Universal hydrogel carrier for pathogen detection and its use as a sensor

Abstract

The application aims to provide a universal hydrogel carrier for pathogenic bacteria detection, and solves the problem of low timeliness in pathogenic bacteria detection and the problem of inability to realize rapid on-site quantitative detection. A conjugate HA-DNA is formed by hyaluronic acid and DNA single strand, the conjugate HA-DNA is mixed with pathogenic bacteria aptamer and dialdehyde chitosan manganese dioxide nanoscale enzyme, carboxyl and amino are combined, and base complementary pairing is used, the conjugate HA-DNA is used as a skeleton, the pathogenic bacteria aptamer is used as a crosslinking agent, and a spatial three-dimensional structure embedding the dialdehyde chitosan manganese dioxide nanoscale enzyme is formed.

Description

Technical Field

[0001] This invention relates to pathogen detection carriers and their detection applications, and more particularly to universal hydrogel carriers for pathogen detection and their applications as sensors. Background Technology

[0002] Pathogen detection has broad application prospects in the fields of public safety, public health, and life and health. Pathogen detection includes qualitative and quantitative detection. Quantitative detection often provides users with a more intuitive understanding, and the timeliness of pathogen detection is also important. People often want to know the test results as quickly as possible, and in many cases, faster testing means greater practical value.

[0003] Pathogenic bacteria detection is not a new technology. For example, the current gold standard for pathogenic microorganism detection still relies on microbial culture or PCR amplification instruments, which have relatively poor timeliness. While these tests are generally more rigorous and accurate, they are often unusable in many situations due to limitations in time and equipment. Therefore, developing a simple, rapid, and cost-effective method for the quantitative determination of pathogenic bacteria is undoubtedly of great value.

[0004] Novel polymeric hydrogels with three-dimensional (3D) network structures have attracted widespread attention as detection platforms due to their stability, cost-effectiveness, and ease of storage. DNA hydrogels utilize synthetic polymers as a backbone and DNA as a cross-linking agent. These hydrogels are designed to induce collapse based on target settings, releasing a carrier for detecting sensitive signals during this process. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to provide a universal hydrogel carrier for pathogen detection, thereby solving the issues of insufficient timeliness and inability to achieve rapid on-site quantitative detection in the process of pathogen detection.

[0006] The technical solution involves forming a conjugate HA-DNA from hyaluronic acid and single-stranded DNA. The conjugate HA-DNA is then mixed and reacted with a pathogenic aptamer and a dialdehyde chitosan manganese dioxide nanozyme. By utilizing the combination of carboxyl and amino groups and complementary base pairing, the conjugate HA-DNA forms a backbone, and the pathogenic aptamer acts as a cross-linking agent, thus forming a three-dimensional spatial structure that encapsulates the dialdehyde chitosan manganese dioxide nanozyme.

[0007] In the above or some embodiments, a hyaluronic acid mixture is prepared by separately preparing EDC, NHS and hyaluronic acid solutions, and mixing them to form a hyaluronic acid mixture formed by mixing EDC, NHS and hyaluronic acid solutions, thereby activating the carboxyl groups of the hyaluronic acid mixture; Single-stranded DNA was slowly added dropwise to a hyaluronic acid mixture after carboxyl activation, so that the carboxyl groups of hyaluronic acid in the hyaluronic acid mixture combined with the amino groups at the ends of the single-stranded DNA to form a conjugate HA-DNA. The target pathogenic bacteria aptamer solution and the dialdehyde chitosan manganese dioxide nanozyme solution were added dropwise to the HA-DNA conjugate solution and mixed for reaction. The target pathogenic bacteria aptamer acted as a cross-linking agent, forming a hydrogel with a three-dimensional structure of dialdehyde chitosan manganese dioxide nanozyme through the combination of acid carboxyl and amino groups and the complementary pairing of bases.

