Gene osranbp1 for controlling grain length of rice and genetic engineering application thereof

CN117646009BActive Publication Date: 2026-09-25NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311681905.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-08
Publication Date
2026-09-25
Estimated Expiration
2043-12-08

AI Technical Summary

Benefits of technology

[0018]1、本发明公开了水稻OsRanBP1基因的粒型基因工程应用,该基因来自水稻(Oryzasativa L.),过量表达该基因可以增加水稻粒长,利于水稻粒型的遗传改良。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117646009B_ABST
    Figure CN117646009B_ABST
Patent Text Reader

Abstract

The application belongs to the field of genetic engineering, and discloses a gene OsRanBP1 for controlling rice grain length and genetic engineering application thereof.The cDNA sequence of the gene is shown as SEQ ID NO.1, overexpression of the rice gene OsRanBP1 can increase the rice grain length and leaf angle, and is beneficial to genetic improvement of the rice grain type.The grain length of the OsRanBP1 function loss mutant is shortened, the leaf angle is reduced, and the ear length is reduced; and the OsRanBP1 gene can be used for genetic improvement of yield traits of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and relates to a gene OsRanBP1 that controls rice grain length and its genetic engineering applications. Background Technology

[0002] Rice (Oryza sativa L.) is the staple food of more than half of the world's population. With the increasing global population, increasing rice yield is a crucial way to ensure food security. Grain size, including grain length, width, and thickness, are all decisive factors directly affecting rice grain weight and yield, and are important target traits for breeding selection (Xing et al., 2010; Zuo et al., 2014; Zhao et al., 2022). In recent years, many genes related to grain size have been discovered. These genes participate in different regulatory pathways, including G protein signaling pathways, ubiquitin-proteasome-mediated degradation pathways, mitogen-activated protein kinase (MAPK) signaling pathways, plant hormones, and transcriptional regulation.

[0003] Genes controlling grain length include GRAIN SIZE 3 (GS3) (Fan et al. 2006), GRAIN LENGTH4 (GL4) (Wu et al. 2006), THOUSAND GRAIN WEIGHT 3 / GRAIN LENGTH 3.3 (TGW3 / GL3.3) (Xia et al. 2018; Ying et al. 2018), GRAIN LENGTH 7 (GL7) (Wang et al., 2015), and GRAINSHAPE 9 (GS9) (Zhao et al. 2018). Genes controlling grain width include GRAIN WIDTH 2 (GW2) (Song et al. 2007), GRAIN WIDTH 5 (GW5) (Weng et al. 2008), and GRAIN WIDTH 8 (GW8) (Wang et al. 2012). The control of thousand-grain weight includes GRAIN WIDTH 6a (GW6a) (Song et al. 2015) and THOUSANDGRAIN WEIGHT 6 (TGW6) (Ishimaru et al. 2013).

[0004] GS3 is a major QTL in rice that simultaneously controls grain length and weight (Fan et al. 2006, 2009). A single nucleotide mutation in the GL4 gene affects thousand-grain weight and yield per plant in rice (Wu et al. 2017). TGW3 / GL3.3 is a negative regulator of grain length, synergistically altering the size and number of glume cells (Ying et al. 2018), and has a genetic epistatic effect with GS3, significantly increasing grain size when acting in conjunction with this gene (Xia et al. 2018). GL7 regulates both grain length and improves rice appearance quality through changes in tandem repeat copy number (Wang et al. 2015). GW2 and GW5 regulate grain width and weight via the ubiquitin-proteasome pathway (Song et al. 2007; Wenger et al. 2008). GW7 affects grain length by regulating cell division, while GW8 regulates both grain size and quality (Wang et al. 2012). GW8 can directly bind to the GW7 promoter and inhibit its expression (Wang et al. 2015).

