A method for high-efficiency expression of sucrose in bacillus subtilis

Abstract

The application discloses a method for efficiently expressing sucrase by using bacillus subtilis, and belongs to the field of genetic engineering and bioengineering. The bacillus subtilis recombinant bacteria of the application take pBHSS4 as a carrier skeleton, take a sucrase gene derived from micromonospora echinospora as a target gene, and take bacillus subtilis WB600 as an expression host. The expression of the InvDz13 sucrase is successfully realized, and the optimal signal peptide SP YomL , the co-expression of the chaperone protein complex GrpE-DnaK-DnaJ, and the co-expression of the secretion pathway element SppA are obtained through screening, and the expression level of the sucrase is further improved. The bacillus subtilis recombinant bacteria of the application can efficiently express the sucrase, the enzyme activity of the sucrase in the supernatant of a shake flask fermentation reaches 61.14 U / mL at the most, and the process of industrialized production and application of the sucrase InvDz13 is accelerated.

Description

Technical Field

[0001] This invention relates to a method for efficiently expressing sucrase using Bacillus subtilis, belonging to the fields of genetic engineering and microbial engineering technology. Background Technology

[0002] Invertase (EC3,2,1,26), also known as β-D-fructofuranoside hydrolase, specifically catalyzes the hydrolysis of β-D-fructofuranoside bonds in non-reducing sugars, exhibiting relative specificity. It can catalyze the hydrolysis of sucrose to produce glucose and fructose, and also catalyze the hydrolysis of raffinose to produce melibiose and fructose.

[0003] Bacillus subtilis is a strain capable of efficiently secreting proteins and is widely used in the production of industrial enzyme preparations. It has the following advantages: (1) non-pathogenic and does not produce endotoxins or other substances; (2) strong protein secretion function; (3) no obvious codon bias, making it difficult for products to form inclusion bodies; and (4) simple and rapid culture. After inactivating six proteases in the genome of Bacillus subtilis strain WB600 using gene mutation, its protease activity was 0.32% of that of the wild-type strain, making it more conducive to the expression of exogenous proteins. However, the recombinant expression levels of different proteins in Bacillus subtilis varied significantly.

[0004] Four classic protein secretion pathways exist in Bacillus subtilis. Current strategies for optimizing protein secretion in Bacillus subtilis mainly focus on specific steps within these pathways to improve target protein expression levels. Examples include enhancing promoter transcriptional activity, screening for optimal signal peptides, and overexpressing molecular chaperones. However, the highest extracellular expression level of a target protein in Bacillus subtilis requires the coordinated action of all steps in the secretion pathway. Among these, the signal peptide is a crucial element for assisting precursor protein folding and guiding its transmembrane translocation, and it is a limiting factor affecting the efficiency and yield of heterologous protein secretion.

[0005] InvDz13, a sucrase derived from *Microbacterium trichothecenolyticum*, is currently the invertase with the highest reported specific activity for raffinose. It can hydrolyze raffinose into melobiose in soy milk under mild conditions, thereby improving the prebiotic properties of soy milk and having significant application value in the soybean processing industry. However, the low homologous expression level of sucrase InvDz13 limits its industrial production and application. Therefore, efficient extracellular expression of sucrase InvDz13 in *Bacillus subtilis* is of great significance. Summary of the Invention

[0006] To address the issue of low homologous expression levels of the InvDz13 sucrase, this invention successfully expressed the sucrase InvDz13 derived from *Microbacterium trichothecenolyticum* using pBHSS4 as the vector backbone and *Bacillus subtilis* WB600 as the expression host. The optimal signal peptide SP was then selected through screening. YomL The co-expression of the chaperone protein complex GrpE-DnaK-DnaJ and the co-expression of the secretion pathway element SppA further enhances the expression level of sucrase. The recombinant Bacillus subtilis strain of this invention can efficiently express sucrase; using it as the production strain, the highest sucrase activity in the shake-flask fermentation supernatant reached 61.14 U / mL.

[0007] This invention provides a recombinant Bacillus subtilis, which has undergone signal peptide screening and co-expressed molecular chaperones and secretion pathway elements.

[0008] In one embodiment of the present invention, the recombinant Bacillus subtilis expresses sucrase derived from Microbacterium trichothecenolyticum and undergoes one or more of the following modifications (a) to (c):

[0009] (a) Using SP YomL Signal peptide, SP YncM Signal peptide or SP YddT The signal peptide expresses the sucrase;

[0010] (b) Co-expressed one or more of the molecular chaperone proteins PrsA, GroESL, and DnaK; or expressed the chaperone protein complex grpE-dnaK-dnaJ;

[0011] (c) Co-expressed secretion pathway proteins secA, sipS, sipT, sppA or tepA.

[0012] In one embodiment of the present invention, the SP YomL Signal peptide, SP YncM Signal peptide, SP YddT The nucleotide sequences of the signal peptide are shown in SEQ ID NO.2 to 4, respectively.

[0013] In one embodiment of the present invention, the GENE IDs of the molecular chaperone proteins PrsA, GroESL, and DnaK are 939294 (prsA), 938006 (groES), 938045 (groEL), and QKJ78448.1 (DnaK), respectively.

[0014] In one embodiment of the present invention, the grpE-dnaK-dnaJ nucleotide sequence is shown in SEQ ID NO.5.

[0015] In one embodiment of the present invention, the GENE IDs of the secretion pathway proteins secA, sipS, sipT, and tepA are 936711 (secA), 938944 (sipS), 938763 (sipT), and 936370 (tepA), respectively, and the nucleotide sequence encoding the secretion pathway protein sppA is shown in SEQ ID NO.6.

[0016] In one embodiment of the present invention, the nucleotide sequence encoding the sucrase InvDz13 is shown in SEQ ID NO.1.

[0017] In one embodiment of the present invention, the recombinant Bacillus subtilis uses Bacillus subtilis WB600 as the expression host.

[0018] In one embodiment of the present invention, the recombinant Bacillus subtilis expresses sucrase and has at least two of the following improvements (a) to (c):

[0019] (a) Using signal peptide SP YomL Promotes the secretion of the target protein;

[0020] (b) Enhance the expression level of the target protein by co-expressing the chaperone protein complex GrpE-DnaK-DnaJ;

[0021] (c) Increase the expression level of the target protein by co-expressing the secretion pathway element SppA.

[0022] In one embodiment of the present invention, the signal peptide gene is inserted upstream of the target gene.