[0008] In the above or some embodiments, the concentration of the EDC solution is 97.6 mg / mL, the concentration of the NHS solution is 23 mg / mL, and the concentration of the hyaluronic acid solution is 0.5%-1%. The above solutions are mixed in a volume ratio of 1:1:8 to form a hyaluronic acid mixture of EDC, NHS, and hyaluronic acid solution, and the mixture is thoroughly mixed and incubated at 37°C to activate the carboxyl groups.

[0009] In the above or some embodiments, single-stranded c1DNA and c2DNA with a concentration of 50μM were added dropwise to the hyaluronic acid mixture, the volume ratio of hyaluronic acid mixture to DNA was 4:1, and the incubation reaction yielded HA-c1DNA and HA-c2DNA of the target hyaluronic acid and DNA.

[0010] In the above or some embodiments, the HA-c1DNA, HA-c2DNA, pathogenic aptamer, and dialdehyde chitosan manganese dioxide nanozyme are mixed and reacted, with the volume ratio of HA-c1DNA:HA-c2DNA:pathogenic aptamer:DAC / MnO2 being 1:1:1:200.

[0011] This invention also provides a universal hydrogel carrier for pathogen detection as a sensor application. The hydrogel carrier includes a pathogen aptamer. When the pathogen aptamer comes into contact with a pathogen, the pathogen binds to the pathogen aptamer with high affinity, leading to the disintegration of the hydrogel carrier and the exposure of the internal dialdehyde chitosan manganese dioxide nanozyme. The degree of disintegration of the hydrogel carrier is positively correlated with the pathogen content, that is, the amount of dialdehyde chitosan manganese dioxide nanozyme exposed by disintegration is positively correlated with the pathogen content. Standard solutions were prepared by adding different concentrations of pathogenic bacteria to a standard amount of hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and chromogenic substrate were added. The colorimetric signal values ​​of the standard solutions at a wavelength of 652 nm were measured under different concentrations of pathogenic bacteria. A standard curve was established to correlate different concentrations of the target bacteria with the colorimetric signal values. The target analyte was sampled and added to a standard hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and chromogenic substrate were added. The colorimetric signal value of the sample was measured at a wavelength of 652 nm. The obtained colorimetric signal value was substituted into the standard curve to obtain the concentration value of the target bacterial species in the curve.

[0012] In the above or some of the embodiments, the chromogenic substrate is tetramethylbenzidine (TMB).

[0013] In the above or some embodiments, the concentration of tetramethylbenzidine (TMB) in the colorimetric sensing system is 0.5-2.5 mM, and the concentration of H2O2 is 2-10 mM.

[0014] In the above or some embodiments, the pathogenic bacteria is one or a mixture of Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Escherichia coli.

[0015] The presence of foodborne pathogens in this invention allows for high-affinity binding to the aptamer, leading to hydrogel disintegration and exposure of the encapsulated DAC / MnO2. The degree of hydrogel disintegration is positively correlated with the amount of pathogens, enabling quantitative detection of foodborne pathogens. Due to the excellent catalytic properties of DAC / MnO2 and the good stimulus responsiveness of the DNA hydrogel, the developed aptamer sensor exhibits good analytical performance and can serve as a general platform for detecting foodborne pathogens. Furthermore, this method is characterized by low cost, simple operation, and high detection sensitivity. It enables real-time, on-site quantitative detection of various foodborne pathogens; this method can be used for pathogens ranging from 10⁻¹⁰ to 10⁻¹⁰. 5 The detection was performed within the CFU / mL concentration range, showing a good linear relationship, and has broad application prospects in sample testing, food safety analysis, and other fields. Attached Figure Description

[0016] Figure 1 This is a schematic diagram illustrating the on-site quantitative detection principle of the present invention.

[0017] Figure 2 This is a graph showing the results of direct detection of Salmonella using a colorimetric sensing platform.

[0018] Figure 3 This is a graph showing the results of direct detection of E. coli using a colorimetric sensing platform.