[0005] Our laboratory previously discovered that the key rice grain length regulator qGL3 / OsPPKL1 dephosphorylates OsGSK3 to stabilize its expression, thereby regulating brassinosteroid (BR) signaling. To further investigate the molecular network of qGL3 regulating BR and the molecular mechanism of rice grain length, our laboratory selected m-qgl3 and NIL... qgl3 Phosphorylated proteomics analysis of the materials and their corresponding wild-type materials DJ and 9311 revealed a nucleoplasmic transporter OsRanBP1 with a significantly decreased phosphorylation level. Summary of the Invention

[0006] The purpose of this invention is to disclose the cloning of the rice grain length-regulating gene OsRanBP1 and its genetic engineering application in rice grain length traits. Overexpression of the rice gene OsRanBP1 can increase rice grain length, which can be applied to the genetic improvement of rice grain shape. OsRanBP1 loss-of-function mutants have shorter grain length and reduced panicle length, which can be used for the genetic improvement of rice yield traits.

[0007] The first objective of this invention is to provide the OsRanBP1 gene, the cDNA sequence of which is shown in SEQ ID NO.1:

[0008]

[0009] Furthermore, the amino acid sequence encoded by the OsRanBP1 gene is shown in SEQ ID NO.2.

[0010] A second objective of this invention is to provide an overexpression vector containing the aforementioned rice gene OsRanBP1.

[0011] Furthermore, the overexpression vector is obtained by inserting the aforementioned rice OsRanBP1 gene between the KpnⅠ and SalⅠ restriction sites of the plant binary expression vector pCAMBIA1300s.

[0012] A third objective of this invention is to provide the application of the aforementioned OsRanBP1 gene in altering rice seed length.

[0013] Furthermore, overexpression of the aforementioned OsRanBP1 gene can increase rice grain length, while knocking out or silencing the aforementioned OsRanBP1 gene can reduce rice grain length.

[0014] A fourth objective of this invention is to provide the application of overexpression of the aforementioned OsRanBP1 gene or the aforementioned overexpression vector in improving rice yield.

[0015] Furthermore, overexpression of the aforementioned OsRanBP1 gene or the aforementioned overexpression vector can increase rice grain length and / or increase leaf angle.

[0016] A fifth objective of this invention is to provide the application of knocking out or silencing the aforementioned OsRanBP1 gene in improving rice yield.

[0017] Beneficial effects

[0018] 1. This invention discloses the application of grain shape gene engineering of the rice OsRanBP1 gene, which is derived from rice (Oryzasativa L.). Overexpression of this gene can increase rice grain length, which is beneficial to the genetic improvement of rice grain shape.

[0019] 2. The OsRanBP1 gene in this invention also controls the leaf angle and panicle length of rice, providing a new resource for high-yield and high-quality breeding of rice to increase photosynthetic efficiency.

[0020] 3. The OsRanBP1 gene loss-of-function mutant in this invention has shorter grain length and reduced panicle length, providing a new and effective approach for rice trait regulation and screening. Attached Figure Description

[0021] Figure 1 Construction of transgenic materials for gene editing and overexpression of OsRanBP1

[0022] Figure 1 Validation of A.OsRanBP1 gene-editing materials;

[0023] Figure 1 B. Schematic diagram of the restriction enzyme sites of the overexpression vector pCAMBIA1300s;

[0024] Figure 1 C. Validate OsRanBP1 gene editing and overexpression transgenic materials using Western blotting technology.

[0025] Figure 2 Grain phenotype of OsRanBP1 transgenic material

[0026] Figure 2 A comparison of grains from gene-edited and overexpressed transgenic lines of A.OsRanBP1, with the image of brown rice with the husk removed on the right.

[0027] Figure 2 Statistical graph of grain length in gene-edited and overexpressed transgenic lines of B.OsRanBP1.

[0028] Figure 3 Leaf angle and panicle phenotype of OsRanBP1 gene-edited and overexpressed transgenic lines

[0029] Figure 3 A and Figure 3 B. Comparison of leaf angle and spikelet shape between OsRanBP1 gene-edited and overexpressed transgenic lines;

[0030] Figure 3 Statistical graph of leaf angle in gene-edited and overexpressed transgenic lines of C.OsRanBP1;

[0031] Figure 3 Statistical graph of spike length in D.OsRanBP1 gene-edited and overexpressed transgenic lines. Detailed Implementation

[0032] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0033] Example 1: Construction of gene editing vectors for overexpression and knockout of OsRanBP1 gene

[0034] 1. Construction of overexpression vector:

