2M glycine.

[0020] In one embodiment, the concentration of formaldehyde is 0.5-2M, preferably 1.2M.

[0021] In one embodiment, the reaction temperature is 30-70°C, preferably 30-50°C, and more preferably 40°C.

[0022] In one embodiment, the pH of the reaction is 4-10, preferably pH 6-8, and more preferably pH 7.

[0023] A sixth object of the present invention is to provide an enzyme preparation containing the above-mentioned serine hydroxymethyltransferase or the above-mentioned recombinant cells.

[0024] A seventh object of the present invention is to provide the application of the said serine hydroxymethyltransferase or the said recombinant cells in the food field.

[0025] In one embodiment, the application includes using the serine hydroxymethyltransferase or the recombinant cells for the production of L-serine or L-serine-containing products.

[0026] Beneficial effects:

[0027] This invention obtained a serine hydroxymethyltransferase mutant by replacing glutamic acid at position 160 with leucine, glutamic acid at position 193 with glutamine, and glutamic acid at position 266 with methionine in a serine hydroxymethyltransferase derived from *E. coli*. This mutant not only improves the enzyme activity and thermostability of serine hydroxymethyltransferase but also enhances its ability to synthesize L-serine in *E. coli*, making it more suitable for industrial production. The specific improvements of the mutant compared to the wild-type enzyme are as follows:

[0028] (1) The enzyme activity was increased by 35.0%;

[0029] (2) It showed a stronger affinity for the substrate: the kinetic constant Km decreased from 10.38 μM to 4.36 μM;

[0030] (3) Catalytic efficiency was significantly improved: the conversion number Kcat / Km increased from 0.35 s. -1 μM -1 Improved to 1.09s -1 μM -1 ;

[0031] (4) Improved stability: After incubation at 40℃ and pH 6.5 for 24 hours, the residual enzyme activity of the wild-type enzyme was 31.7% of the initial value, and the residual enzyme activity of the mutant was 77.5% of the initial value.

[0032] Furthermore, under the condition of reacting at 40℃ for 24 hours, strain E. coli BL21 / pET28a-AdSHMT E160L / E193Q / E266M The final yield of L-serine was as high as 92.88 g / L, which is 3.26 times that of E.coli BL21 / pET28a-AdSHMT. Attached Figure Description

[0033] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0034] Figure 1 The enzymatic properties of wild-type and mutant enzymes are as follows: (A) Specific enzyme activity of wild-type and mutant enzymes; (B) Effect of temperature on enzyme activity; (C) Effect of pH on enzyme activity; (D) Temperature stability of wild-type and mutant enzymes.

[0035] Figure 2 The images show SDS-PAGE gel images of the wild-type enzyme and the mutant enzyme, where M is the protein marker, lane 1 is the wild-type enzyme, and lane 3 is the triple mutant.

[0036] Figure 3 Liquid chromatography detection of L-serine prepared by engineered bacteria. Detailed Implementation

[0037] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0038] The culture media involved in the following examples are as follows:

[0039] (1) LB liquid medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L.

[0040] (2) LB solid medium: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 20g / L.

[0041] (3) TB medium:

[0042] A: Yeast extract 24g, peptone 12g, glycerin 4g;

[0043] B: KH2PO4 2.3g, K2HPO4 16.4g;

[0044] Dissolve A in 900 mL of ultrapure water and autoclave; dissolve B in 100 mL of ultrapure water and autoclave. Mix 900 mL of A and 100 mL of B to prepare 1 L of TB culture medium.

[0045] Example 1: Construction and expression of wild-type serine hydroxymethyltransferase

[0046] The nucleotide sequence of the wild-type serine hydroxymethyltransferase gene AdSHMT is shown in SEQ ID NO.4. The expression plasmid pET28a was digested with the restriction endonuclease HindIII / EcoRI to obtain a linearized vector. The gene AdSHMT and pET28a were ligated to obtain the recombinant plasmid pET28a-AdSHMT. This recombinant plasmid was chemically transformed into *E. coli* BL21(DE3), plated on kanamycin-resistant LB agar plates, and incubated overnight at 37°C. Randomly selected clones were identified by colony PCR and sequenced for verification. The results showed that the recombinant expression vector pET28a-AdSHMT, containing the serine hydroxymethyltransferase gene, was successfully transformed into *E. coli* BL21(DE3). The successfully transformed recombinant bacteria were named *E. coli* BL21 / pET28a-AdSHMT. The recombinant plasmid was extracted from the successfully transformed bacterial culture and stored at -20°C. Sequencing was performed by Suzhou Genewiz Co., Ltd.