[0019] Figure 4 This is a graph showing the results of direct detection of Staphylococcus aureus using a colorimetric sensing platform.

[0020] Figure 5 This is a graph showing the selectivity results of the colorimetric sensing platform for Salmonella.

[0021] Figure 6This is a graph showing the selectivity results of the colorimetric sensing platform for Escherichia coli.

[0022] Figure 7 This is a graph showing the selectivity results of the colorimetric sensing platform for Staphylococcus aureus.

[0023] Figure 8 This is a bar chart showing the stability of the colorimetric sensing platform according to the method of the present invention. Detailed Implementation

[0024] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0025] In the description of this invention, "a plurality of" means two or more, unless otherwise explicitly specified.

[0026] This invention first provides a detection carrier that can be widely combined with a variety of pathogens. Specifically, it is a conjugate HA-DNA formed by hyaluronic acid and single-stranded DNA. The conjugate HA-DNA is mixed and reacted with pathogen aptamers and dialdehyde chitosan manganese dioxide nanozymes. By utilizing the combination of carboxyl and amino groups and complementary base pairing, the conjugate HA-DNA forms a backbone, and the pathogen aptamers act as cross-linking agents to form a three-dimensional spatial structure that embeds dialdehyde chitosan manganese dioxide nanozymes.

[0027] In the above or some embodiments, the hyaluronic acid mixture is first prepared by adding 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) solutions to two hyaluronic acid solutions and incubating the reaction at 37°C for a period of time. Preferably, the EDC, NHS, and hyaluronic acid solutions are prepared such that the concentration of the EDC solution is 97.6 mg / mL, the concentration of the NHS solution is 23 mg / mL, and the concentration of the hyaluronic acid solution is 0.5%-1%. The above solutions are mixed in a volume ratio of 1:1:8 to form the hyaluronic acid mixture, and the mixture is thoroughly mixed and incubated at 37°C to activate the carboxyl groups. Based on the above steps, single-stranded DNA is slowly added dropwise to the hyaluronic acid mixture after carboxyl activation, so that the carboxyl groups of hyaluronic acid in the hyaluronic acid mixture combine with the amino groups at the ends of the single-stranded DNA to form a conjugate HA-DNA; then, a solution of the target pathogenic bacteria aptamer and a solution of dialdehyde chitosan manganese dioxide nanozyme are added to the HA-DNA conjugate solution, and the mixture is reacted. The target pathogenic bacteria aptamer acts as a cross-linking agent, and through the combination of acid carboxyl groups and amino groups, as well as the complementary pairing of bases, a hydrogel with a three-dimensional spatial structure of dialdehyde chitosan manganese dioxide nanozyme is formed.

[0028] In the above or some embodiments, single-stranded c1DNA and c2DNA with a concentration of 50μM were added dropwise to the hyaluronic acid mixture, with a volume ratio of hyaluronic acid mixture to DNA of 4:1. The incubation reaction yielded HA-c1DNA and HA-c2DNA of the target hyaluronic acid and DNA.

[0029] In the above or some embodiments, the HA-c1DNA, HA-c2DNA, pathogenic aptamer, and dialdehyde chitosan manganese dioxide nanozyme (DAC / MnO2) are mixed and reacted, with the molar volume ratio of HA-c1DNA:HA-c2DNA:pathogenic aptamer:dialdehyde chitosan manganese dioxide nanozyme (DAC / MnO2) being 1:1:1:200.

[0030] In some embodiments, HA-c1DNA (15 μL, 10 μM), HA-c2DNA (15 μL, 10 μM), foodborne pathogens (5 μL, 30 μM), and DAC / MnO2 (30 μL, 1 mM) are mixed and incubated at 37°C with shaking for 10 hours to obtain the final hydrogel carrier.

[0031] The acetal chitosan manganese dioxide nanozyme (DAC / MnO2) can be prepared by the following method. The patent application filed by the co-inventors and applicant in this case regarding the preparation of the acetal chitosan manganese dioxide nanozyme is already in a published state.