[0023] This invention also provides a method for increasing the expression level of sucrase in Bacillus subtilis, wherein the recombinant Bacillus subtilis expresses sucrase derived from Microbacterium trichothecenolyticum and undergoes one or more of the following modifications (a) to (c):

[0024] (a) Using SP YomL Signal peptide, SPYncM Signal peptide or SP YddT The signal peptide expresses the sucrase;

[0025] (b) Co-expressed one or more of the molecular chaperone proteins PrsA, GroESL, and DnaK; or expressed the chaperone protein complex grpE-dnaK-dnaJ;

[0026] (c) Co-expressed secretion pathway proteins secA, sipS, sipT, sppA or tepA.

[0027] In one embodiment of the present invention, the SP YomL Signal peptide, SP YncM Signal peptide, SP YddT The nucleotide sequences of the signal peptide are shown in SEQ ID NO.2 to 4, respectively.

[0028] In one embodiment of the present invention, the GENE IDs of the molecular chaperone proteins PrsA, GroESL, and DnaK are 939294 (prsA), 938006 (groES), 938045 (groEL), and QKJ78448.1 (DnaK), respectively.

[0029] In one embodiment of the present invention, the grpE-dnaK-dnaJ nucleotide sequence is shown in SEQ ID NO.5.

[0030] In one embodiment of the present invention, the GENE IDs of the secretion pathway proteins secA, sipS, sipT, and tepA are 936711 (secA), 938944 (sipS), 938763 (sipT), and 936370 (tepA), respectively, and the nucleotide sequence encoding the secretion pathway protein sppA is shown in SEQ ID NO.6.

[0031] In one embodiment of the present invention, the nucleotide sequence encoding the sucrase InvDz13 is shown in SEQ ID NO.1.

[0032] In one embodiment of the present invention, the recombinant Bacillus subtilis uses Bacillus subtilis WB600 as the expression host.

[0033] In one embodiment of the present invention, the recombinant Bacillus subtilis expresses sucrase and has at least two of the following improvements (a) to (c):

[0034] (a) Using signal peptide SP YomL Promotes the secretion of the target protein;

[0035] (b) Enhance the expression level of the target protein by co-expressing the chaperone protein complex GrpE-DnaK-DnaJ;

[0036] (c) Increase the expression level of the target protein by co-expressing the secretion pathway element SppA.

[0037] In one embodiment of the present invention, the signal peptide gene is inserted upstream of the target gene.

[0038] The present invention also provides a method for producing sucrase, wherein the method comprises preparing it by fermentation using the recombinant Bacillus subtilis.

[0039] In one embodiment of the present invention, the method is as follows: the engineered Bacillus subtilis bacteria are first inoculated into a seed culture medium and cultured at 35-38°C and 180-220 rpm for 8-12 hours to obtain a seed liquid; then the seed liquid is inoculated into a fermentation culture medium for fermentation culture to obtain a fermentation broth containing sucrase.

[0040] In one embodiment of the present invention, the seed culture medium comprises 8-12 g / L of peptone, 4-6 g / L of yeast extract, and 8-12 g / L of sodium chloride.

[0041] In one embodiment of the present invention, the fermentation culture is a shake flask fermentation culture, wherein the seed liquid is inoculated into the shake flask fermentation medium at an inoculation rate of 1% to 3%, and cultured at 30 to 37°C and 180 to 220 rpm for 45 to 50 hours; the shake flask fermentation medium contains: 8 to 12 g / L yeast extract, 14 to 18 g / L peptone, 4 to 6 g / L sodium chloride, 8 to 12 mM CaCl2, and 20 to 40 mg / L kanamycin, and the initial pH of the fermentation medium is 6 to 8.

[0042] The present invention also provides the application of the above-mentioned recombinant Bacillus subtilis engineered strain in the preparation of food containing sucrase, detergents, papermaking, textiles, alcohol and pharmaceuticals.

[0043] Beneficial effects

[0044] (1) This invention achieves recombinant extracellular expression of sucrase InvDz13 in Bacillus subtilis. Using the technical solution of this invention, Bacillus subtilis WB600 was used as the expression host, and pBHSS4 was used as the vector backbone to construct the recombinant Bacillus subtilis WB600 / pBHSS4-SP. YpuA -InvDz13, after 48 hours of shake-flask fermentation, showed a sucrase activity of 10.89 U / mL in the supernatant.

[0045] (2) The recombinant Bacillus subtilis WB600 / pBHSS4-SP strain constructed in this invention YpuA Based on InvDz13, the optimal signal peptide SP was obtained through screening. YomL The co-expression of the chaperone protein complex GrpE-DnaK-DnaJ and the secretion pathway element SppA resulted in a sucrase activity of up to 61.14 U / mL in the shake-flask fermentation supernatant, which greatly improved the sucrase activity and has great application potential in industrial production.

[0046] (3) The present invention relates to a method for efficient expression of sucrase by Bacillus subtilis, which provides a strategic reference for subsequent expression of other recombinant proteins by Bacillus subtilis and promotes the development of Bacillus subtilis protein expression systems. Attached Figure Description

[0047] Figure 1 This invention is pBHSS4-SP YpuA -InvDz13 Carrier Construction Logic Diagram.

[0048] Figure 2 This is a schematic diagram showing the location of the chaperone protein expression element in the vector according to the present invention.

[0049] Figure 3 This invention relates to the shake-flask fermentation sucrase activity of recombinant Bacillus subtilis strains containing different signal peptides; wherein A is strain B. subtilis WB600 / pBHSS4-SP. YpuA -InvDz13; B represents strain B. subtilis WB600 / pBHSS4-SP YvcE -InvDz13; C represents strain B. subtilis WB600 / pBHSS4-SP YbdG -InvDz13; D represents strain B. subtilis WB600 / pBHSS4-SP YddT -InvDz13; E represents strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13; F represents strain B. subtilis WB600 / pBHSS4-SP YoaW -InvDz13; G represents strain B. subtilis WB600 / pBHSS4-SP Pel -InvDz13; H represents strain B. subtilis WB600 / pBHSS4-SP YncM -InvDz13; I represents strain B. subtilis WB600 / pBHSS4-SPYhcR -InvDz13; J represents strain B. subtilis WB600 / pBHSS4-SP YdjM -InvDz13; K represents strain B. subtilis WB600 / pBHSS4-SP FliZ -InvDz13.

[0050] Figure 4 This invention relates to the shake-flask fermentation sucrase activity of recombinant Bacillus subtilis strains co-expressing different molecular chaperones; wherein E is the control strain B. subtilis WB600 / pBHSS4-SP. YomL -InvDz13; PS is strain B. subtilisWB600 / pBHSS4-SP YomL -InvDz13-prsA; DS represents strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-dnaK; GS is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL; DJ is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-grpE-dnaK-dnaJ; DP represents strain B. subtilisWB600 / pBHSS4-SP YomL -InvDz13-dnaK-prsA; GP is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL-prsA.