[0047] Recombinant E. coli BL21 / pET28a-AdSHMT was inoculated into 10 mL of LB medium and cultured at 37 °C and 200 rpm for 10 h. Then, 1% of the inoculum was transferred to 50 mL of LB medium and cultured at 37 °C and 200 rpm for 2 h. Isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.5 mM, and the cells were induced to express serine hydroxymethyltransferase at 16 °C and 200 rpm for 12 h. The bacterial culture was collected, and the cells were washed with PBS, centrifuged, and then sonicated: 1 s for 3 s, 15 min. After lysis, the cells were centrifuged at 4 °C and 12000 rpm for 20 min. The supernatant and precipitate were separated. The expression level of serine hydroxymethyltransferase was verified by SDS-PAGE, and the crude enzyme was purified by Ni-NTA affinity chromatography to obtain a pure enzyme solution of wild-type serine hydroxymethyltransferase (e.g., ...). Figure 2 As shown, lane 1 is the wild-type pure enzyme solution. The obtained purified enzyme was added with 10% glycerol and stored at 4°C for later use.

[0048] Example 2 Construction and expression of serine hydroxymethyltransferase mutant

[0049] Primers P1 / P2, P3 / P4, and P5 / P6 were designed to amplify gene sequences with mutations E160L, E193Q, and E266M using pET28a-AdSHMT as a template. E160L represents a mutation of glutamic acid at position 160 to leucine, and E193Q and E266M are similar. Q and M represent glutamine and methionine, respectively.

[0050] The recombinant plasmid was constructed using the same method as in Example 1 and expressed in Escherichia coli BL21(DE3) to obtain the gene AdSHMT shown in SEQ ID NO.2. E160L / E193Q / E266M and recombinant strain E. coli BL21 / pET28a-AdSHMT E160L / E193Q / E266M .

[0051] P1 GACTACGACCAGGTGCTCGAACTGGCCCGCGAGC

[0052] P2 CTCGCGGGCCAGTTCGAGCACCTGGTCGTAGTCGATCAGG

[0053] P3 CCGCACCATCGCCGATCAGGTGGGCGCGGTATTGATGG

[0054] P4 CCCACCTGATCGGCGATGGTGCGG

[0055] P5 CAGGGCGGTCCTTGATGCACGTGATCGCGGCC

[0056] P6 GGCCGCGATCACGTGCATCAGAGGACCGCCCTG

[0057] Recombinant strain E. coli BL21 / pET28a-AdSHMT E160L / E193Q / E266M The fermentation and enzyme purification methods are the same as in Example 1, yielding a pure enzyme solution of the serine hydroxymethyltransferase mutant (e.g., Figure 2 As shown, lane 3 is a triple mutant pure enzyme solution. The purified enzyme obtained was added with 10% glycerol and stored at 4°C for later use.

[0058] Example 3: Determination of enzyme activity and enzymatic properties of wild-type and mutant enzymes

[0059] The 1 mL reaction system for the enzyme-substrate reaction used the following concentrations: 100 mM DL-β-phenylserine, 50 μM pyridoxal phosphate, 50 mM Na₂SO₄, and 1 mM Na₂EDTA. Before the reaction, the buffer was preheated at 40 °C for 5 min, then 30 μL of enzyme solution was added, and the reaction was carried out at 40 °C and pH 6.5 for 30 min. Finally, the mixture was centrifuged. The sample was diluted 20-fold with ultrapure water, and the UV absorbance at 279 nm was detected using a microplate reader.

[0060] Enzyme activity unit (U) is defined as the amount of enzyme required to produce 1 μmol of benzaldehyde per minute under the conditions described above. The enzyme activity is equivalent to the activity of 1 mg of pure enzyme, expressed in U / mg.

[0061] (1) Enzyme activity assay

[0062] Under the above reaction conditions, the wild-type serine hydroxymethyltransferase AdSHMT (amino acid sequence shown in SEQ ID NO.3) and AdSHMT were determined. E160L / E193Q / E266M The enzyme activity (e.g., amino acid sequence as shown in SEQ ID NO.1) of the mutant when reacting with DL-β-phenylserine at 40℃. Figure 1 As shown in Figure A), the results show that AdSHMT E160L / E193Q / E266M The mutant's specific enzyme activity was 1.35 times that of the wild type.

[0063] (2) Determination of optimal reaction temperature and optimal reaction pH

[0064] The enzyme activity was determined under different temperature and pH conditions. Buffer solutions were used to control the pH of the reaction system: 50 mmol citrate buffer for pH 4–6, 50 mmol Tris-HCl buffer for pH 6–8, and 50 mmol Gly-NaOH buffer for pH 8–10. The enzyme activity of wild-type and mutant enzymes was measured at temperatures of 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, and 70℃.

[0065] The results are as follows Figure 1 Figures B and C show that, at pH 6.5 (50 mM Tris-HCl buffer), the optimal temperature for both the wild type and the mutant was 40 °C, and the enzyme activity was highest at pH 6.5, with the mutant exhibiting 1.35 times the activity of the wild type.