[0032] (1) Preparation of dialdehyde chitosan: Chitosan was dissolved in an acetate buffer solution with a pH of 4.4-4.6 to prepare a chitosan acetic acid solution with a concentration of 15 mg / mL; a sodium periodate aqueous solution with a concentration of 0.05 g / mL was prepared, and then the prepared sodium periodate solution was slowly poured into the chitosan solution. The reaction mixture was stirred at 37-50℃ in the dark for 24-45 h. Then, 800-950 mL of anhydrous ethanol was added to terminate the reaction for 2-3 h and precipitate the crude product. Subsequently, the crude product was purified by dialysis in sodium chloride solution (0.2 mol / L) and deionized water for 36-48 h. (2) Preparation of DAC / MnO2 nanozyme: Manganese acetate with a concentration of 100mM and a volume of 1-1.5mL and the dialdehyde chitosan prepared in step (1) were prepared into an aqueous solution and magnetically stirred for the first time for 30-45min. After magnetic stirring at room temperature, sodium hydroxide aqueous solution with a concentration of 70mM and a volume of 4.6-5.2mL was added and magnetic stirring was continued vigorously at room temperature for 12-16h. Afterwards, the mixture was washed three times and dispersed in ultrapure water, wherein the volume of dialdehyde chitosan was 5mL and the concentration was 0.1-1mg / mL.

[0033] The present invention also provides a universal hydrogel carrier for the detection of pathogenic bacteria as a sensor, which can detect one or a mixture of Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Escherichia coli.

[0034] When the target of the test is E. coli The target of the detection was Escherichia coli, whose DNA sequence is as follows: c1DNA: NH2-TTTTGAAAGTCTACTGGT; c2DNA: NH2-TTTTTAGGGCACACGA; Pathogenic aptamer: ACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAA The target bacteria detected was Salmonella, whose DNA sequence is as follows: c1DNA: NH2-TTTCGCGCACAGGGGAA; c2DNA: NH2-TTTCCCCCACGCCCGT; Aptamers: ACGGGCGTGGGGGCAATGCCTGCTTGTAGGCTTCCCCTGTGCGCG The target bacteria for detection is Staphylococcus aureus, and its DNA sequence is as follows: c1DNA:NH2-TTTATAACGCAGAACTT; c2DNA: NH2-TTTCGTGAGAGGGCGC; aptamer: GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT The hydrogel carrier includes a pathogenic bacteria aptamer. When the pathogenic bacteria aptamer comes into contact with the pathogenic bacteria, the pathogenic bacteria bind to the pathogenic bacteria aptamer with high affinity, leading to the disintegration of the hydrogel carrier and the exposure of the internal dialdehyde chitosan manganese dioxide nanozyme. The degree of disintegration of the hydrogel carrier is positively correlated with the content of pathogenic bacteria, that is, the amount of dialdehyde chitosan manganese dioxide nanozyme exposed by disintegration is positively correlated with the content of pathogenic bacteria.

[0035] To achieve on-site quantitative detection, a standard curve can be established relating different concentrations of the target bacterial species to the colorimetric signal value. The specific process is as follows: Standard solutions were prepared by adding different concentrations of pathogenic bacteria to a standard amount of hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and chromogenic substrate were added. The colorimetric signal values ​​of the standard solutions at a wavelength of 652 nm were measured under different concentrations of pathogenic bacteria. Then, multiple points were established in a two-dimensional coordinate system with concentration as the abscissa and colorimetric signal value as the ordinate. The more detection points, the more ideal the curve. The target analyte was sampled and added to a standard hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and a chromogenic substrate were added. The colorimetric signal value of the sample was measured at a wavelength of 652 nm. The obtained colorimetric signal value was substituted into the standard curve to obtain the concentration value of the target bacterial species corresponding to the curve. The chromogenic substrate was tetramethylbenzidine (TMB), with a concentration of 0.5-2.5 mM, and the concentration of H2O2 was 2-10 mM.