[0051] Figure 5 This invention relates to the shake-flask fermentation sucrase activity of recombinant Bacillus subtilis strains expressing different secretion pathway elements; wherein, E is the control strain B. subtilis WB600 / pBHSS4-SP. YomL -InvDz13; SA is strain B. subtilisWB600 / pBHSS4-SP YomL -InvDz13-secA; ST is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipT; PA is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-sppA; TA is strain B. subtilis WB600 / pBHSS4-SP YomL-InvDz13-tepA; SS is strain B. subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipS. Detailed Implementation

[0052] Unless otherwise specified, the implementation methods in the following embodiments are all conventional methods.

[0053] The detection methods involved in the following embodiments are as follows:

[0054] Methods for detecting sucrase activity:

[0055] Mix 120 μL of 1 M sucrose solution and 430 μL of 50 mM, pH 6.5 disodium citrate phosphate buffer thoroughly. Preheat at 35 °C for 10 min, add 50 μL of crude enzyme solution, shake to mix, react for 10 min, add 0.3 mL of DNS, shake, boil for 15 min, and then cool rapidly. Measure the spectrophotometry at 540 nm (using inactivated enzyme solution as a control).

[0056] Under the above conditions, the amount of enzyme required to hydrolyze 1 μmol of sucrose per unit time is defined as 1 U.

[0057] The culture media involved in the following examples are as follows:

[0058] Seed culture medium: 10 g / L peptone, 5 g / L yeast extract and 10 g / L sodium chloride.

[0059] Shake-flask fermentation medium: yeast extract 10 g / L, peptone 16 g / L, sodium chloride 5 g / L, CaCl2 10 mM, kanamycin 30 mg / L. The initial pH of the fermentation medium was 7.0.

[0060] LB solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 0.2 g / L agar powder.

[0061] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl.

[0062] Salt solution (T-base): 2 g / L (NH4)2SO4, 18.3 g / L K2HPO4·3H2O, 6 g / L KH2PO4, 1 g / L sodium citrate·2H2O.

[0063] GMI medium: 20 mL salt solution (T base), 0.2 mL 50% (w / v) glucose, 0.2 mL 2% (w / v) MgSO4, 0.2 mL 10% (w / v) yeast extract, 0.4 mL 1% (w / v) casein hydrolysate, and 0.5 mL 2 mg / mL tryptophan solution.

[0064] GMII medium: 10 mL salt solution (T base), 0.1 mL 50% (w / v) glucose, 0.1 mL 2% (w / v) MgSO4, 0.04 mL 10% (w / v) yeast extract, 0.02 mL 1% (w / v) casein hydrolysate, 0.01 mL 6% (w / v) CaCl2, 0.05 mL 10% (w / v) MgCl2, and 0.25 mL 2 mg / mL tryptophan solution.

[0065] Note: Except for the salt solution, all other solutions in GMI and GMII culture media must be sterilized separately and filtered to remove tryptophan. All components should be mixed before use.

[0066] Example 1: Construction of recombinant Bacillus subtilis and its shake-flask fermentation

[0067] The specific steps are as follows:

[0068] (1) Obtaining the carrier skeleton

[0069] Vector skeleton pBHSS4-SP YpuA The fragment was obtained by PCR amplification from pBHSS4Y using primers P1 / P2. Among them, SP... YpuA The GENE ID is CP053102.1. The method for constructing the pBHSS4Y vector is disclosed in He Li, et al. Enhanced extracellular raw starch-degrading α-amylase production in Bacillus subtilis through signal peptide and translation efficiency optimization. Biochemical Engineering Journal. 2022, 189: 108718.

[0070] The sequence information of primers P1 / P2 is shown in Table 1.

[0071] Table 1: Primer sequences

[0072] P1 TCTAGAGTCGACGTCCCCGGGGCAG P2 GGATCCGGCATCCGCGAGACTGACCTTC

[0073] The PCR amplification program was as follows: 94℃ pre-denaturation, 5 min; 94℃ denaturation, 10 s; 60℃ annealing, 10 s; 72℃ extension, 4 min; 30 cycles; 72℃, 10 min.

[0074] (2) Obtaining the InvDz13 sucrase gene

[0075] The InvDz13 sucrase gene fragment was obtained by PCR amplification using primers P3 / P4 with *Microbacterium trichothecenolyticum* colonies as a template. The sequence information of primers P3 / P4 is shown in Table 2, and the nucleotide sequence of the InvDz13 sucrase gene is shown in SEQ ID NO. 1.

[0076] Table 2: Primer sequences

[0077] P3 AGTCTCGCGGATGCCGGATCCGCACCGGTTGCCCCGGCTGC P4 CCGGGGACGTCGACTCTAGATCACGGCAGCGGGGTAACTT

[0078] The PCR amplification program was as follows: 94℃ pre-denaturation, 5 min; 94℃ denaturation, 10 s; 55℃ annealing, 10 s; 72℃ extension, 20 s; 30 cycles; 72℃, 10 min.

[0079] (3) Construction of a recombinant vector containing the InvDz13 sucrase gene

[0080] The vector backbone pBHSS4-SP obtained in step (1) was converted using POE-PCR. YpuA The fragment was ligated with the sucrase gene fragment obtained in step (2) to prepare the recombinant vector pBHSS4-SP. YpuA -InvDz13.

[0081] The POE-PCR reactions are shown in Table 3.

[0082] Table 3: POE-PCR reaction system

[0083]

[0084] The PCR amplification program was as follows: 94℃ pre-denaturation, 5 min; 94℃ denaturation, 10 s; 55℃ annealing, 10 s; 72℃ extension, 15 min; 30 cycles; 72℃, 20 min.

[0085] (4) Construction of recombinant Bacillus subtilis containing the InvDz13 sucrase gene

[0086] The POE-PCR PCR product was recombined into the vector pBHSS4-SP YpuATransforming InvDz13 into Bacillus subtilis WB600 competent cells yields recombinant transformants, namely the recombinant Bacillus subtilis strain WB600 / pBHSS4-SP containing the InvDz13 sucrase gene. YpuA -InvDz13.