[0066] (3) Determination of enzyme kinetic parameters

[0067] The assay method involved measuring the specific enzyme activity to different concentrations of DL-β-phenylserine (1, 5, 10, 25, 50, 100, 200, 500, 1000 μM) to calculate the kinetic parameter K of DL-β-phenylserine for wild-type and mutant individuals. m V max and K cat .

[0068] Under optimal reaction conditions of 40°C and pH 6.5 (50 mM Tris-HCl buffer), the kinetic constant K of wild-type p-DL-β-phenylserine was determined. m 10.38 μM, K cat / K m It is 0.35s -1 μM -1 The kinetic constant K of the mutant on DL-β-phenylserine m 4.36 μM, K cat / K m It is 1.09s -1 μM -1 .

[0069] (4) Stability test

[0070] Wild-type and mutant strains were incubated at 40℃ and pH 6.5 for 24 h, and the residual enzyme activity was measured at 1, 2, 4, 6, 12, and 24 h. Incubation time of 0 h was considered 100%.

[0071] The results are as follows Figure 1 D shows that after incubation at 40℃ and pH 6.5 for 24 hours, the residual enzyme activity of the wild-type enzyme was 31.7% of the initial value, while the residual enzyme activity of the mutant was 77.5% of the initial value.

[0072] Example 4: E. coli BL21 / pET28a-AdSHMT E160L / E193Q / E266M L-Serine preparation by engineered bacteria

[0073] The strains E. coli BL21 / pET28a-AdSHMT and E. coli BL21 / pET28a-AdSHMT were respectively... E160L / E193Q / E266M Used for the conversion of L-serine. In a 200 mL system with 50 mM Tris-HCl solution as a buffer, the bacterial cell OD... 600nm The concentration was controlled at 15. 1.2M glycine, 1.2M formaldehyde, 0.4mM pyridoxal phosphate and 10mM tetrahydrofolate were added to the buffer system and the reaction was carried out at 40℃ for 24h.

[0074] HPLC was used to detect glycine and L-serine (e.g.) in the reaction solution. Figure 3 (As shown). The reaction solution was boiled in a water bath for 10 min, then centrifuged at 12000 rpm for 20 min at 4℃. The supernatant was diluted 100-fold with ultrapure water and filtered through a 0.22 μm membrane. Then, it was derivatized with phthalaldehyde before injection. Chromatographic column: Agilent C18 column (250 × 4.6 mm, 5 μm); mobile phase: A: 10 mmol / L disodium hydrogen phosphate and 10 mM sodium borate solution, pH adjusted to 8.2 with hydrochloric acid; B: methanol:acetonitrile:water, 45:45:10 (v:v:v). Detector: UV detector, detection wavelength: 338 nm; column temperature: 40℃; injection volume: 20 μL; flow rate: gradient elution.

[0075] The results showed that E. coli BL21 / pET28a-AdSHMT E160L / E193Q / E266M The final yield reached 92.88 g / L, with a final substrate molar conversion rate of 73.7%, which is 3.26 times that of E. coli BL21 / pET28a-AdSHMT. These results indicate that the catalytic efficiency of this mutant enzyme is significantly improved using E. coli as the substrate cell, demonstrating broad prospects for industrial application.

Claims

1. A serine hydroxymethyltransferase, characterized in that, The serine hydroxymethyltransferase uses the amino acid sequence shown in SEQ ID NO.3 as the parent, with the parent's glutamic acid at position 160 mutated to leucine, glutamic acid at position 193 mutated to glutamine, and glutamic acid at position 266 mutated to methionine; the amino acid sequence of the serine hydroxymethyltransferase is shown in SEQ ID NO.

1.

2. The gene encoding the serine hydroxymethyltransferase of claim 1.

3. A vector containing the gene of claim 2.

4. A recombinant cell, characterized in that, The recombinant cell contains the gene of claim 2, or the vector of claim 3.

5. The recombinant cell according to claim 4, characterized in that, The recombinant cells used Escherichia coli as the host.

6. A method for producing L-serine, characterized in that, The method involves reacting a substrate containing glycine and formaldehyde with the serine hydroxymethyltransferase of claim 1, or the recombinant cells of claim 4 or 5, in the presence of a coenzyme to produce L-serine; the coenzyme includes tetrahydrofolate and pyridoxal phosphate.

7. The method according to claim 6, characterized in that, The reaction temperature is 30-55℃.

8. An enzyme preparation, characterized in that, The enzyme preparation contains the serine hydroxymethyltransferase of claim 1, or the recombinant cells of claim 4 or 5.

9. The use of the serine hydroxymethyltransferase of claim 1, or the recombinant cells of claim 4 or 5, in the food industry.

10. The application according to claim 9, characterized in that, The application includes using the serine hydroxymethyltransferase or the recombinant cells for the production of L-serine or L-serine-containing products.

Citation Information

Patent Citations

  • Serine hydroxymethyltransferase mutant and application thereof in production of L-serine

    CN121628869A