[0036]

[0037] The experimental group consisted of solutions containing different concentrations of Salmonella, Escherichia coli, and Staphylococcus aureus, which also formed the control group. The Salmonella concentrations were 0 CFU / mL, 1.75 × 10⁻⁶ CFU / mL, and 1.75 × 10⁻⁶ CFU / mL, respectively. 2 CFU / mL, 1.75×10 3 CFU / mL, 1.75×10 4 CFU / mL, 1.75×10 5 CFU / mL; The concentrations of E. coli were 0 CFU / mL, 7.5 × 10 CFU / mL, and 7.5 × 10 CFU / mL, respectively. 2 CFU / mL, 7.5×10 3 CFU / mL, 7.5×10 4 CFU / mL, 7.5×10 5 CFU / mL; The concentrations of Staphylococcus aureus were 0 CFU / mL, 3.5 × 10 CFU / mL, and 3.5 × 10 CFU / mL, respectively. 2 CFU / mL, 3.5×10 3 CFU / mL, 3.5×10 4 CFU / mL Staphylococcus aureus concentration; The blank is a bacterial solvent, i.e., a physiological saline solution that does not contain bacteria. It represents a blank control experiment, i.e., the colorimetric value measured by ultraviolet light at 652nm when there are no bacteria, which is the initial colorimetric value.

[0038] Stability histogram method: After the prepared DNA gel was placed in a -4℃ refrigerator for 1 day, 5 days, 10 days, 20 days, and 35 days, 10... 3 After incubating the pathogenic bacteria at CFU / mL for 1 hour, H2O2 and TMB were added, and the colorimetric signal value was measured at 652 nm using a UV spectrophotometer.

[0039] Blank - blank space; S.ty - Salmonella typhimurium; List.m - Listeria monocytogenes; E.coli - Escherichia coli; S.aureus - Staphylococcus aureus; mix - a mixture of four bacteria.

[0040] The attached results were obtained using a UV4820 ultraviolet spectrophotometer. The addition of H2O2 and TMB to substances with peroxidase properties turns the solution blue and produces a peak at 652 nm under ultraviolet scanning. The size of the peak value represents the peroxidase activity; higher peroxidase activity results in a higher peak value.

[0041] The presence of foodborne pathogens in this invention allows for high-affinity binding to the aptamer, leading to hydrogel disintegration and exposure of the encapsulated DAC / MnO2. The degree of hydrogel disintegration is positively correlated with the amount of pathogens, enabling quantitative detection of foodborne pathogens. Due to the excellent catalytic properties of DAC / MnO2 and the good stimulus responsiveness of the DNA hydrogel, the developed aptamer sensor exhibits good analytical performance and can serve as a general platform for detecting foodborne pathogens. Furthermore, this method is characterized by low cost, simple operation, and high detection sensitivity. It enables real-time, on-site quantitative detection of various foodborne pathogens; this method can be used for pathogens ranging from 10⁻¹⁰ to 10⁻¹⁰. 5 The detection was performed within the CFU / mL concentration range, showing a good linear relationship, and has broad application prospects in sample testing, food safety analysis, and other fields.

Claims

1. A universal hydrogel carrier for pathogen detection, comprising a conjugate HA-DNA formed by hyaluronic acid and single-stranded DNA, wherein the conjugate HA-DNA is mixed and reacted with pathogen aptamers and dialdehyde chitosan manganese dioxide nanozymes, utilizing the combination of carboxyl and amino groups and complementary base pairing to form a three-dimensional structure in which the conjugate HA-DNA serves as the backbone and the pathogen aptamers serve as cross-linking agents.