[0035] (1) Fifty plump seeds of the rice variety 'Zhonghua 11' (ZH11) were selected, disinfected with 10% sodium hypochlorite solution for 20 min, and rinsed 5 times with pure water to remove sodium hypochlorite from the seed surface. The seeds were soaked in pure water until they sprouted, and then sown in nutrient soil and grown in an artificial climate incubator (16h light / 8h darkness, 30℃ during the day and 26℃ at night). When the seedlings reached the 3-4 leaf stage, preserved rice seedling samples were taken, and rice RNA was extracted according to the Invitrogen Trizol method. The quality and concentration of RNA were analyzed by 1% agarose gel electrophoresis, and total RNA of acceptable quality was further used to synthesize the first strand of cDNA. The synthesis of the first strand of cDNA was performed according to the Vazyme reverse transcription system manual.

[0036] (2) Using the first strand of cDNA synthesized by reverse transcription as a template, OsRanBP1 was cloned by PCR. PCR amplification was performed using primer pairs: F1: CCGCCGTTTCTGGTAATCT (SEQ ID NO.3), R1: ATGGACTCGGTGCATTGTG (SEQ ID NO.4). The cloned fragment was ligated into the pEasy Blunt Simple vector, transformed into Escherichia coli strain DH5α, and sequenced to obtain the recombinant plasmid T-OsRanBP1 containing the cDNA sequence of the rice OsRanBP1 gene shown in SEQ ID NO.1.

[0037] (3) Based on the cDNA sequence of the rice OsRanBP1 gene, primer pairs were designed to amplify the complete coding reading frame: F2: GCTTTGCGAGCTCGGTACCATGGCAGACGAG (SEQ ID NO.5), containing the KpnⅠ restriction endonuclease site; R2: GCCTTGCTCACCATGGTACCATCATCTGATG (SEQ ID NO.6), containing the SalⅠ restriction endonuclease site. Using the correctly sequenced recombinant plasmid T-OsRanBP1 obtained in step (2) as a template, PCR amplification was performed, and the amplified product was inserted between the KpnⅠ and SalⅠ restriction sites of the plant binary expression vector pCAMBIA1300s. Figure 1 B) The overexpression vector pCAMBIA1300s-OsRanBP1 was obtained.

[0038] Obtaining transgenic plants: The obtained overexpression vector pCAMBIA1300s-OsRanBP1 was transformed into Agrobacterium strain EHA105 by heat shock. The T-DNA region of the overexpression vector was integrated into the genome of the japonica rice variety Zhonghua 11 using Agrobacterium-mediated rice genetic transformation, thereby obtaining transgenic rice with OsRanBP1 overexpression.

[0039] 2. Construction of gene editing vector to knock out the OsRanBP1 gene:

[0040] Two target sites were selected in the exon region of OsRanBP1, with a distance of 500 bp between them. The target sites ended with NGG. The target sites had poor specificity with other non-target genes but good characteristics with the target gene, resulting in low off-target effects.

[0041] The sequence of target 1 is: 5'-AGGAGCATGCTCCAACGTCT-3' (SEQ ID NO.7).

[0042] The sequence of target 2 is: 5'-AGTGGTAGCTGGAGAGGCCA-3' (SEQ ID NO.8).

[0043] Design primers containing the target sequence MT1-OsRanBP1-BsF:

[0044] The pCBC-MT1T2 plasmid was amplified using the following primers: ATATATGGTCTCTGGCGGGAGCATGCTCCAACGTCTGTT (SEQ ID NO.9), MT2-OsRanBP1-BsR:ATTATTGGTCTCTAAACTGGCCTCTCCAGCTACCACC (SEQ ID NO.10), MT1-OsRanBP1-F0:TGGGAGCATGCTCCAACGTCTGTTTTAGAGCTAGAAATAGC (SEQ ID NO.11), and MT2-OsRanBP1-R0:AACTGGCCTCTCCAGCTACCACCGCTTCTTGGTGCC (SEQ ID NO.12).