[0087] The specific steps of Bacillus subtilis transformation are as follows:

[0088] Bacillus subtilis WB600 was streaked onto LB agar plates containing 30 mg / L kanamycin and incubated overnight at 37°C. A single colony was picked using an inoculation loop and inoculated into 5 mL of GMI solution, and cultured at 37°C with shaking at 200 rpm for 10–12 h. The next day, 2 mL of fresh culture was transferred to 18 mL of GMI solution and cultured at 37°C with shaking at 200 rpm for 4.5 h. Then, 10 mL of the above culture was transferred to 90 mL of GMII solution and cultured at 37°C with shaking at 200 rpm for 1.5 h to obtain competent cells. The competent cells were aliquoted into 500 μL 2 mL sterile centrifuge tubes for use. It is best to use competent cells immediately after preparation. During transformation, an appropriate amount of DNA (~1 μg) was added to 500 μL of competent cells. After incubating at 37℃ with gentle shaking at 120 rpm for 2.5 h, the culture was plated onto a plate containing 30 mg / L kanamycin and incubated overnight at 37℃. The next day, a single colony was picked and cultured in 5 mL of LB broth with shaking at 37℃ and 200 rpm for 12 h. The plasmid was then extracted and sent for sequencing. The correct sequence was the recombinant Bacillus subtilis WB600 / pBHSS4-SP containing the InvDz13 sucrase gene. YpuA -InvDz13.

[0089] (5) Shake-flask fermentation of recombinant Bacillus subtilis containing the InvDz13 sucrase gene

[0090] The recombinant Bacillus subtilis strain WB600 / pBHSS4-SP obtained in step (4) YpuA -InvDz13 was first inoculated into seed culture medium and cultured at 37℃ and 200rpm for 12h to obtain seed liquid. The seed liquid was then inoculated into shake flask fermentation medium at an inoculation rate of 2% (v / v) and cultured at 30℃ and 200rpm for 48h to obtain fermentation broth.

[0091] The fermentation broth of the obtained recombinant Bacillus subtilis was centrifuged at 4℃, 8000 rpm for 10 min. The supernatant after centrifugation was the crude enzyme solution obtained from fermentation. The enzyme activity of the obtained crude enzyme solution was detected by sucrase detection, and the enzyme activity data was 10.89 U / mL.

[0092] Example 2: Construction and shake-flask fermentation of recombinant Bacillus subtilis containing different signal peptides

[0093] (1) Construction of signal peptide primary screening plasmid

[0094] plasmid pBE-SP for screening signal peptides aprE -InvDz13 was constructed as follows. pBE-SP was obtained by digesting plasmid pBE-S (from the B. subtilis Secretory Protein Expression System kit from Takara) with BamHI and HindIII. aprE The fragments and enzyme digestion system are shown in Table 4. The InvDz13 fragment was digested using primers P5 / P6 with pBE-SP. aprE pBE-SP was obtained by PCR amplification using InvDz13 as a template, and then double-digested with BamHI and HindIII to obtain the pBE-SP. aprE The fragment was ligated with the InvDz13 fragment using T4 ligation, the ligation hierarchy is shown in Table 5, and E. coli JM109 was transformed to finally obtain pBE-SP. aprE -InvDz13. The primer P5 / P6 sequence information is shown in Table 6.

[0095] Table 4: Enzyme digestion reaction system

[0096] Plasmid or fragment 2μg <![CDATA[QuickCut TM BamH I]]> 2.5μL <![CDATA[QuickCut TM HindⅢ]]> 2.5μL 10×QuickCut Buffer 5μL <![CDATA[ddH2O]]> Make up to 50μL

[0097] Reaction conditions: 37℃ for 1 hour.

[0098] Table 5: T4 Connection System

[0099] Gene fragment 3.5μL Plasmid fragment 0.5μL T4 ligase 0.5μL 10×T4 Buffer 0.5μL

[0100] Reaction conditions: 22℃ for 2 hours.

[0101] pBE-SP was amplified using P7 / P8. aprE -InvDz13 yielded the pBE-InvDz13 fragment (with signal peptide SP removed). aprE The ligation was performed using the ClonExpress II One Step Cloning Kit (purchased from Vazyme) to ligate a mixture of 173 different *B. subtilis* signal peptides (from the *B. subtilis Secretory Protein Expression System* kit from Takara). The signal peptides were ligated to the 5′ end of the *InvDz13* gene. The ligation system was then directly transformed into *E. coli* JM109 and plated onto corresponding antibiotic plates for overnight incubation. The colonies were then washed off the plates using ddH2O and collected in EP tubes for plasmid extraction, yielding plasmids containing different signal peptides (SP). nThe recombinant plasmid pBE-SP n -InvDz13. The primer P7 / P8 sequence information is shown in Table 6.

[0102] Table 6: Primer Sequences

[0103] P5 cgcggatccgcaccggttgcc P6 cccaagctttcacggcagcgg P7 cgcgtccctctccttttgcttaagttcagagtag P8 ggccggtgcacatatggcaccggttgccccggct

[0104] (2) Construction and high-throughput screening of signal peptide libraries

[0105] The recombinant plasmid pBE-SP containing different signal peptides obtained in step (1) n -InvDz13 was transformed into Bacillus subtilis WB600 competent cells. The specific steps of Bacillus subtilis transformation are as described in step (4) of Example 1.

[0106] The specific steps for high-throughput screening are as follows:

[0107] After overnight incubation at 37°C on LB agar plates containing 30 μg / mL kanamycin, recombinant colonies containing different signal peptides were inoculated into LB medium containing 30 μg / mL kanamycin and incubated in 96-well plates at 37°C and 800 rpm for 10 h. Then, 60 μL of the above bacterial culture was transferred to a new 96-well plate containing 600 μL of LB medium, 30 μg / mL kanamycin was added, and the plates were incubated at 30°C and 800 rpm for 48 h. The remaining bacterial culture was stored in glycerol for later use. After incubation, the 96-well plates were centrifuged at 1000 rpm for 15 min, and the InvDz13 sucrase activity in the supernatant was measured. Strains with high sucrase activity were used for signal peptide sequencing. Approximately 1920 bacteria were screened, and 10 colonies with high sucrase activity were obtained, while other colonies served as controls. Recombinant plasmids were prepared accordingly.

[0108] pBE-SP YvcE -InvDz13、pBE-SP YbdG -InvDz13、pBE-SP YddT -InvDz13、pBE-SP YomL -InvDz13、pBE-SP YoaW -InvDz13、pBE-SP Pel -InvDz13、pBE-SP YncM -InvDz13、pBE-SP YhcR -InvDz13、pBE-SP YdjM -InvDz13 and pBE-SP FliZ -InvDz13. Among them, the signal peptide SP... YvcE SP YbdG SP YoaWSP Pel SP YhcR SP YdjM and SP FliZ Sequence information is shown in Table 7, SP YddT The nucleotide sequence of the gene is shown in SEQ ID NO.4, SP YomL The nucleotide sequence of the gene is shown in SEQ ID NO.2, SP YncM The nucleotide sequence of the gene is shown in SEQ ID NO.3.