2. The universal hydrogel carrier for pathogen detection according to claim 1, characterized in that, A hyaluronic acid mixture was prepared by separately preparing EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride), NHS (N-hydroxysuccinimide), and hyaluronic acid solutions, and mixing them to form a hyaluronic acid mixture. This activated the carboxyl groups of the hyaluronic acid mixture. Single-stranded DNA was slowly added dropwise to a hyaluronic acid mixture after carboxyl activation, so that the carboxyl groups of hyaluronic acid in the hyaluronic acid mixture combined with the amino groups at the ends of the single-stranded DNA to form a conjugate HA-DNA. The HA-DNA conjugate solution was added to the target pathogenic bacteria aptamer solution and the dialdehyde chitosan manganese dioxide nanozyme solution, and the mixture was reacted to form a hydrogel with a three-dimensional spatial structure of the dialdehyde chitosan manganese dioxide nanozyme.

3. The universal hydrogel carrier for pathogen detection according to claim 2, characterized in that, The concentration of the EDC solution is 97.6 mg / mL, the concentration of the NHS solution is 23 mg / mL, and the concentration of the hyaluronic acid solution is 0.5%-1%. The above solutions are mixed in a volume ratio of 1:1:8 to form a hyaluronic acid mixture of EDC, NHS, and hyaluronic acid solution. The mixture is thoroughly mixed and incubated at 37°C to activate the carboxyl groups.

4. The universal hydrogel carrier for pathogen detection according to claim 3, characterized in that, Single-stranded c1DNA and c2DNA, each at a concentration of 50 μM, were added to a hyaluronic acid mixture. The volume ratio of the hyaluronic acid mixture to the DNA was 4:

1. The reaction was incubated to obtain HA-c1DNA and HA-c2DNA of the target hyaluronic acid and DNA.

5. The universal hydrogel carrier for pathogen detection according to claim 4, characterized in that, The HA-c1DNA, HA-c2DNA, pathogenic aptamer, and dialdehyde chitosan manganese dioxide nanozyme were mixed and reacted, with the volume ratio of HA-c1DNA:HA-c2DNA:pathogenic aptamer:DAC / MnO2 being 1:1:1:

200.

6. The hydrogel carrier according to any one of claims 1-5 is used as a sensor, wherein the hydrogel carrier includes a pathogenic bacteria aptamer. When the pathogenic bacteria aptamer comes into contact with pathogenic bacteria, the pathogenic bacteria bind to the pathogenic bacteria aptamer with high affinity, resulting in the disintegration of the hydrogel carrier and the exposure of the internal dialdehyde chitosan manganese dioxide nanoenzyme. The degree of disintegration of the hydrogel carrier is positively correlated with the content of pathogenic bacteria, that is, the amount of dialdehyde chitosan manganese dioxide nanoenzyme exposed by disintegration is positively correlated with the content of pathogenic bacteria. Standard solutions were prepared by adding different concentrations of pathogenic bacteria to a standard hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and a chromogenic substrate were added. The colorimetric signal values ​​of the standard solutions at a wavelength of 652 nm were measured under different concentrations of pathogenic bacteria to establish a standard curve relating different concentrations of the target bacterial species to the colorimetric signal values. The target analyte was sampled and added to a standard hydrogel carrier solution. After incubation for a period of time, sufficient hydrogen peroxide (H2O2) and a chromogenic substrate were added. The colorimetric signal values ​​of the sample were measured at a wavelength of 652 nm. The obtained colorimetric signal values ​​were substituted into the standard curve to obtain the corresponding concentration values ​​of the target bacterial species in the curve.

7. The application of the hydrogel carrier according to claim 6 as a sensor, characterized in that, The chromogenic substrate is tetramethylbenzidine (TMB).

8. The application of the hydrogel carrier according to claim 7 as a sensor, characterized in that, The concentration of the tetramethylbenzidine (TMB) is 0.5-2.5 mM, and the concentration of the H2O2 is 2-10 mM.

9. The application of the hydrogel carrier according to any one of claims 6-8 as a sensor, characterized in that, The pathogenic bacteria are one or a mixture of Salmonella, Staphylococcus aureus, Listeria monocytogenes, and Escherichia coli.

Images