[0045] The obtained fragment was ligated to the pBUE411 vector using T4 Ligase (NEB), then transformed into DH5α competent cells, plated on kanamycin LB agar plates, and incubated at 37°C for 24 h. Positive single clones were amplified using primers OsU3-FD3: GACAGGCGTCTTCTACTGGTGCTAC (SEQ ID NO.13) and TaU3-RD: CTCACAAATTATCAGCACGCTAGTC (SEQ ID NO.14), and confirmed by sequencing OsU3-FD3 and TaU3-FD2: TTGACTAGCGTGCTGATAATTTGTG (SEQ ID NO.15). Bacterial cultures that successfully aligned with the target sequence were propagated and transformed into Agrobacterium to construct transgenic materials, obtaining the OsRanBP1 loss-of-function mutant.

[0046] Example 2: Identification of gene-edited and overexpressed transgenic lines of OsRanBP1

[0047] Primers designed to verify the cr-osranbp1 mutant were cr-osranbp1-F: CCTGCGTAAGTTTTACGACATCAT (SEQ ID NO.16) / cr-osranbp1-R: GAGATTGCTGAAGAAGAGGATGGAG (SEQ ID NO.17). Total DNA was extracted from the cr-osranbp1 mutants cr1-osranbp1 and cr2-osranbp1, as well as wild-type 'ZH11' plants. PCR amplification was performed using the above DNA as templates. The target fragment was 697 bp. Products with the correct band size were sent to the company for sequencing. The sequencing results were used to identify the mutation status of the transgenic plants. Figure 1 A).

[0048] To verify the protein expression level of OsRanBP1 in transgenic plants, an OsRanBP1 protein antibody was purchased from Ibotek and analyzed using a Western blot experiment. The results showed that, compared with the wild-type 'ZH11', the protein content of OsRanBP1 in the two lines of the cr-osranbp1 mutant material was significantly reduced; conversely, the protein expression levels of OsRanBP1 in the two homozygous overexpression lines OX1-OsRanBP1 and OX2-OsRanBP1 were significantly increased. Figure 1 C), therefore, these transgenic plant lines can all be used for subsequent experimental analysis in this study.

[0049] Example 3: Cultivation of gene-edited and overexpressed transgenic lines of OsRanBP1

[0050] The OsRanBP1 transgenic material plants, which had undergone positive validation in Example 1, and the wild-type ZH11 were planted at the Baima Teaching Base of Nanjing Agricultural University. Each line was planted in 3 rows with 8 plants per row, and conventional soil and fertilizer management was applied. After the seeds matured, the panicle stem nodes of each group of rice were cut off for panicle length measurement, and the leaf angle was measured by cutting off the second leaf from the top along with the stem. The harvested seeds were dried at 42℃ for 5 days before grain length analysis.

[0051] It was found that the grain length of cr-osranbp1 was significantly shorter than that of wild type, while the grain length of OsRanBP1 overexpressing plants was significantly longer than that of wild type. Figure 2 ).

[0052] Observation of leaf angles at maturity in OsRanBP1 transgenic plants revealed that the leaf angles of cr-osranbp1 were not significantly different from those of wild-type plants, while the leaf angles of OsRanBP1 overexpression plants were significantly increased. Figure 3 (A and 3C).

[0053] Further measurements of the ear length of OsRanBP1 transgenic plants revealed that the ear length of cr-osranbp1 plants was significantly shorter than that of wild-type plants, while the ear length of OsRanBP1 overexpression plants showed no significant difference compared to wild-type plants. Figure 3 B and 3D).

[0054] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. OsRanBP1 Genes or containing OsRanBP1 The application of gene overexpression vectors in altering rice seed length and / or increasing leaf angle is characterized by, The OsRanBP1 The cDNA sequence of the gene is shown in SEQ ID NO.

1. Overexpression OsRanBP1 Genes increase rice grain length and / or increase rice leaf angle.

2. The application according to claim 1, characterized in that, The overexpression vector is a vector that... OsRanBP1 Gene insertion into the plant binary expression vector pCAMBIA1300s Kpn I and Saddle I. Obtained between enzyme cleavage sites.

3. OsRanBP1 The application of genes in altering rice seed length is characterized by, The OsRanBP1 The cDNA sequence of the gene is shown in SEQ ID NO.1; knockout or silencing. OsRanBP1 Genes reduce rice grain length.