[0109] Table 7: Signal peptide sequences

[0110]

[0111] (3) Construction of recombinant bacteria containing different signal peptides

[0112] Fragment pBHSS4-InvDz13 was generated using primers P9 / P10 with pBHSS4-SP YpuA -InvDz13 was obtained by PCR amplification using a template.

[0113] Different signal peptide sequence fragments were obtained based on the sequencing results of step (2). Fragment SP YvcE SP YbdG SP YddT SP YomL SP YoaW SP Pel SP YncM SP YhcR SP YdjM and SP FliZ Primers P11 / P12, P13 / P14, P15 / P16, P17 / P18, P19 / P20, P21 / P22, P23 / P24, P25 / P26, P27 / P28, and P29 / P30 were used respectively with pBE-SP YvcE -InvDz13、pBE-SP YbdG -InvDz13、pBE-SP YddT -InvDz13、pBE-SP YomL -InvDz13、pBE-SP YoaW -InvDz13、pBE-SP Pel -InvDz13、pBE-SP YncM -InvDz13、pBE-SP YhcR -InvDz13、pBE-SP YdjM -InvDz13 and pBE-SP FliZ-InvDz13 was obtained by PCR amplification using a template. The sequence information of primers P9 / P10, P11 / P12, P13 / P14, P15 / P16, P17 / P18, P19 / P20, P21 / P22, P23 / P24, P25 / P26, P27 / P28, and P29 / P30 is shown in Table 8.

[0114] Table 8: Primer Sequences

[0115] P9 ggatccgcaccggttgcc P10 tgatccttcctcctttaattggg P11 aattaaaggaggaaggatcaatgagaaagagtttaattacacttggttt P12 ggggcaaccggtgcggatcccgccgatgcagttttacttgt P13 aattaaaggaggaaggatcaatgaaaacattatggaaagtcctcaa P14 ggggcaaccggtgcggatcccgagacggatacaagcaaaacc P15 aattaaaggaggaaggatcaatgagaaagaaaagagttattacttgtgtta P16 ggggcaaccggtgcggatcctgcagaagcgtaacctgcagg P17 aattaaaggaggaaggatcaatgagaaagaaaagagttattacttgtgtta P18 ggggcaaccggtgcggatcctgcagtagcgtaacctgcagg P19 aattaaaggaggaaggatcaatgaaaaagatgttgatgttagctttt P20 ggggcaaccggtgcggatccagccgaagcttcccctacat P21 aattaaaggaggaaggatcaatgaaaaaagtgatgttagctacggc P22 ggggcaaccggtgcggatcctgcgttcgcgccagctgg P23 aattaaaggaggaaggatcaatggcgaaaccactatcaaaagg P24 ggggcaaccggtgcggatccagcgtctgccgcgggtaa P25 aattaaaggaggaaggatcaatgctgtctgtcgaaatgataagc P26 ggggcaaccggtgcggatccagcttcgaacgtgtacattacattta P27 aattaaaggaggaaggatcaatgttgaagaaagtcattttagccg P28 ggggcaaccggtgcggatcccgcactggcatctgatgaaa P29 aattaaaggaggaaggatcaatgaaaaagagtcaatattttattgttttta P30 ggggcaaccggtgcggatcctgccgcggcagcagcaat

[0116] Using POE-PCR to SP YvcE SP YbdG SP YddT SP YomL SP YoaW SP Pel SP YncM SP YhcR SP YdjM and SP FliZ The fragments were ligated to the pBHSS4-InvDz13 fragment, then transformed into Bacillus subtilis WB600 competent cells. Positive clones were selected to obtain recombinant B. subtilis WB600 / pBHSS4-SP containing different signal peptides. YvcE -InvDz13, B.subtilis WB600 / pBHSS4-SP YbdG -InvDz13, B.subtilis WB600 / pBHSS4-SP YddT -InvDz13, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13, B.subtilis WB600 / pBHSS4-SP YoaW -InvDz13, B.subtilis WB600 / pBHSS4-SP Pel -InvDz13, B.subtilis WB600 / pBHSS4-SP YncM -InvDz13, B.subtilis WB600 / pBHSS4-SP YhcR -InvDz13, B.subtilis WB600 / pBHSS4-SP YdjM -InvDz13, B.subtilis WB600 / pBHSS4-SP FliZ -InvDz13.

[0117] (4) Shake-flask fermentation of recombinant bacteria containing different signal peptides

[0118] The recombinant Bacillus subtilis obtained in step (3) and the recombinant strain WB600 / pBHSS4-SP prepared in Example 1 were respectively used. YpuA -InvDz13 was first inoculated into seed culture medium and cultured at 37℃ and 200rpm for 12h to obtain seed liquid. The seed liquid was then inoculated into shake flask fermentation medium at an inoculation rate of 2% (v / v) and cultured at 30℃ and 200rpm for 48h to obtain fermentation broth.

[0119] The fermentation broth of the obtained recombinant Bacillus subtilis was centrifuged at 4℃, 8000 rpm for 10 min. The supernatant after centrifugation was the crude enzyme solution obtained from fermentation. The enzyme activity of the crude enzyme solution in the fermentation supernatant was tested, and the results are shown in Table 9.

[0120] Table 9: Enzyme activities during shake-flask fermentation of different recombinant strains

[0121] <![CDATA[B.subtilis WB600 / pBHSS4-SP YpuA -InvDz13]]> 11.23 <![CDATA[B.subtilis WB600 / pBHSS4-SP YvcE -InvDz13]]> 22.70 <![CDATA[B.subtilis WB600 / pBHSS4-SP YbdG -InvDz13]]> 9.73 <![CDATA[B.subtilis WB600 / pBHSS4-SP YddT -InvDz13]]> 30.82 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13]]> 40.42 <![CDATA[B.subtilis WB600 / pBHSS4-SP YoaW -InvDz13]]> 22.75 <![CDATA[B.subtilis WB600 / pBHSS4-SP Pel -InvDz13]]> 29.55 <![CDATA[B.subtilis WB600 / pBHSS4-SP YncM -InvDz13]]> 31.48 <![CDATA[B.subtilis WB600 / pBHSS4-SP YhcR -InvDz13]]> 9.68 <![CDATA[B.subtilis WB600 / pBHSS4-SP YdjM -InvDz13]]> 17.09 <![CDATA[B.subtilis WB600 / pBHSS4-SP FliZ -InvDz13]]> 12.98

[0122] from Figure 3 As shown in Table 9, the optimal signal peptide SP was obtained through screening. YomL SP YncM and SP YddT Among them, signal peptide SP YomL Mediated recombinant Bacillus subtilis WB600 / pBHSS4-SP YomL -InvDz13 showed the highest sucrase activity during shake-flask fermentation, at 40.42 U / mL, which was lower than that of the control strain B. subtilis WB600 / pBHSS4-SP. YpuA -InvDz13 has 3.6 times the activity of sucrase in shake-flask fermentation.

[0123] Example 3: Construction and shake-flask fermentation of recombinant Bacillus subtilis strain co-expressing molecular chaperone

[0124] (1) Construction of co-expression single-molecule chaperone vectors

[0125] To improve the extracellular expression level of InvDz13 in B. subtilis and enhance the protein folding environment, the expression vector was optimized. Co-expressing molecular chaperone proteins PrsA (Gene ID: 939294), GroESL (Gene ID of groES: 938006, GenE ID of groEL: 938045), and DnaK (Gene ID: QKJ78448.1) were selected.

[0126] promoter P aprE The fragment was obtained by PCR amplification using primers P31 / P32 with the pBHSSD2 vector as a template.

[0127] actagtgttcttttctgtatgaaaaatagttatttcgagtctctacggaaatagcgagagatgatatacctaaatagagataaaatcatctcaaaa aaatgggtctactaaaatattattccatctattacaataaattcacagaatagtcttttaagtaagtctactctgaacttaagcaaaaggagagggacg cgt.

[0128] The Ter-1 terminator fragment was obtained by PCR amplification using primers P33 / P34 with pBHSSD2 vector as template: Tgcggtagtttatcacagttaaattgctaacgcagtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctg gatgctgtaggcataggcttggttatgccggtactgccgggcctatttcactttttgcattctacaaactgcataactattatgtaaatcgctccttttta ggtggcacaaatgtgaggcattttcgctctttccggcaaccacttccaagtaa.

[0129] Molecular chaperone fragments prsA, groESL, and dnaK were obtained by PCR amplification using the *B. subtilis* WB600 genome as a template, respectively, with primers P35 / P36, P37 / P38, and P39 / P40. The promoter P was then sequentially ligated using overlap-PCR. aprE The pBHSSD2 vector consists of a molecular chaperone fragment and a terminator Ter-1, forming a tandem fragment. The method for constructing the pBHSSD2 vector is disclosed in Ying Jingru. Discovery, application and expression of fructan sucrase for efficient conversion of soybean oligosaccharides [D]. Anhui University, 2023.

[0130] The linearized vector fragment was created using primers P41 / P42 with plasmid pBHSS4-SP. YomL -InvDz13 was obtained by PCR amplification using a template.

[0131] Finally, POE-PCR was used to ligate the tandem fragments and the linearized vector fragment to generate PCR products, which were named pBHSS4B1(pBHSS4-SP). YomL -InvDz13-P aprE-prsA-Ter-1), pBHSS4B2 (pBHSS4-SP YomL -InvDz13-P aprE -dnaK-Ter-1), pBHSS4B3 (pBHSS4-SP YomL -InvDz13-P aprE -groESL-Ter-1). For a detailed structural diagram, please refer to [the diagram]. Figure 2 The sequence information of primers P31 / P32, P33 / P34, P35 / P36, P37 / P38, P39 / P40 and P41 / P42 is shown in Table 10.

[0132] Table 10 Primer Sequences

[0133] P31 actagtgttcttttctgtatgaaaatagttatttcg P32 acgcgtccctctccttttgcttaagttc P33 tgcggtagtttatcacagttaaattgc P34 cacttcaacgcacctttcagcttacttggaagtggttgccg P35 cttaagcaaaaggagagggacgcgtatgaagaaaatcgcaatagcag P36 gcaatttaactgtgataaactaccgcattatttagaattgcttgaagatgaagaag P37 cttaagcaaaaggagagggacgcgtatgttaaagccattaggtgatcgcgttg P38 gcaatttaactgtgataaactaccgcattacatcattccacccataccgcccatg P39 cttaagcaaaaggagagggacgcgtatgagtaaagttatcggaatcgac P40 gcaatttaactgtgataaactaccgcattattttttgttttggtcgtcg P41 ttccggcaaccacttccaagtaagctgaaaggtgcgttgaagtgttg P42 ttcatacagaaaagaacactagtccttccaccctttcgatcaattc

[0134] (2) Construction of co-expression bimolecular chaperone vectors

[0135] To further enhance extracellular protein expression, based on the optimization of the InvDz13 sucrase-based Bacillus subtilis expression system by overexpressing single chaperone proteins DnaK, PrsA, and GroESL, we combined overexpression of dual chaperone molecules DnaK and PrsA, GroESL and PrsA, and the chaperone protein complex GrpE-DnaK-DnaJ. See the schematic diagram for details. Figure 2 Two sets of promoters and terminators are used when overexpressing dual-chaperone molecules:

[0136] 1) Promoter P aprE The fragments were obtained by PCR amplification using primers P31 / P32 with the pBHSSD2 vector as a template. The Ter-1 terminator fragment was obtained by PCR amplification using primers P33 / P34 with the pBHSSD2 vector as a template. The chaperone protein complex gene grpE-dnaK-dnaJ (SEQ ID NO.5) was obtained by PCR amplification using primers P43 / P44 with the B. subtilis WB600 genome as a template. The linearized vector fragment was obtained by PCR amplification using primers P41 / P42 with plasmid pBHSS4-SP. YomL -InvDz13 was obtained via PCR amplification using a template. Finally, POE-PCR was used to ligate the tandem fragment and the linearized vector fragment to generate the PCR product pBHSS4D1(pBHSS4-SP). YomL -InvDz13-P aprE -grpE-dnaK-dnaJ-Ter-1). For a detailed structural diagram, please refer to... Figure 2 .

[0137] 2)P 43The promoter was obtained by PCR amplification using primers P45 / P46 with the vector pBHSSD2 as a template.

[0138] Tgataggtggtatgttttcgcttgaacttttaaatacagccattgaacatacggttgatttaataactgacaaacatcaccctcttgctaaagcggccaaggacgctgccgccggggctgtttgcgtttttgccgtgatttcgtgtatca ttggtttacttattttttgccaaagctgtaatggctgaaaattcttacatttattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataaagtgatagcggtaccattataggtaagagaggaatgtacac;

[0139] Ter-2 terminator was obtained by PCR amplification using primers P48 / P49 with vector pBHSSD2 as a template: Ctgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgacca aaatcccttaacgtgagtttttcgttccactgagcgtcagaccccgtagaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctg;

[0140] The PrsA fragment was obtained by PCR amplification using primers P50 / P51 with plasmid pBHSS4B1 as a template. Then, the promoter P was ligated using overlap-PCR. 43 The three segments, namely the target segment PrsA and the terminator Ter-2, constitute the cascade segment P. 43 -PrsA-2-Ter-2. The linearized vector fragment was obtained by PCR amplification using primers P52 / P53 with plasmid pBHSS4 as a template. Finally, the tandem fragment and the vector fragment were ligated using POE-PCR to construct the PCR product pBHSS4D4(pBHSS4-SP). YomL -InvDz13-P 43 -prsA-Ter-2). For a detailed structural diagram, please refer to... Figure 2 .

[0141] 3) Serial segment PaprE -dnaK-Ter-1 and P aprE -groESL-Ter-1 was obtained by PCR amplification using primers P31 / P34 with plasmids pBHSS4B2 and pBHSS4B3 as templates, respectively. The tandem fragment P... 43 -prsA-Ter-2 was obtained by PCR amplification using primers P47 / P49 with plasmid pBHSS4D4 as a template. The linearized vector fragment was obtained by PCR amplification using primers P52 / P42 with plasmid pBHSS4B3 as a template (the original chaperone expression cassette was removed). Finally, the tandem fragment and the linearized vector fragment were ligated using POE-PCR to generate PCR products named pBHSS4D2(pBHSS4-SP). YomL -InvDz13-P aprE -dnaK-Ter-1-P 43 -prsA-Ter-2) and pBHSS4D3(pBHSS4-SP) YomL -InvDz13-P aprE -groESL-Ter-1-P 43 -prsA-Ter-2). Vector pBHSS4-SP YomL -InvDz13-P aprE -dnaK-Ter-1-P 43 -prsA-Ter-2 enables the simultaneous co-expression of the target gene InvDz13 with the chaperone proteins dnaK and prsA. The vector pBHSS4-SP YomL -InvDz13-P aprE -groESL-Ter-1-P 43 -prsA-Ter-2 enables the simultaneous co-expression of the target gene InvDz13 with the chaperone proteins groESL and prsA. See the schematic diagram for details. Figure 2 The sequence information of primers P43 / P44, P45 / P46, P47, P48 / P49, P50 / P51 and P52 / P53 is shown in Table 11.

[0142] Table 11 Primer sequences

[0143] P43 cttaagcaaaaggagagggacgcgtatgtcagaagaaaaacaaaccgttg P44 gcaatttaactgtgataaactaccgcattaatcgcctttaaacgcgcgttttac P45 tgataggtggtatgttttcgcttgaacttttaaat P46 gtgtacattcctctcttacctataatggtaccgcta P47 tctttccggcaaccacttccaagtaatgataggtggtatgttttcgcttgaac P48 ctgtcagaccaagtttactcatatatactttagattg P49 accaacacttcaacgcacctttcagccagattacgcgcagaaaaaaaggatct P50 cattataggtaagagaggaatgtacacatgaagaaaatcgcaatagca P51 tgagtaaacttggtctgacagttatttagaattgcttgaagatg P52 agatcctttttttctgcgcgtaatctggctgaaaggtgcgttgaagtgttggt P53 caagcgaaaacataccacctatcaccttccaccctttcgatcaattcca

[0144] (3) Construction of recombinant Bacillus subtilis strains co-expressing molecular chaperones

[0145] The POE-PCR product pBHSS4B1 (pBHSS4-SP) YomL -InvDz13-P aprE-prsA-Ter-1), pBHSS4B2 (pBHSS4-SP YomL -InvDz13-P aprE -dnaK-Ter-1), pBHSS4B3(pBHSS4-SP YomL -InvDz13-P aprE -groESL-Ter-1), pBHSS4D1(pBHSS4-SP YomL -InvDz13-P aprE -grpE-dnaK-dnaJ-Ter-1), pBHSS4D2(pBHSS4-SP YomL -InvDz13-P aprE -dnaK-Ter-1-P 43 -prsA-Ter-2) and pBHSS4D3 (pBHSS4-SP) YomL -InvDz13-P aprE -groESL-Ter-1-P 43 -prsA-Ter-2) were transformed into Bacillus subtilis WB600 competent cells, respectively, to obtain recombinant transformants, namely Bacillus subtilis recombinant strains WB600 / pBHSS4-SP co-expressing molecular chaperones. YomL -InvDz13-prsA, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-dnaK, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL, B.subtilisWB600 / pBHSS4-SP YomL -InvDz13-grpE-dnaK-dnaJ, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-dnaK-prsA and B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL-prsA.

[0146] (4) Shake-flask fermentation of recombinant Bacillus subtilis co-expressing molecular chaperone

[0147] The recombinant Bacillus subtilis obtained in step (3) was first inoculated into a seed culture medium and cultured at 37°C and 200 rpm for 12 h to obtain a seed liquid. The seed liquid was then inoculated into a shake flask fermentation medium at an inoculation rate of 2% (v / v) and cultured at 30°C and 200 rpm for 48 h to obtain a fermentation broth.

[0148] The fermentation broth of the obtained recombinant Bacillus subtilis was centrifuged at 4℃, 8000 rpm for 10 min. The supernatant after centrifugation was the crude enzyme solution obtained from fermentation. The enzyme activity of the crude enzyme solution in the fermentation supernatant was tested, and the results are shown in Table 12.

[0149] Table 12: Enzyme activities during shake-flask fermentation of different recombinant strains

[0150] <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13]]> 41.15 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-prsA]]> 39.49 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-dnaK]]> 29.31 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL]]> 16.31 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-grpE-dnaK-dnaJ]]> 56.25 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-dnaK-prsA]]> 19.96 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-groESL-prsA]]> 27.22

[0151] from Figure 4 As can be seen from Table 12, the recombinant Bacillus subtilis strain WB600 / pBHSS4-SP YomL The sucrase activity in the fermentation supernatant of -InvDz13-grpE-dnaK-dnaJ reached 56.25 U / mL, which is higher than that of recombinant Bacillus subtilis WB600 / pBHSS4-SP. YomL -1.37 times that of InvDz13.

[0152] Example 4: Construction and shake-flask fermentation of recombinant Bacillus subtilis strain co-expressing secretion element protein

[0153] (1) Construction of vectors for co-expressing secretion pathway elements

[0154] pBHSS4-SP YomL The InvDz13 vector was prepared using primers P54 / P55 as described in Example 3, using pBHSS4-SP. YomL The fragments secA (GENE ID: 936711), sipS (GENE ID: 938944), sipT (GENE ID: 938763), sppA (nucleotide sequence as shown in SEQ ID NO. 6), and tepA (GENE ID: 936370) were obtained by PCR amplification using the *B. subtilis* WB600 genome as a template, respectively, using primers P56 / P57, P58 / P59, P60 / P61, P62 / P63, and P64 / P65. Finally, the tandem fragments and the linearized vector fragments were ligated using POE-PCR to generate PCR products, named pBHSS4F1 (pBHSS4-SP). YomL -InvDz13-P aprE -secA-Ter-1), pBHSS4F2(pBHSS4-SP YomL -InvDz13-P aprE-sipS-Ter-1), pBHSS4F3(pBHSS4-SP YomL -InvDz13-P aprE -sipT-Ter-1), pBHSS4F4(pBHSS4-SP YomL -InvDz13-P aprE -sppA-Ter-1 ) and pBHSS4F5 (pBHSS4-SP YomL -InvDz13-P aprE -tepA-Ter-1). For a schematic diagram showing the specific locations where these components are connected to the carrier, please refer to [reference needed]. Figure 2 The sequence information of primers P54 / P55, P56 / P57, P58 / P59, P60 / P61, P62 / P63 and P64 / P65 is shown in Table 13.

[0155] Table 13 Primer sequences

[0156] P54 tgcggtagtttatcacagttaaattg P55 acgcgtccctctccttttg P56 gcaaaaggagagggacgcgtatgcttggaattttaaataaaatgtttg P57 aactgtgataaactaccgcactattcagtacggccgcagc P58 gcaaaaggagagggacgcgtttgaaatcagaaaatgtttcgaaga P59 aactgtgataaactaccgcactaatttgttttgcgcatttcg P60 gcaaaaggagagggacgcgtttgaccgaggaaaaaaatacgaa P61 aactgtgataaactaccgcattattttgtttgacgcatttcgtt P62 gcaaaaggagagggacgcgtatgaatgcaaaaagatggattgc P63 aactgtgataaactaccgcactacttcgcatagagatacatcattctc P64 gcaaaaggagagggacgcgtatggatcatcgtatggaaaacaca P65 aactgtgataaactaccgcatcattgaatcatccgtccttctt

[0157] (2) Construction of recombinant Bacillus subtilis strains co-expressing secretion pathway elements

[0158] The POE-PCR products pBHSS4F1, pBHSS4F2, pBHSS4F3, pBHSS4F4, and pBHSS4F5 were transformed into Bacillus subtilis WB600 competent cells to obtain recombinant transformants, which are recombinant Bacillus subtilis WB600 / pBHSS4-SP strains that co-express secretion pathway elements. YomL -InvDz13-secA, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipS, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipT, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sppA, B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-tepA.

[0159] (3) Shake-flask fermentation of recombinant Bacillus subtilis co-expressing secretion pathway elements

[0160] The recombinant Bacillus subtilis obtained in step (2) was first inoculated into a seed culture medium and cultured at 37°C and 200 rpm for 12 h to obtain a seed liquid. The seed liquid was then inoculated into a shake flask fermentation medium at an inoculation rate of 2% (v / v) and cultured at 30°C and 200 rpm for 48 h to obtain a fermentation broth.

[0161] The fermentation broth of the obtained recombinant Bacillus subtilis was centrifuged at 4℃, 8000 rpm for 10 min. The supernatant after centrifugation was the crude enzyme solution obtained from fermentation. The enzyme activity of the crude enzyme solution in the fermentation supernatant was tested, and the results are shown in Table 14.

[0162] Table 14: Enzyme activities during shake-flask fermentation of different recombinant strains

[0163] <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13]]> 41.55 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-secA]]> 39.01 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipT]]> 52.90 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sppA]]> 61.14 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-tepA]]> 47.57 <![CDATA[B.subtilis WB600 / pBHSS4-SP YomL -InvDz13-sipS]]> 36.58

[0164] from Figure 5 As can be seen from Table 14, the recombinant Bacillus subtilis strain WB600 / pBHSS4-SP YomL The sucrase activity in the fermentation supernatant of -InvDz13-sppA reached 61.14 U / mL, which is typical for recombinant Bacillus subtilis WB600 / pBHSS4-SP. YomL -1.47 times that of InvDz13.

[0165] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant Bacillus subtilis, characterized in that, The recombinant Bacillus subtilis used Bacillus subtilis WB600 as the expression host and employed SP... YomL Understanding signal peptide expression in *Trichoderma unilateralis* (TSM) Microbacterium trichothecenolyticum The enzyme InvDz13, derived from sucrase, was co-expressed with secretory pathway proteins. sppA ; The SP YomL The nucleotide sequence of the signal peptide is shown in SEQ ID NO.2; encoding the secretion pathway protein. sppA The nucleotide sequence is shown in SEQ ID NO.6; the nucleotide sequence encoding the sucrase InvDz13 is shown in SEQ ID NO.

1.

2. A method for increasing the expression level of sucrase in Bacillus subtilis, characterized in that, Recombinant Bacillus subtilis was expressed using Bacillus subtilis WB600 as the expression host and SP was used. YomL Signal peptide expression revealed the sucrase InvDz13 derived from *Trichoderma solani*, and co-expressed secretion pathway proteins. sppA ; The SP YomL The nucleotide sequence of the signal peptide is shown in SEQ ID NO.2; encoding the secretion pathway protein. sppA The nucleotide sequence is shown in SEQ ID NO.6; the nucleotide sequence encoding the sucrase InvDz13 is shown in SEQ ID NO.

1.

3. A method for preparing sucrase, characterized in that, The method is to prepare the recombinant Bacillus subtilis by fermentation as described in claim 1.

4. The method according to claim 3, characterized in that, The method involves first inoculating the recombinant Bacillus subtilis into a seed culture medium and culturing it at 35-38℃ and 180-220 rpm for 8-12 h to obtain a seed liquid; then inoculating the seed liquid into a fermentation culture medium at an inoculation rate of 1%-3% and culturing it at 30-37℃ and 180-220 rpm for 45-50 h to obtain a fermentation broth containing sucrase.

5. The use of the recombinant Bacillus subtilis according to claim 1 in the preparation of sucrase or food, detergents, paper products, textiles, alcoholic beverages and pharmaceuticals containing sucrase.

Images